ID: 1146542442

View in Genome Browser
Species Human (GRCh38)
Location 17:33709093-33709115
Sequence ATGGAGACCCAGAAAGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146542442 Original CRISPR ATGGAGACCCAGAAAGATGT AGG (reversed) Intronic
900740040 1:4325472-4325494 ATTGAGACCCAGGCAGATGCTGG - Intergenic
901491027 1:9596297-9596319 ATGCAGAGCCAGAAAGACCTGGG - Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902976486 1:20092364-20092386 ATTGAGGCCCAGAAAGTTTTAGG + Intergenic
903789742 1:25884729-25884751 ATGGAGACCCAGAGAAATAAAGG + Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
905248409 1:36630423-36630445 ATGAAAGCCCAGAAAGAGGTAGG - Intergenic
905807412 1:40886917-40886939 ATGAAGACCCAGAGAGGTGCAGG - Intergenic
906008304 1:42499193-42499215 ATGGAGAACTAATAAGATGTAGG + Intronic
906208962 1:44001687-44001709 ATGGAGACACGGAAAGTTCTAGG + Intronic
906390146 1:45408070-45408092 CTTGAGACCTAGAAAGAAGTGGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906933813 1:50194639-50194661 CTGGAGACCAAGAAAGAAGCAGG + Intronic
907841164 1:58158785-58158807 CTGCAGAGCCAGAAAGATGCAGG + Intronic
907944922 1:59127115-59127137 CTGAAGACACAGAAAGGTGTGGG + Intergenic
910666475 1:89730262-89730284 ATGAAGACCCAGAAAGACTCTGG + Intronic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911741770 1:101394342-101394364 ATGGAGACAGAGAAACATGTGGG + Intergenic
912045716 1:105452992-105453014 ATGAAGACCCAGTAGGACGTGGG + Intergenic
912781113 1:112548879-112548901 AAGGAGAACCGGAAATATGTAGG - Intronic
913310430 1:117485549-117485571 ATGGAATCCCAGAGAGATTTTGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
917321650 1:173788761-173788783 ATGGATACTTAGAAAGATATTGG - Intergenic
917811500 1:178662833-178662855 AAGTAGACCAAGCAAGATGTTGG + Intergenic
918480571 1:184973641-184973663 AGGGAGACCCTCAGAGATGTGGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919104909 1:193137318-193137340 CTAGAGATCCAAAAAGATGTTGG - Intronic
921005191 1:211086210-211086232 TTGGAAACCCAGACAGAAGTAGG - Intronic
921655077 1:217724954-217724976 ATGGAGATTCTGAAACATGTTGG + Intronic
922501229 1:226098436-226098458 AAGGATGCCCAGAAAGGTGTGGG + Intergenic
924106239 1:240652090-240652112 TGGGAGACCCAGAATGAAGTGGG + Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063281395 10:4633228-4633250 AGGGAGACCCAAAAATATATGGG + Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064299650 10:14112155-14112177 GTAGAAACACAGAAAGATGTTGG + Intronic
1065940223 10:30557608-30557630 ATGGAGACCCACAAAACAGTGGG - Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1067222755 10:44355870-44355892 ATGGAGGCCCAGAGAGCTCTAGG + Intergenic
1067767625 10:49098833-49098855 ATGGAGACCCAGAAACACATGGG - Intronic
1067834778 10:49631910-49631932 ATGGGGACCTAGGAAGATATTGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1070815540 10:79320569-79320591 AGGGTGGCCCTGAAAGATGTTGG + Intergenic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1074860910 10:117509800-117509822 ATGGAGCACCAGAAAGCTGGCGG - Intergenic
1076129913 10:128006687-128006709 AAGGAGACCCATAAACATTTGGG + Intronic
1076514107 10:131033533-131033555 CTGGATACGCAGAAAGATGGAGG + Intergenic
1078102828 11:8339814-8339836 AAGGAGACCCGGGAAGAGGTTGG - Intergenic
1078451597 11:11444401-11444423 ATGGGAACCCAGACAGAGGTTGG - Intronic
