ID: 1146537703

View in Genome Browser
Species Human (GRCh38)
Location 17:33667287-33667309
Sequence CAGCAGTATGGGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3261
Summary {0: 1, 1: 0, 2: 11, 3: 319, 4: 2930}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146537703 Original CRISPR CAGCAGTATGGGAGGGCAGG AGG Intronic
Too many off-targets to display for this crispr