ID: 1146533589

View in Genome Browser
Species Human (GRCh38)
Location 17:33631056-33631078
Sequence CTGGGTAAGGAGCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 391}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146533589 Original CRISPR CTGGGTAAGGAGCAAGTGGA AGG Intronic
900202937 1:1419427-1419449 CTGGGTGACCAGCAACTGGACGG + Exonic
900780953 1:4616925-4616947 CTGGGTGAGCAGCAAGTTGGAGG - Intergenic
900783973 1:4636190-4636212 CTGGTTATGGAGCAGATGGATGG - Intergenic
900940769 1:5797220-5797242 CTGAGTAGGGAGCAAGGGGCTGG - Intergenic
902234311 1:15047934-15047956 CTGGGTAAGGGGCAAGTAAGTGG - Intronic
903134931 1:21303082-21303104 CTGGGAAAGCAGCCAGTGGTGGG - Intronic
904274173 1:29369579-29369601 CTGGGTATGGAGTGAGTGGAGGG - Intergenic
904364462 1:30001669-30001691 CTGGGTGTGGAGTGAGTGGAGGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
904952903 1:34258660-34258682 CTGTGTTAGGAGCCAGTGCAGGG + Intergenic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
909344608 1:74571358-74571380 CTAGGACAGGAGCAAGAGGAAGG - Exonic
909676209 1:78241657-78241679 CTGTGGAAGAAGCAACTGGAAGG - Intergenic
910245324 1:85132662-85132684 CTGGGAAAGGAGGGAGTGGGGGG - Intronic
910689694 1:89953464-89953486 GTGGGTAGGGAGCAAGGGAAGGG - Intergenic
911691491 1:100839767-100839789 GGGGGTAGGGAGCAAGGGGAGGG - Intergenic
911749781 1:101482765-101482787 CTGTGCAAGCAGCAAGTGGTGGG + Intergenic
911816598 1:102359949-102359971 GGGGGTAAGGGGCAAGGGGAGGG + Intergenic
911971238 1:104440516-104440538 CTGGGTAAAAAGCAAGTGGATGG - Intergenic
912528807 1:110305240-110305262 CTGGGTACGGAGCAAGTGAGTGG + Intergenic
913191105 1:116413670-116413692 ATGGGTAAAGACCAAGGGGAGGG - Intergenic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916070052 1:161164805-161164827 CTGGTTAAGGAGCATTTGGGAGG - Intronic
916878954 1:169000355-169000377 CTGGGTATGGAACAAGTCTAGGG - Intergenic
917333205 1:173903708-173903730 CTGGGTAAAGAACAACTTGAAGG + Intergenic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
918465432 1:184817017-184817039 CAGGGTGAGGGGCAGGTGGAGGG - Intronic
922208054 1:223466538-223466560 CTGGGTGAGGATCATGTAGAAGG - Intergenic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
922919106 1:229285630-229285652 GTGGGTCAGGAGCAAGGGTAAGG + Intronic
923322426 1:232847875-232847897 CTGGGGAAGGAGCAAGAGCATGG + Intergenic
1063943234 10:11152121-11152143 CTTGGGTAGGAGTAAGTGGATGG + Intronic
1064264018 10:13809856-13809878 CTTGGTGAGATGCAAGTGGAAGG - Intronic
1064265744 10:13823888-13823910 CTGGAAAAGTAGCAAGTGGCTGG - Intronic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070430997 10:76337500-76337522 CTGAGGAAGGAGCAAGTGCAAGG + Intronic
1070442682 10:76462454-76462476 CTGGGTGAAGAGGAAGAGGATGG - Intronic
1070721935 10:78762988-78763010 CTGAGTAGGGAGCTATTGGAGGG - Intergenic
1071026265 10:81117632-81117654 CGGGGAAAGGAGGAAGGGGAGGG + Intergenic
1071361615 10:84851804-84851826 CAGGGTACTGAGCAAGGGGAAGG - Intergenic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1073004847 10:100315417-100315439 CGGGGTAGGGGGCAAGGGGAGGG - Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073245637 10:102088231-102088253 TGGGGTAAGGGACAAGTGGAGGG - Intergenic
1073533330 10:104253163-104253185 CTGGGGAGGGAGCGAGTGGGTGG + Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076425242 10:130363019-130363041 CTGGGCAAGTAGCAACTTGATGG + Intergenic