1078611247 11:12821348-12821370 ATGAAGACTCAGAAAGGTTTTGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1081446936 11:43139824-43139846 AAGGAGGCCAAGAAGGATGTTGG - Intergenic
1082182105 11:49132668-49132690 ATGGATACCTAGAAAGATACAGG - Intergenic
1082791566 11:57349583-57349605 ATGGGGCACCAGAAAGATGCAGG + Intronic
1084912532 11:72402537-72402559 ATGGAAACTAAGAAAGATGGGGG - Intronic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086683397 11:89702280-89702302 ATGGATACCTAGAAAGATACAGG + Intergenic
1086802097 11:91188755-91188777 AAGGAGAGCCAAAAGGATGTGGG + Intergenic
1087603524 11:100345876-100345898 ATAGAGAACCAGCAAGATGTTGG + Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1088859368 11:113785507-113785529 ATGGAGCCCAAGAAAGCTCTTGG + Intergenic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090650510 11:128802017-128802039 ATTCAGACCCAGAAACATGTTGG - Intronic
1091058519 11:132440855-132440877 CTGGAGACCTAGGAAGCTGTAGG + Intronic
1091542781 12:1477502-1477524 GAGGAGAGCCAGAAACATGTGGG + Intronic
1091613406 12:2030876-2030898 CTGGAGACCCAGCAACAAGTTGG + Intronic
1091839048 12:3606059-3606081 ATTAACACCCAGAAATATGTTGG - Intergenic
1092010541 12:5107065-5107087 ATGCAAAATCAGAAAGATGTGGG + Intergenic
1092769549 12:11884274-11884296 ACGGAGGCCCAGAAAGATGGAGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095739179 12:45588375-45588397 CTGGAGAGCCAGAAAGCTGGTGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1098693541 12:73521957-73521979 ATAGAGCCCCAGGAATATGTGGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099553110 12:84073005-84073027 CTGAAGACCAAGAAAGAAGTAGG + Intergenic
1100578236 12:95913157-95913179 AAAGTGACCCAGGAAGATGTGGG - Intronic
1101259156 12:103011830-103011852 ATAGAGTCCCAAAAAGATCTGGG + Intergenic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1102255175 12:111410839-111410861 AAGGAGGCCCAGAGAGTTGTGGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102544731 12:113646255-113646277 ATGGATGCCCAGAGAGATGAAGG + Intergenic
1102816748 12:115872149-115872171 ATGGAGCTGGAGAAAGATGTAGG - Intergenic
1107464427 13:40636300-40636322 ATGGAGACCCAGAGAGGTAGAGG - Intronic
1107711218 13:43152295-43152317 CTGGTGAGCCAGAAATATGTAGG + Intergenic
1109038388 13:57296667-57296689 AAGGAGACCAAGAAATATTTAGG + Intergenic
1109217479 13:59606067-59606089 ATGGAGACCTGGAGAGATGAGGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1111547870 13:89767561-89767583 ATGAAGACACAGAAAGTAGTTGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112993875 13:105548309-105548331 ATAGATATCCAGAAAGATGCAGG + Intergenic
1114654991 14:24310649-24310671 CTGTAGGCCCAGAAGGATGTCGG + Exonic
1115589102 14:34845926-34845948 ATGGAGGCAGAAAAAGATGTAGG + Intronic
1115640704 14:35334122-35334144 ATGGTCACCCTGAAAGAAGTAGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1117435400 14:55711242-55711264 ATAGAGACCCAGAGAGGTCTGGG + Intergenic
1118374912 14:65168336-65168358 ACTGAGGCCCAGAAAGATCTTGG + Intergenic
1120844536 14:89114432-89114454 AAGGGGACCCAGAAAAATGCAGG + Intergenic
1120852564 14:89184660-89184682 ATGGAGACCCAGGAAGGTGAAGG - Intronic
1122962704 14:105104057-105104079 AGGGAGTCCCAGAAAGATAAGGG + Intergenic
1125347924 15:38738268-38738290 ATTGACACCCATAAATATGTAGG - Intergenic
1125412277 15:39417892-39417914 GTGGAGAGCCAGAATGCTGTTGG + Intergenic
