ID: 1146542537

View in Genome Browser
Species Human (GRCh38)
Location 17:33710048-33710070
Sequence CTCCATCAACCTATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146542537_1146542541 7 Left 1146542537 17:33710048-33710070 CCAAGCTCCATAGGTTGATGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1146542541 17:33710078-33710100 GAGATGAGATTTCTCCTCATGGG 0: 1
1: 0
2: 22
3: 435
4: 4933
1146542537_1146542540 6 Left 1146542537 17:33710048-33710070 CCAAGCTCCATAGGTTGATGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1146542540 17:33710077-33710099 GGAGATGAGATTTCTCCTCATGG 0: 1
1: 0
2: 0
3: 21
4: 243
1146542537_1146542542 16 Left 1146542537 17:33710048-33710070 CCAAGCTCCATAGGTTGATGGAG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1146542542 17:33710087-33710109 TTTCTCCTCATGGGTCTGCATGG 0: 1
1: 0
2: 0
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146542537 Original CRISPR CTCCATCAACCTATGGAGCT TGG (reversed) Intronic
901647801 1:10726064-10726086 CTCCAACCACCTATGGGGCAGGG + Intronic
907319320 1:53592890-53592912 CCCCACCTACCTGTGGAGCTGGG - Intronic
915965860 1:160307540-160307562 CTCCATCAAGCTAACGAGCAGGG + Intronic
918362910 1:183777383-183777405 GTCCATTATCCTATGGAGCTAGG + Intronic
919169426 1:193935146-193935168 CTCAATTAACCTAGGGGGCTTGG - Intergenic
922579395 1:226685827-226685849 ATCCATGAAGCTCTGGAGCTGGG + Intronic
1070178771 10:73995457-73995479 CTCCATCAAGTTGTGAAGCTGGG + Intergenic
1070957207 10:80472000-80472022 CCCCATCTCCCTATGTAGCTGGG + Intronic
1076146708 10:128127603-128127625 CCCCAGCAACCCTTGGAGCTTGG + Intergenic
1076896402 10:133314795-133314817 CAGCATCATCCTGTGGAGCTGGG - Intronic
1082895772 11:58188414-58188436 CTGCATCAATCTATGGAGGTGGG + Intergenic
1084886195 11:72208660-72208682 CTCCATCAACTTCAAGAGCTAGG - Intergenic
1085061642 11:73452691-73452713 CTCCATCTACCTATGAAGATTGG + Intronic
1085515309 11:77108171-77108193 CTCCAGCCAGCTTTGGAGCTGGG + Intronic
1091025693 11:132139005-132139027 CTCCATCTGCCATTGGAGCTTGG - Intronic
1092449842 12:8592073-8592095 CTCCATCAGCCTGAGTAGCTAGG + Intergenic
1092505271 12:9092304-9092326 CTCCATCTACTCCTGGAGCTAGG - Intronic
1094436540 12:30426471-30426493 CTCTGACAACCTATAGAGCTAGG + Intergenic
1095449931 12:42319771-42319793 ATCAATCAACATATTGAGCTGGG - Intronic
1096750512 12:53756038-53756060 CTCCACCAAGCCAGGGAGCTGGG - Intergenic
1098878459 12:75891710-75891732 TTCCATAAAGCTAAGGAGCTTGG + Intergenic
1101494829 12:105243927-105243949 CTCCATCCACATATGGGACTTGG + Intronic
1117018902 14:51549420-51549442 CTCCAACAGCCTGTGGAGCGAGG + Intronic
1121661287 14:95637048-95637070 CTACAGCAACCTATGGAGACAGG + Intergenic
1122190922 14:100043054-100043076 CTCCATCAACCTTTGTGGGTAGG + Intronic
1123793113 15:23743417-23743439 CTACATCAACCTAGGTAACTTGG - Intergenic
1133148730 16:3810361-3810383 CTCCATCAACAAAAGGAGCCTGG + Intronic
1133711737 16:8408217-8408239 CTTGATCAACCTATGGAAGTGGG + Intergenic
1142377174 16:89712082-89712104 CTCCATCTTTCTCTGGAGCTGGG + Exonic
1143643213 17:8211696-8211718 CTTCATCAACCTAGGGATTTGGG - Intergenic
1146207262 17:30915531-30915553 CTCCACCAACCAATGGAGGCTGG + Intronic
1146542537 17:33710048-33710070 CTCCATCAACCTATGGAGCTTGG - Intronic
1147313634 17:39608452-39608474 CAACATCTACCTATGGGGCTCGG - Intronic
1151325011 17:73374396-73374418 CTCCATCATCCTGTGGACCCTGG + Intronic