1078557387 11:12341023-12341045 CTGTGTAAGGAGCCTGTGGGAGG + Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080783794 11:35455932-35455954 CTGGGGAATAAGTAAGTGGAAGG - Intronic
1080804066 11:35635848-35635870 GTGGGTCATGAGCAAGTGGCAGG - Intergenic
1081520534 11:43877126-43877148 CTGGGGAAGTAGCCACTGGATGG + Intergenic
1083779906 11:64912376-64912398 CGGGGTCAGGAGCAGGTGCAGGG + Exonic
1084323162 11:68384721-68384743 GGGGGTCAGGAGCATGTGGAGGG + Intronic
1084766188 11:71310332-71310354 GTGGGTAAGGAAGAAGTGAAAGG + Intergenic
1084786013 11:71442041-71442063 CTGGGTAAGGAGGGAATGGATGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085742933 11:79092360-79092382 CTGGGAAAGGTGCATGAGGAGGG - Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086521445 11:87672573-87672595 CTGAGTTTGGAGCAAGTGCAGGG + Intergenic
1088570749 11:111221476-111221498 CTGGGGATGGAGCAAGTGGTTGG - Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089173872 11:116534740-116534762 CAGGGTAAGGAGGAATGGGAAGG + Intergenic
1089890953 11:121880122-121880144 CTGAGAAAGAAGCCAGTGGATGG - Intergenic
1090142174 11:124277071-124277093 CTGGGAAAGGAGTGAGTGAAGGG + Intergenic
1091365007 11:135011320-135011342 GTGGGTAGGGGGCTAGTGGAGGG - Intergenic
1094121990 12:26984849-26984871 CTAGGACAGGAGCAAGTTGAAGG + Intronic
1095575665 12:43735375-43735397 CTGGACAAGGAGGAAATGGAAGG + Intronic
1096345702 12:50844339-50844361 CTGGGTAGGGGGCTAGGGGAGGG - Intronic
1097269240 12:57764309-57764331 CTGGGGAAGCAACTAGTGGATGG - Intronic
1097340569 12:58433040-58433062 TGGGGGAAAGAGCAAGTGGAGGG - Intergenic
1097340623 12:58433726-58433748 TGGGGGAAAGAGCAAGTGGAGGG + Intergenic
1098088761 12:66878460-66878482 CTGGGAGAGGAGAAAATGGAGGG + Intergenic
1100177645 12:92049425-92049447 CTGTGTAATGAACAAGAGGATGG + Intronic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1102182691 12:110924097-110924119 CTGGGGAGGGAGCGAGTGGGCGG + Intergenic
1102601824 12:114037233-114037255 CTGGGAAGGGAGCGAGGGGAGGG - Intergenic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103978626 12:124720987-124721009 CTGTGGAAGGAACAAGGGGAGGG + Intergenic
1104477748 12:129084448-129084470 CAGGCTAAGGAGGAAGTGTACGG - Intronic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1110752886 13:79136368-79136390 AGGGGTAGGGAGCAAGGGGAGGG + Intergenic
1111381930 13:87467016-87467038 CTGTGTAATGACCAAGTGAAGGG + Intergenic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112769422 13:102779831-102779853 CAGGGTAGGGAGTCAGTGGATGG + Intergenic
1112776979 13:102854976-102854998 CTGGGAAAGGAAGAGGTGGAGGG - Intronic
1118496731 14:66314966-66314988 GGGGGTGGGGAGCAAGTGGAAGG - Intergenic
1118602702 14:67481775-67481797 CTGAGCAAGGAGCTAGTGGAAGG - Intronic
1119758941 14:77138127-77138149 CAGGGTAGGGAGGAAGTGGAAGG + Intronic
1121123766 14:91392982-91393004 CTGGGGAAGGAGAAACTGCAAGG + Intronic
1121696639 14:95918680-95918702 CTGACTCAGGAGGAAGTGGAGGG - Intergenic