1126179619 15:45772348-45772370 ATGGAGACACACACAGAGGTGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127781696 15:62321996-62322018 ATTAAAACACAGAAAGATGTAGG - Intergenic
1128495476 15:68196027-68196049 ATGGAGACCCAGCCTGCTGTTGG + Intronic
1129229502 15:74188983-74189005 ATCGAGACCCAGAGAGAGGAAGG + Intronic
1129543453 15:76370835-76370857 AGGGAGACTCATAAAGATCTTGG - Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130607811 15:85333405-85333427 ATTTAGATCCAGATAGATGTGGG - Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131433253 15:92403181-92403203 ATGGAGACTCAGAGAGGTCTCGG + Intronic
1131467627 15:92668130-92668152 AGGGAGACACACAAAGTTGTAGG - Intronic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1133412618 16:5580791-5580813 ATCCAGACCCAGGAAGCTGTAGG + Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1134636797 16:15798889-15798911 AGGCAGCCCCAGAAAGATGCTGG + Intronic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135460929 16:22642275-22642297 ATGGTGAACAAGAAAGATGCAGG - Intergenic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1137950959 16:52782823-52782845 ATGAAGACCCAGGAAGGTGAGGG - Intergenic
1138341265 16:56290521-56290543 CTGGAGACCCAGAATGAGTTTGG + Intronic
1138747404 16:59379321-59379343 ATGGTGACCCGGAAACATGAGGG - Intergenic
1138925811 16:61590159-61590181 ATGGAAAGTCACAAAGATGTGGG - Intergenic
1139194960 16:64907808-64907830 ATGGAAGACCAGAAAGATGCAGG - Intergenic
1140407631 16:74721579-74721601 ATGGAGACTCACACAGCTGTGGG + Intronic
1140634463 16:76894939-76894961 ATGGAGCCTCAGAGAAATGTGGG + Intergenic
1141588799 16:85053361-85053383 ATCGAGACCCAAAAGGATTTTGG - Intronic
1143103078 17:4514682-4514704 AGGGAGACCCAGGAAGGGGTAGG - Intronic
1143161703 17:4876138-4876160 ATGTAGACCCACAAAGTTCTTGG + Intronic
1143816674 17:9522031-9522053 TTGGAGACCCAAAAAAATGATGG - Intronic
1143965584 17:10754541-10754563 ACGCAGACTCAGAAAGATGCTGG - Intergenic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149052163 17:52318637-52318659 ATGAAGCCCCAGAATGATGTGGG + Intergenic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1149623012 17:58060263-58060285 ATGGAGTCCAAGAAAGATGGAGG + Intergenic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151605831 17:75134986-75135008 ATGAAGACCCAGAGAGGAGTGGG - Intergenic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1154039608 18:10841337-10841359 AGGGAAACCCAGAAAGAGTTTGG + Intronic
1154286904 18:13066857-13066879 ATGGTGGCCCAGAAAGGTCTGGG - Intronic
1158340112 18:56456984-56457006 ATGCAGACCCAAAAAAATGATGG + Intergenic
1159552446 18:69909312-69909334 ATGGAGACCCAAACTCATGTAGG - Intronic
1159713012 18:71786682-71786704 ATTGAGACCTGGAAATATGTAGG + Intronic
1159861191 18:73651519-73651541 ATGCAGACACAGACAGGTGTGGG + Intergenic
1162275465 19:9650516-9650538 ATGGAGACCAACAAATAGGTCGG - Intronic
1162430318 19:10624730-10624752 AGGGCGACCCAGGAGGATGTGGG + Intronic
1162573834 19:11487285-11487307 ATCGAGACCAAGAAAGGTCTGGG - Exonic
1163207373 19:15813581-15813603 GTGGAGACACAGAGAGATGTGGG + Intergenic
1164428604 19:28167114-28167136 ATTGAGACCCAGAGAGGTGGAGG + Intergenic
1164558402 19:29270714-29270736 ATGCTGAGCCAGAAAGATGGGGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164936494 19:32218719-32218741 ATGGAAAATTAGAAAGATGTTGG + Intergenic
1165948594 19:39459749-39459771 ATGGACAGCCAGGAAGATGGAGG - Intronic
1167359069 19:49020319-49020341 CTGGAGACCCAGAAAGATAGGGG - Intergenic
1167366756 19:49058556-49058578 CTGGGGACCCAGAAAGATGGGGG - Exonic
1167740646 19:51323123-51323145 ATAGAGACCCAGAAAGAGAGGGG - Intronic
1167793215 19:51693126-51693148 ATAGAGACACAGAGAGATATCGG - Intergenic
1168294274 19:55370976-55370998 ATGGAGATCCACAGAGATGGAGG + Intergenic
1168497024 19:56861952-56861974 ATGTAGAGTCAGAAAGACGTGGG - Intergenic
1168501640 19:56898128-56898150 ATGGAAAACAAGAGAGATGTGGG + Intergenic
926490791 2:13523757-13523779 ATGCAGACCCAGAGAGACGTGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927993272 2:27463309-27463331 ATAGAGACCAAGGAAGATGAGGG + Intronic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928738930 2:34326333-34326355 ATGGGCACCCAGAAACATGCAGG - Intergenic
928870123 2:35965977-35965999 CTGGAGACCCAGGAAGCTGGTGG - Intergenic
929954411 2:46444379-46444401 ATGGAGACCCAGGGAAGTGTGGG + Intronic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
932858032 2:75259187-75259209 ATGGAGTCTCAGAGAAATGTGGG - Intergenic
932927683 2:75995288-75995310 ATGGATATGCAGAAAGATATAGG - Intergenic
933664721 2:84955718-84955740 CTGTAGGGCCAGAAAGATGTTGG + Intergenic
934136571 2:89001457-89001479 ATGGAGACCCAGAAGCTAGTAGG - Intergenic
934888179 2:98042655-98042677 ATCAAGAACCAGAAAGATCTCGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935414292 2:102799495-102799517 TTGAAGACCCAAAAAGATATGGG + Intronic
936558287 2:113514746-113514768 AAGGAGGCCGAGAAGGATGTCGG + Intergenic
936656443 2:114493489-114493511 ATAGAAACCCAGAAAGATAAGGG + Intronic
936756091 2:115714535-115714557 TTGGAGAACAAGAGAGATGTAGG - Intronic
937677285 2:124605967-124605989 ATGGAGAGAGAGAAAAATGTGGG - Intronic
937720747 2:125092327-125092349 ATGGAGTACTAGAAAGATCTTGG - Intergenic
939834107 2:147106981-147107003 ATGGAGACTCAGAGAGCAGTTGG + Intergenic
941234463 2:162952806-162952828 ATGGAGACCAAGAAATCTGATGG - Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943097037 2:183441681-183441703 ATGGCAAGCCAAAAAGATGTCGG + Intergenic
943453277 2:188072548-188072570 ATGGGGAGCCAGAAAGAGGTTGG - Intergenic
944957456 2:204828809-204828831 ATGGAGAGCCAAAAGGATTTGGG - Intronic
945676571 2:212862013-212862035 ATGGCCACCCAAAAATATGTAGG + Intergenic
946015202 2:216598749-216598771 ATGGGGACCCAGGAAGATGTAGG - Intergenic
946640022 2:221773983-221774005 ATGGAGGACCAGAAACAGGTAGG - Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
948182012 2:235989597-235989619 AGGGCCACCCAGGAAGATGTGGG + Intronic
948287251 2:236795463-236795485 ATGGAAACTTGGAAAGATGTCGG + Intergenic
948541980 2:238697625-238697647 AGGCAGACCCAGAAGGCTGTGGG - Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1171012321 20:21515301-21515323 GTGAAGACCCAGAAAGCTGCGGG + Intergenic
1171965318 20:31525397-31525419 ATGGAGACTCACAAATATTTTGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1172620070 20:36312946-36312968 ATGGAGGCCCAGAGAGGTGCAGG - Intronic
1172894935 20:38293816-38293838 ATGGAGAGCCAGGAGCATGTTGG - Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173944729 20:46941415-46941437 ACTGAGCCCCAGAAAGATGAAGG - Intronic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175113358 20:56664556-56664578 ATGGAGGGCCAGAAAGACCTGGG + Intergenic