1122100945 14:99409117-99409139 CTGGGCGAGGAGGAGGTGGAAGG - Intronic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1122732702 14:103813041-103813063 TTGGGTAAAGACCAAGTGGTGGG - Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123165801 14:106324112-106324134 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123168498 14:106349140-106349162 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123176187 14:106421566-106421588 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123178533 14:106445012-106445034 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1123194756 14:106605974-106605996 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123198381 14:106638976-106638998 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1123222815 14:106872687-106872709 CCGGGTCAGGAGCAGGTGCAGGG - Intergenic
1202947497 14_KI270726v1_random:41999-42021 CCGGGTCAGGAGCAGGTGCAGGG + Intergenic
1124699412 15:31899396-31899418 ATGGGTGGGGAGCAAGGGGAGGG + Intergenic
1127292010 15:57579604-57579626 CTGGGTGAGGAGGATGTGGGTGG - Intergenic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1128230745 15:66033356-66033378 CTGGGCATGGAGCCTGTGGAGGG - Intronic
1128737462 15:70061304-70061326 CAGGGAAAGGAGCAAGGGCAGGG + Intronic
1129265047 15:74388885-74388907 CTGGGTAGGGAACAAGGGGCAGG - Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129361721 15:75028684-75028706 CTGGGAAAGGACCCAGTGAACGG + Intronic
1130399099 15:83532549-83532571 CTGGGTATGAAGGAATTGGATGG + Intronic
1131132993 15:89912285-89912307 CTGGGTGAGGAGGATTTGGAGGG - Intronic
1131177240 15:90217744-90217766 CTGGGGAATGAGAAAGGGGAAGG - Intronic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1134805463 16:17120393-17120415 TGGAGCAAGGAGCAAGTGGAAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1135524732 16:23205754-23205776 CTGGGGATGGAACAGGTGGATGG - Intronic
1135662078 16:24305645-24305667 CTGGGTGGGGAGCAAGAGGAGGG + Intronic
1135863908 16:26082817-26082839 CTTGGTAAGATGCAAGGGGATGG - Intronic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1138053687 16:53810493-53810515 CAGGATAAGGAGCAAAAGGAAGG - Intronic
1139471761 16:67181763-67181785 CTGCAATAGGAGCAAGTGGAGGG - Intronic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140592335 16:76368672-76368694 TGGGGTAAGGGGCAAGGGGAGGG + Intronic
1140986049 16:80158958-80158980 CTGGGTCAGGAAAAAGTTGAGGG + Intergenic
1141629081 16:85277080-85277102 CTGGGGAAGGAGCTGGGGGAGGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1143182811 17:4994358-4994380 CTGGGTGGGGAGCATGGGGATGG - Intronic
1143591827 17:7889585-7889607 GTGGGGAAGGGGCAAGTTGAGGG + Intronic
1144591533 17:16528319-16528341 ATGGGTAATGAGAAAGGGGAGGG + Intergenic
1144755255 17:17676302-17676324 CTGGAATAGGAGAAAGTGGAGGG - Intergenic
1145104116 17:20100806-20100828 GTGGGTAGGGGGCAAGGGGAGGG - Intronic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146859615 17:36285790-36285812 CTGGGGAAGGAGCAAGGAAAAGG - Intronic
1146919690 17:36702439-36702461 CTGGGAAAGGAAGAAGTGCATGG - Intergenic
1147047402 17:37763713-37763735 GTGGGTAGGGGGCAAGGGGAGGG - Intergenic
1147089939 17:38089877-38089899 CTGGGGAAGGAGCAAGGAAAAGG - Intergenic
1147107272 17:38230644-38230666 CTGGGGAAGGAGCAAGGAAAAGG + Intergenic
1148422253 17:47557892-47557914 CTGGGGAAGGAGCAAGGAAAAGG - Intronic
1148458292 17:47822656-47822678 CTCGGTGAGGATGAAGTGGAAGG - Intergenic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154980891 18:21501404-21501426 ATGGGTGAGGGGCAAGAGGAGGG - Intronic
1156635329 18:39021051-39021073 GTGGGTGAGGAGCTAGGGGAGGG - Intergenic
1157278439 18:46329323-46329345 CTGGAAAAGGTGGAAGTGGAGGG - Intronic