1175169122 20:57067612-57067634 CTGGAGACCCAGGAGGATCTGGG + Intergenic
1175750333 20:61492591-61492613 ATGAAGACTCAGATAGATGGTGG + Intronic
1175960289 20:62632710-62632732 ATGGACATCCAGATACATGTGGG + Intergenic
1176447666 21:6833209-6833231 AGTGAGTCCCAGGAAGATGTTGG + Intergenic
1176825835 21:13698235-13698257 AGTGAGTCCCAGGAAGATGTTGG + Intergenic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1181434056 22:22900170-22900192 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181434994 22:22905536-22905558 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1183236133 22:36619110-36619132 ACCGAGACCCAGAAAGGTGAAGG + Intronic
1183778541 22:39983796-39983818 GTGGAGACCGAGAAGGAAGTGGG - Intergenic
1184403090 22:44285392-44285414 ATTGAGACCCAGAATGATTTGGG - Intronic
1184716980 22:46288038-46288060 CTGGAGACCCAGAGAAAAGTGGG + Intronic
1184804767 22:46787319-46787341 ACGGAGACACAGAAAGCTGCTGG - Intronic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
950040735 3:9917616-9917638 ACGGAGCCCCAGAAAAAGGTAGG + Exonic
951170735 3:19539093-19539115 AGGGAGAGCCAGGAAGAAGTTGG - Intergenic
952081218 3:29759719-29759741 ACTGAGACCCAGAAAGCTCTGGG - Intronic
952093219 3:29916656-29916678 AAGGAGAACCAAAAATATGTGGG + Intronic
952975826 3:38695062-38695084 ATGGAGACACAGGAAGAAATCGG - Intergenic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953690904 3:45118411-45118433 ATAGAGATCCAGAAAAATATTGG - Exonic
954947924 3:54442974-54442996 AGGCAGACCCAGGGAGATGTGGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955973273 3:64457122-64457144 AAGGAGACCCAAAAAGAAGCAGG - Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956989063 3:74742428-74742450 TTGTAGACCCAGAAAGTAGTAGG - Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958746963 3:98148085-98148107 ATGGAGACACAGAAAGGTTTTGG - Intergenic
958822371 3:98990276-98990298 ATTGAGACCGAGAAAGAGGTGGG + Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960968918 3:123125255-123125277 AAGGAGAGCCCAAAAGATGTTGG - Intronic
961074640 3:123970694-123970716 ATGGAGTCCCAGGAAGATACTGG + Intronic
962478809 3:135780715-135780737 ATGGAGAGCTAGCAAGATGAGGG - Intergenic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
962813943 3:138981870-138981892 ATGAAGACCCAGATAGGTGTTGG - Intergenic
965510729 3:169565684-169565706 ATGGAGCTCCAGAAAAATCTGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967855276 3:194112770-194112792 ATGGAGATCCAGGAATTTGTAGG - Intergenic
968958100 4:3729119-3729141 ATGGTGACCCAGAGGGCTGTGGG + Intergenic
969884647 4:10204503-10204525 ATGTAGACCAGGACAGATGTAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972817900 4:42665017-42665039 GTGGAGGCCCAGAAATATTTGGG - Intergenic
973209949 4:47604672-47604694 AGGGAGAAACAGTAAGATGTGGG - Intronic
975338264 4:73206687-73206709 AGGGTGGACCAGAAAGATGTTGG + Intronic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
975952925 4:79796163-79796185 TTGGAGATACAGAAATATGTAGG - Intergenic
976138933 4:81970204-81970226 ATGGCTACCCAGAAAGAAGGTGG + Intronic
976743677 4:88382494-88382516 AAAGAGACCCAGAAAAAAGTTGG - Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978347623 4:107788430-107788452 AGGCAGACCCACACAGATGTTGG - Intergenic
980318347 4:131235403-131235425 ATGGTGAACCAAAAAGATGATGG + Intergenic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982603393 4:157482085-157482107 ATGGAGACCTACAAAGACGTAGG + Intergenic
985908863 5:2863763-2863785 ATGGAGGCACAGAGAGCTGTGGG + Intergenic
985957320 5:3275266-3275288 GAAGAGACCCAGAAAGGTGTGGG - Intergenic
986153577 5:5150970-5150992 ATGGAGCCTCAGAGAAATGTGGG - Intronic
986649077 5:9946252-9946274 AGAGAGAGCCAGAAAGATGCGGG - Intergenic
988850210 5:35173215-35173237 ATGGACACCCACATACATGTTGG + Intronic
989113485 5:37929640-37929662 ATGGAGACCCACAAGGACCTGGG + Intergenic
990503960 5:56426573-56426595 ATGAAGACCCCGAAAGCTGCAGG + Intergenic
990656614 5:57963693-57963715 ATGGAGACACAGAAAGGTAAAGG - Intergenic
990746862 5:58967426-58967448 ATGGAGACGAAAAAAGATATTGG - Intergenic
992186540 5:74249947-74249969 ATGGAAACCCACAAACATTTTGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992419865 5:76592252-76592274 ATGGTGAGCCAAAAAGATGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993760226 5:91785877-91785899 ATGGATTTCCAGAAATATGTAGG - Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
998902434 5:146870440-146870462 ATGAGGACCCAGCAAGAAGTTGG + Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999743476 5:154574414-154574436 GTCGAGACCCAGGAAGATGAGGG - Intergenic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000943987 5:167398126-167398148 ATTGACACCCAGAGAGATTTAGG - Intronic
1001219795 5:169890717-169890739 TTTGGGACCCTGAAAGATGTTGG + Intronic
1002494144 5:179600299-179600321 ATGGAGACCCAGAAAGTAACTGG - Intronic
1002789638 6:427726-427748 AGGCAGACACAGACAGATGTGGG - Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1005825647 6:29630351-29630373 ATGGAGAGCTATAAAAATGTGGG - Intronic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1007602305 6:43090148-43090170 CTGGTGACCCAGAAAGGGGTAGG + Intronic
1008076314 6:47149650-47149672 AGGTAGACCCAGAAAGAGTTTGG - Intergenic
1008396598 6:51015900-51015922 ATGGAAGCACAGATAGATGTGGG - Intergenic
1011706804 6:90008761-90008783 ATTGAGGCCCAGGAGGATGTTGG + Exonic
1012258286 6:97059123-97059145 GTGGAGACCCAGGATGAGGTAGG + Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1014246491 6:119075900-119075922 TTGTAGAAACAGAAAGATGTTGG + Intronic
1015521231 6:134133454-134133476 ATTGAAACCCAGAAATATTTAGG - Intergenic
1015580954 6:134724556-134724578 ATGTAGACACAGAAAGGTCTTGG - Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017363179 6:153600687-153600709 CAGGAAACCTAGAAAGATGTTGG + Intergenic
1018848966 6:167574098-167574120 ATTGGGACCCAGAAAGACCTGGG + Intergenic
1020433046 7:8132821-8132843 ATGGAGTTCCAGAAAGAACTTGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021118080 7:16766233-16766255 ATGAACACCCAAAAATATGTTGG - Intronic
1021587478 7:22224644-22224666 ATGGAGGCCCAGACAGTGGTGGG + Intronic
1022180843 7:27917891-27917913 GTGGAGAGTCAGAAATATGTGGG - Intronic
1022478124 7:30725207-30725229 ATGGAGACGCAGGCAGAGGTTGG + Intronic
1024260212 7:47568735-47568757 ATGGAAACCCCGGCAGATGTGGG + Intronic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1026333832 7:69376978-69377000 AAAGAGATGCAGAAAGATGTAGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028882316 7:95893613-95893635 ATGGAGTGCCAGCAAGATGATGG - Intronic
1028974139 7:96893261-96893283 TTTGAGACAAAGAAAGATGTAGG - Intergenic