1157647653 18:49292967-49292989 GTGGGTAAGGGGCTAGAGGAGGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158546108 18:58398833-58398855 CTGGGTAAGGAGCAGTTGCTGGG + Intronic
1158547674 18:58409928-58409950 CTGGGAAGGGAACAAGTGGGAGG - Intergenic
1159913144 18:74165237-74165259 CTGGGGAAGGAAGGAGTGGATGG - Intergenic
1160130782 18:76223172-76223194 CTGGGGAAGGAGCACATGAAAGG - Intergenic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1166329333 19:42069508-42069530 AGGGGGAAGGAGCAAATGGAGGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
925003567 2:425258-425280 CCTGGCAAGGAGCGAGTGGATGG - Intergenic
927485220 2:23484175-23484197 GTGGTCTAGGAGCAAGTGGAGGG - Intronic
927638221 2:24831345-24831367 CTGGGTAGAGAGGAAGTGGAGGG - Intronic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
929208981 2:39332375-39332397 ATGGGTATGGAGAAAGTGAATGG - Intronic
929249768 2:39739811-39739833 CTGAGCAAGGAAGAAGTGGATGG + Intronic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929723098 2:44391788-44391810 CGGGGTATGGAACAAGTTGATGG - Intronic
929817009 2:45240541-45240563 CGGGGTAGGGGGCAAGGGGAGGG + Intergenic
930870495 2:56166131-56166153 GTGGGTAGGGAGCTAGGGGAGGG + Intergenic
931412939 2:62052071-62052093 ATAGGTAAGGAGCAACAGGATGG - Intronic
931688928 2:64818723-64818745 CTGGGCAAGGAGCAAGCTGCAGG - Intergenic
932451221 2:71812006-71812028 CTGGGAATCCAGCAAGTGGAAGG + Intergenic
932759250 2:74428738-74428760 CTGGGGGAGGAGGAAGTGCAGGG + Intronic
933747820 2:85583773-85583795 CTGACTGAGGAGCAAGTGCATGG + Intergenic
933866515 2:86523151-86523173 TTGGGTACCGAGCAAGTGGGAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936736970 2:115456811-115456833 GTGGGTGAGGAGCTAGGGGAGGG + Intronic
936838619 2:116740889-116740911 CTGGCAAAGGAGAAAGGGGAAGG + Intergenic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937760172 2:125591180-125591202 GTGGGTAGGGGGCAAGAGGAGGG + Intergenic
938423785 2:131167245-131167267 CGGGGTGGGGGGCAAGTGGAGGG - Intronic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938923883 2:136021107-136021129 CTGGGTCAAGAGAATGTGGATGG + Intergenic
938960001 2:136332211-136332233 GTGGGAAAGGTGCATGTGGAAGG + Intergenic
939324393 2:140669377-140669399 ATGGGTTAATAGCAAGTGGAGGG + Intronic
940083716 2:149834230-149834252 CAGGGTAGGGGGCTAGTGGAGGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940407519 2:153322643-153322665 GTGGGTGGGGAGCAAGGGGAGGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
942964845 2:181879506-181879528 CTGGGTGAGGAGAGAGTGGTAGG - Intergenic
943038963 2:182781108-182781130 CGGGGTAGGGGGCAAGGGGAAGG - Exonic
943361032 2:186919608-186919630 CTTGGAAAGGAGTATGTGGATGG - Intergenic
943958269 2:194222248-194222270 ATGGGTAATAAGCCAGTGGAAGG + Intergenic
944109285 2:196114688-196114710 GGGGGTAGGGAGCAAGGGGAGGG - Intergenic
946199766 2:218064833-218064855 CTGGGTGGGGAGGAACTGGAGGG - Intronic
946365708 2:219247754-219247776 CTGGGTGAGGAGCATGTGGGTGG + Exonic
947523968 2:230867371-230867393 CTGGGTAAGGAGGAAATGTGCGG - Intronic
947753178 2:232543299-232543321 CTGGGCCAGGAGCACGTTGATGG - Exonic
947909705 2:233792953-233792975 CTGGGTAAGGAGCAGATGGAGGG + Intronic
948735065 2:239998236-239998258 CTGGGTAAGGAGGAAAGTGAAGG - Intronic
948944451 2:241212385-241212407 CTGGGTAGGGACCAAGAGGTGGG - Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1171114977 20:22517646-22517668 ATGGCTAATGAGCAGGTGGAAGG + Intergenic