1030431325 7:109452610-109452632 ATGGAAACCAAGAAAAAAGTAGG - Intergenic
1032568308 7:132971605-132971627 TTAGTGAGCCAGAAAGATGTGGG + Intronic
1033415297 7:141156521-141156543 ATGGACACCTTGAAAGATGATGG + Intronic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1036048926 8:5174212-5174234 ATGGAAATCCAGAAGGCTGTGGG - Intergenic
1036728995 8:11245238-11245260 ATGGAGAGGCAGAAGGATTTAGG + Intergenic
1036776223 8:11614486-11614508 ATCGGGAGCCAGAGAGATGTTGG - Intergenic
1039476825 8:37843192-37843214 ATGGTGCCCCAGAAAGCTGCAGG + Exonic
1039859912 8:41448207-41448229 TTGGAGACCCAGTAAGATCAAGG - Intergenic
1040416477 8:47200420-47200442 ATGGTGACCCAGAGAGATAAAGG - Intergenic
1040488184 8:47894554-47894576 GTGGAGACCAAGGAAGAAGTAGG - Intronic
1042177176 8:66048216-66048238 AGGGATACTCAGAAATATGTGGG - Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1045705728 8:104920375-104920397 CTGGGGTCCCAGAAGGATGTGGG + Intronic
1046224673 8:111262119-111262141 ATGGACACCCCTAAAGATGTTGG - Intergenic
1046739734 8:117815324-117815346 ATGGAGAATGAGGAAGATGTAGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047333221 8:123911560-123911582 ATGCAGAGCCAGAAAGACCTAGG - Intronic
1048589696 8:135809998-135810020 CTGGTCACCCAGAAAGATGGAGG - Intergenic
1049894574 9:101520-101542 AAGGAGGCCGAGAAGGATGTGGG - Intergenic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1052178688 9:25498682-25498704 GTAGAGACTCAGAAAAATGTGGG + Intergenic
1053385296 9:37682381-37682403 TTGGACATCCAGGAAGATGTTGG + Intronic
1053735781 9:41101510-41101532 AAGGAGGCCGAGAAGGATGTGGG - Intergenic
1054692595 9:68329888-68329910 AAGGAGGCCGAGAAGGATGTGGG + Intronic
1056031187 9:82555192-82555214 ATGGGGTCCCAGAAAGCTTTGGG - Intergenic
1056048343 9:82742234-82742256 ACGGTTACCCAGAAAGTTGTTGG - Intergenic
1056597789 9:88021805-88021827 ATGGAGACCCAAGAATATGGCGG - Intergenic
1057930245 9:99186801-99186823 AAGGAGAACCAGAAATATCTTGG - Intergenic
1059294582 9:113258840-113258862 ATGGAGACACACAAAACTGTTGG + Exonic
1060115509 9:120937033-120937055 ATGGAGACACAGAGAGATTTTGG + Intergenic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1062175452 9:135159605-135159627 ATTGAGGCACAGAAAGATGGGGG + Intergenic
1203521525 Un_GL000213v1:51322-51344 AGTGAGTCCCAGGAAGATGTTGG - Intergenic
1185881664 X:3746702-3746724 ATGGAGACCCAGAAACTTAGAGG - Intergenic
1185913671 X:4010375-4010397 CTGGAGACCCAGGAAGCTGGTGG + Intergenic
1185978670 X:4750460-4750482 AGGCAGACCCAGAGAGATATAGG + Intergenic
1187704183 X:21993286-21993308 ATCGAGAACTAGAATGATGTTGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1190248135 X:48704326-48704348 ATGGAGACTAGGAAGGATGTGGG + Intronic
1190299203 X:49046590-49046612 AGAGAAACCCAGAAAGATGCAGG - Intergenic
1190435446 X:50420011-50420033 ACTGAGACTCAGAAAGAGGTAGG - Intronic
1192924589 X:75742137-75742159 ATGTATACCCAGAAAAATGATGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193706769 X:84830304-84830326 ATAGAGATCCAGAAAGTTCTAGG + Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195969856 X:110461343-110461365 TTGGAGACTCAGAGAAATGTTGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197961264 X:132008618-132008640 AGGGGGACACAGAAACATGTTGG + Intergenic
1198480883 X:137039223-137039245 TTGGAGTCCCAGAAATAAGTAGG + Intergenic
1201748091 Y:17402641-17402663 AAGGAGGCCCAGAAATTTGTTGG + Intergenic