1172548274 20:35778973-35778995 TTGGGGAAGGAGCAAGAGGAGGG + Intronic
1172779662 20:37428692-37428714 CTGGGGAAGGAGCAAGTTTGTGG - Intergenic
1172974027 20:38893561-38893583 CTGGGAAGGGAGGAAGTGGGAGG + Intronic
1173285615 20:41669142-41669164 CTGGGTAAAGAACAAATGGGTGG + Intergenic
1174509589 20:51041026-51041048 TGGGGGAAGGAGGAAGTGGAGGG - Intergenic
1175917713 20:62434663-62434685 TTGGAAAAGGAGCAAGTGAAGGG + Intergenic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1177064981 21:16419377-16419399 CTGGGAAGGGAGCCAATGGAAGG - Intergenic
1177158107 21:17519143-17519165 CAGGGTAAGGAGCCAATGTAGGG - Intronic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1179874028 21:44258504-44258526 GTCGGTAAGGAGCCCGTGGAGGG - Exonic
1180680450 22:17622498-17622520 CTGGGTGGGGAGCTAGGGGAGGG + Intronic
1181153650 22:20903233-20903255 GTGGGGAAGGAGCAAGTGAAAGG + Intergenic
1182482657 22:30619455-30619477 CAGGGTGAGAAGCAAGTGTAAGG - Intronic
1182915099 22:34022073-34022095 ATGGGAAAGGGGCAAGTGAAAGG + Intergenic
1183630827 22:39031671-39031693 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1183634343 22:39052051-39052073 CTGGGGAAGGAGGAGGAGGAGGG - Intronic
1184227344 22:43136632-43136654 TTGGGGAAGTAGCAAATGGAAGG + Intronic
1184314531 22:43674465-43674487 CTGGGTCACGAGGAACTGGAAGG + Intronic
1184731251 22:46372289-46372311 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184731264 22:46372341-46372363 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184776361 22:46625480-46625502 CTGGGCCAGGAGCAAGGAGATGG - Intronic
1185001061 22:48246199-48246221 CTGCTTAAGGACCCAGTGGAAGG - Intergenic
1185035349 22:48473343-48473365 CCGGGTCAGGATCACGTGGAGGG - Intergenic
1185289420 22:50016136-50016158 CTGGGCCAGGACCAAGTGGGTGG + Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950419940 3:12892716-12892738 CTGGGTAGGGTGCAAGGGCAGGG - Intergenic
951143381 3:19195659-19195681 CTGGGTAATTATCAAGTAGATGG - Intronic
951185352 3:19706206-19706228 CTAGTTAAGGAGGAAGAGGAAGG + Intergenic
951990344 3:28669652-28669674 CTTGGTGAGCTGCAAGTGGATGG + Intergenic
952355301 3:32578516-32578538 CTAGGTGAGAAGCAAGAGGAAGG - Intergenic
952607467 3:35167316-35167338 TGGGGTGAGGAGCAAGTGGAGGG - Intergenic
952782939 3:37121692-37121714 CTGGGAAAGGAGAAAGTACATGG + Intronic
952895192 3:38074026-38074048 CTGTGTAAGGACCCACTGGAAGG - Intronic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953027208 3:39152210-39152232 ATGGGTAAGGAACAGGAGGAGGG + Intronic
953037252 3:39223736-39223758 GGGGATAAGGAGCAAGGGGAGGG + Intergenic
955421270 3:58740373-58740395 CTGCTCAAGGAGCAAGAGGATGG - Intronic
956160545 3:66346858-66346880 CTGTGTAAGGACCACTTGGATGG + Intronic
956382682 3:68682696-68682718 GTGGGTAGGGAGCTAGGGGAGGG - Intergenic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
957284586 3:78202020-78202042 CTGGGTACTGAGCAGGTGGCTGG - Intergenic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
959278733 3:104310315-104310337 GGGGGTAAGGTGCAAGGGGAGGG + Intergenic
960828430 3:121817258-121817280 GGGGGTAGGGAGCAAGGGGAGGG + Intronic
960997310 3:123348654-123348676 GTGGGAGAGAAGCAAGTGGAGGG + Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
961995739 3:131240181-131240203 CTGAGAAAGGAGCCAGAGGAAGG - Intronic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
963826009 3:149954400-149954422 GTGGGTAAGGAGTAAGGGTAAGG - Intronic
965231445 3:166058386-166058408 TTGGGTGGGGAGCAAGGGGAGGG + Intergenic
966430409 3:179826245-179826267 CTGGGTAAGGAGGAAGAGAAAGG - Intronic
967218496 3:187229741-187229763 CTAGGTAGGGAGAAGGTGGAAGG - Intronic
967788915 3:193526453-193526475 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
967808184 3:193733343-193733365 CTGGGTAGGGAGCAGGTGCAGGG + Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
970803162 4:20000813-20000835 CTGGGAAAGCATCAAGGGGAAGG + Intergenic
971510850 4:27421618-27421640 GGGGGTGAGGAGCAAGGGGAGGG - Intergenic
972058924 4:34842463-34842485 CTGTGTAAAGATCAAGTGCACGG - Intergenic
972734336 4:41826186-41826208 CTGGAGGAGGAGCAAGTGGGTGG - Intergenic
972806004 4:42529959-42529981 CTGGGGAAGAAGTATGTGGATGG + Intronic
973995055 4:56450171-56450193 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
974755156 4:66196012-66196034 CTGGGGAGGGAACAAGTGGGAGG - Intergenic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
976544012 4:86312400-86312422 GTGAGTAAGGAGCACTTGGAAGG - Intronic
977660905 4:99584853-99584875 TTGGGGAAGGAGGGAGTGGAAGG - Intronic
978948029 4:114522712-114522734 GGGGGTCAGGAGCAAGGGGATGG - Intergenic
980277498 4:130673667-130673689 CTAGGGAGGGAGGAAGTGGAGGG - Intergenic
980985693 4:139692300-139692322 CTGGGTGAGCAGCAGGTGGCTGG - Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
982826663 4:160010981-160011003 CTGGGGATGGAGCAGGTGGTTGG + Intergenic
983255933 4:165400618-165400640 ATGGATAAGGAGTAAGTGAAGGG + Intronic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983439580 4:167764333-167764355 TTTGGTAAGGAGCAATTGGGAGG + Intergenic
983566898 4:169162939-169162961 CTGGGTAAGGAGAGGATGGAGGG - Intronic
984549257 4:181141130-181141152 CTGGGTAAAGAGGAAATTGAGGG - Intergenic
985670954 5:1206505-1206527 CTGGCTAAGGAGACAGTGGCTGG + Intronic
985790866 5:1926327-1926349 CTGGGACAGGAGCAAGGGAAGGG - Intergenic
985913450 5:2900533-2900555 CTGGGGAGGGAGAAAGTGGAGGG - Intergenic
986527855 5:8700034-8700056 GTGGGTAGGGAGCTAGGGGAGGG + Intergenic
986891980 5:12320384-12320406 CAGTGTGAGGAGGAAGTGGATGG + Intergenic
990197822 5:53338215-53338237 CTGGGGAAGAGGCAAGTAGATGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
992267561 5:75033827-75033849 GGGGGTGAGGAGCAAGGGGAGGG - Intergenic
992325419 5:75655193-75655215 CTGGGTAAGAAGCCAGTGGTTGG + Intronic
993070416 5:83155070-83155092 CTGGGGCAGGAGAAAGAGGAAGG + Intronic
993077935 5:83258038-83258060 GTGGGTGAGGAGCAAGAGGAGGG + Intronic
993554961 5:89325253-89325275 CTGATAAAGGAGGAAGTGGAAGG - Intergenic
993840903 5:92877149-92877171 CTGGGAAAGGAGGAAGAGCATGG - Intergenic
994584740 5:101692532-101692554 CTGGGTATTGGGCAAGGGGAGGG - Intergenic
995507978 5:112880296-112880318 CTTGGTAATTAGAAAGTGGAAGG - Intronic
995946110 5:117648352-117648374 GTGGGTGGGGAGCAAGGGGAGGG - Intergenic
996786848 5:127246454-127246476 CGGGGTGGGGAGCAAGGGGAGGG + Intergenic
996811438 5:127519966-127519988 CTGGGTATGGAGGAAGGGAAAGG - Intronic
997158464 5:131582069-131582091 CTGGGAAAGGAGTCAGTGAATGG - Intronic
997753726 5:136374874-136374896 CTAAGTTAGGACCAAGTGGATGG - Intronic
997822899 5:137082094-137082116 CTGGCCATGGAGCAAGTGGTGGG - Intronic
998542509 5:142996041-142996063 GGGGGTGGGGAGCAAGTGGAGGG + Intronic
999389717 5:151181161-151181183 CTGGAGAAGGAGCAAGTTGTGGG - Exonic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000421210 5:161039903-161039925 GTGGGTAGGGGGCAAGGGGAGGG + Intergenic
1000421260 5:161040368-161040390 GTGGGTAGGGGGCAAGGGGAGGG + Intergenic
1001416353 5:171547027-171547049 GCGGGTGAGGAGCAAGGGGAGGG - Intergenic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1002792237 6:445121-445143 CTGGGGAGGAAGCGAGTGGATGG + Intergenic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1004352405 6:14901809-14901831 GTGGGTGAGGAGCTAGGGGAGGG + Intergenic
1005481212 6:26257280-26257302 GAGGGTAAGGAGCAAGTGCAAGG + Intergenic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1009413938 6:63395729-63395751 CTGGGGAAGGATCAAGAGGCTGG + Intergenic
1010937139 6:81875583-81875605 CAGGGTGAGGAGCTAGGGGAAGG + Intergenic
1011705407 6:89996194-89996216 TTGGGTAGGGAGCACATGGATGG - Intronic
1012082520 6:94779573-94779595 GTGGGTAGGGGGCAAGGGGAGGG - Intergenic
1012266173 6:97145976-97145998 CTGGCTAAAGAGCAAGAAGATGG + Exonic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1012768330 6:103397402-103397424 CTGGGAATGGAGCTAGGGGAGGG + Intergenic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014221976 6:118806926-118806948 CTGGGAAAGGAGCAAGTTCAGGG + Intergenic
1014351355 6:120350049-120350071 CTGGATGAAGAGCAAGAGGAGGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014638624 6:123880510-123880532 CTGGTTAAGGAGAGAATGGATGG + Intronic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1019147144 6:169982790-169982812 CAGGCTGAGAAGCAAGTGGAAGG + Intergenic
1019147652 6:169985328-169985350 CAGGCTGAGAAGCAAGTGGAAGG - Intergenic
1019153801 6:170025753-170025775 ATGGGGAGGGAGCATGTGGACGG + Intergenic
1019358807 7:594507-594529 CTAGGTAAGGACAGAGTGGAGGG + Intronic
1020716586 7:11681201-11681223 GGGGGTGGGGAGCAAGTGGAGGG + Intronic
1021763261 7:23921862-23921884 GTGGATAGGGAGAAAGTGGAGGG + Intergenic
1022873493 7:34503998-34504020 CTGGAGCAGGAGCAAGAGGAGGG + Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023475486 7:40573423-40573445 CTGGGTAAGGTGGATGGGGAGGG - Intronic
1024024036 7:45396316-45396338 CTGGGTGAGGAGCAAGAGAGAGG - Intergenic
1026442423 7:70456118-70456140 CTGGGTTAGGGGGAAGTTGAGGG - Intronic
1026953985 7:74365376-74365398 CTGAGTAAGGGGCACATGGATGG - Intronic
1027776397 7:82470791-82470813 CTGGGTAATGAGCACTTGCAAGG - Intergenic
1028225375 7:88245584-88245606 TGGGGAAAGGAGAAAGTGGAGGG - Intergenic
1028879084 7:95859475-95859497 CTGGGTAAGATGAATGTGGAAGG - Intronic
1029030540 7:97461916-97461938 GTGGGTAAGGAGCTAGAGAATGG + Intergenic
1029248338 7:99218604-99218626 GTGGATAAGGAGGAAGTGGTAGG - Intergenic
1029252474 7:99246781-99246803 GTGGGCATGGAGCAAGTGGAGGG + Intergenic
1029373127 7:100161965-100161987 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1030678348 7:112408196-112408218 CTGAGAAACGAGCCAGTGGAAGG - Intergenic
1031554837 7:123161520-123161542 CAAGGAAAGGAGAAAGTGGAAGG - Intronic
1031642810 7:124186225-124186247 CTGGAGAAGGAGCCAATGGAGGG + Intergenic
1032072743 7:128818978-128819000 CTGGGGAGGGAGCAGGAGGAAGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1033998499 7:147383618-147383640 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1034202386 7:149290519-149290541 CTGTGTAAGGTGCTAGAGGAGGG - Intronic
1034221086 7:149446792-149446814 GTGGGTGAGGAGCAGGTGGGAGG - Intronic
1034970160 7:155413680-155413702 CTGGGTGGGGAGCAAGTCCACGG + Intergenic
1035864923 8:3071351-3071373 CGGGGTGGGGAGCAAGAGGAGGG + Intronic
1036039647 8:5060994-5061016 CTGAGCAAGGAGGAAGAGGAAGG - Intergenic
1037240643 8:16773395-16773417 CTGGGTAAGGAGGGAAGGGAGGG - Intergenic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1039391493 8:37184445-37184467 GTGGGTAGGGTGCAAGGGGAGGG + Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041641410 8:60206878-60206900 GTGGGAAAGGAGCAAGTAGATGG - Intronic
1043629247 8:82308081-82308103 CTGTTTAAGGAGCAAGTGTAGGG - Intergenic
1044907706 8:97022868-97022890 CTGGGTACGTAGCCAGTGGTGGG - Intronic
1046671857 8:117064797-117064819 CTGGGAGAGGAGGAAGAGGAGGG + Intronic
1046855125 8:119022726-119022748 CTGGGGAGGCAGCCAGTGGAGGG - Intronic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1048929239 8:139297925-139297947 CTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049770256 8:144376817-144376839 CTGGGTAGGCAGCAGGTGGATGG + Intronic
1050185209 9:2965772-2965794 CAGGGTAAGGAGAGAGTGGCAGG + Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051477953 9:17529579-17529601 CGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1051588785 9:18754669-18754691 ATGGGCAAGGAGCAAGGAGAAGG - Intronic
1051918510 9:22235973-22235995 CTGGGTAAGGAGGCTGTAGATGG + Intergenic
1053025496 9:34725377-34725399 GGAGGTAAGGAGCAACTGGATGG + Exonic
1053037026 9:34834439-34834461 GGAGGTAAGGAGCAACTGGATGG + Intergenic
1053466384 9:38311620-38311642 CTGGGAAAGGAGCAAGGGAGTGG + Intergenic
1055798608 9:80005128-80005150 CTTGGGAAGAAGCAACTGGATGG + Intergenic
1057082164 9:92181223-92181245 CTGGGCAAGGAACTAGAGGAGGG + Intergenic
1057639695 9:96806621-96806643 CGGGGTAAGGAGCAAATAGGAGG + Intergenic
1057713972 9:97474056-97474078 ATGGGTAAGGAGGAAGATGAAGG - Intronic
1058070078 9:100592710-100592732 CTAAGTGAGGACCAAGTGGAAGG + Intergenic
1059299158 9:113298728-113298750 CTGGGTGAGTAGGATGTGGAGGG - Exonic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1061891933 9:133626537-133626559 CTGGGTAATGGGCAAGAGGTTGG - Intergenic
1185433228 X:21449-21471 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185442430 X:233517-233539 CTGGATCAGAACCAAGTGGAGGG - Intergenic
1185638963 X:1575827-1575849 ATGGGTAAGTAGAAAGTGGGTGG + Intergenic
1186101924 X:6166665-6166687 GTGGATAAGGAGCATGTGCATGG + Intronic
1186202518 X:7168737-7168759 CTGGGTAAGGACAGAGAGGAAGG - Intergenic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187686437 X:21820172-21820194 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1187785517 X:22881119-22881141 GGGGGTAAGGGGCAAGGGGAGGG + Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188852034 X:35143930-35143952 CTGGGGAAGAAGCATGTGGATGG - Intergenic
1189984663 X:46543622-46543644 ATGGGAAAGGAGGAAGTGGTGGG - Intronic
1190777236 X:53562674-53562696 CTGGCTGAGGATAAAGTGGATGG + Intronic
1192058029 X:67793116-67793138 CTGGGGAGGGAGCATGAGGAAGG + Intergenic
1193829400 X:86270383-86270405 CTGAGAATGGAACAAGTGGAAGG + Intronic
1194391013 X:93318068-93318090 CTAGGAAAGGAGAAAGTGGAAGG + Intergenic
1195550605 X:106165387-106165409 AAGGATAAGGAGCAATTGGAAGG - Intergenic
1198039633 X:132837225-132837247 CTGGGTAATGAGTCATTGGATGG - Intronic
1199381914 X:147181372-147181394 CTGGGTAAGGTGGAAGAGGGAGG + Intergenic
1200259091 X:154602443-154602465 CTGGGGCAGGAGCCAGTGGCGGG + Intergenic