1154038240 18:10827996-10828018 CTCCATCAACCTAGTGACCTGGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1161042094 19:2115703-2115725 CCCCAACATCCTAAGGAGCTGGG + Intronic
1162548461 19:11345299-11345321 CTTCATCAACCTCTGCATCTTGG - Exonic
1165542403 19:36503175-36503197 CTCAATCAACTTACAGAGCTAGG + Intergenic
1166102553 19:40579546-40579568 CTCCAGCATCCTAAGTAGCTGGG - Intronic
1168147700 19:54429192-54429214 CTCCACCCACCTCTGGAGCCTGG - Intronic
925682367 2:6435990-6436012 CTCCATCAACTTCTGGCACTGGG + Intergenic
928948658 2:36794467-36794489 GGCCATCAACCTATGTATCTCGG + Intronic
929721372 2:44372061-44372083 CTTTAACAACCTATGGAGCTAGG - Intronic
934524055 2:95040481-95040503 ATCAATCAACCCATAGAGCTGGG + Intronic
940012989 2:149073973-149073995 CTCCATAAGCCAATGGAGCACGG - Intronic
941825023 2:169885463-169885485 CTGCCTCAACCTCCGGAGCTAGG - Intronic
944236119 2:197442783-197442805 CTCAATCAATCTCTGGAGTTTGG - Intergenic
1171322837 20:24261564-24261586 CTACATTACCCTGTGGAGCTGGG - Intergenic
1173454704 20:43192597-43192619 CCCCATCAGCCCAGGGAGCTGGG + Intergenic
1175468093 20:59206703-59206725 CTACAACAACCTCTGAAGCTAGG + Intronic
1176703430 21:10088103-10088125 CTGTAACAACCTATGGTGCTTGG + Intergenic
1180082070 21:45491497-45491519 CTCCAACACCACATGGAGCTGGG - Intronic
950663731 3:14482503-14482525 CTCCCTTAACCTTTTGAGCTTGG + Intronic
950762534 3:15245530-15245552 TTCCATCAATGTATGGAGGTGGG - Exonic
951180429 3:19653034-19653056 CTCCATCAACTCCTAGAGCTAGG - Intergenic
952131753 3:30372114-30372136 CTACCTCAACCAATGGAGCAGGG - Intergenic
957132630 3:76242322-76242344 CTCCTTCACCCTATGGAGCGGGG + Intronic
958856763 3:99394749-99394771 CTCCAGGAAGCTCTGGAGCTGGG + Intergenic
958941880 3:100325855-100325877 CTCATTCAACCTATAGAGTTGGG - Intergenic
959135732 3:102417464-102417486 CTCCACCAGCCTTTGGAGCCTGG - Intronic
962471358 3:135712073-135712095 CCCCATCAACCCTTGTAGCTGGG - Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
981158343 4:141467079-141467101 CTGCATCTACGTATGGAGCTAGG + Intergenic
982717343 4:158822748-158822770 CTTCAGCAACCTAAGTAGCTGGG + Intronic
984977580 4:185242978-185243000 CTCCATCAGGCTATGGGGATGGG + Intronic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
992591729 5:78302541-78302563 CTGCCTCAGCCTCTGGAGCTGGG - Intergenic
993879110 5:93342305-93342327 CTGCATCAGCCTAAGTAGCTGGG - Intergenic
999415793 5:151394987-151395009 CTCCATCCACCTCTGGAGGCAGG - Intergenic
999624538 5:153506511-153506533 CTCAATTAACAAATGGAGCTTGG - Intronic
1000744432 5:165015439-165015461 CTCAATCAAACTCAGGAGCTAGG - Intergenic
1001109695 5:168885457-168885479 CTCCATCAGCCTCCGGAGCAGGG + Intronic
1001824147 5:174732445-174732467 CCCCATCCACCTATGAGGCTGGG - Intergenic
1002322161 5:178382591-178382613 CTCCACCCACCTTTGGTGCTGGG - Intronic
1003675099 6:8196009-8196031 TTCCATCAGCCTCTGGAGATAGG + Intergenic
1005305442 6:24509348-24509370 CTCCCTCAACAAATGGTGCTGGG - Intronic
1011850967 6:91628350-91628372 TTCCATCATCCAAAGGAGCTTGG - Intergenic
1016165839 6:140941916-140941938 TGCCAACAACCTAAGGAGCTTGG + Intergenic
1016282288 6:142432029-142432051 CTCCATCTACTTATAGATCTCGG - Intronic
1016948683 6:149559302-149559324 CTCCTTCAATCAATGGTGCTGGG + Intergenic
1017373793 6:153743473-153743495 CTATGTCAACCTATGCAGCTTGG - Intergenic
1018950795 6:168377600-168377622 ATCCATCAAACTGTGCAGCTGGG - Intergenic
1019791296 7:3015622-3015644 CCCCAGCAACATATGGATCTGGG + Intronic
1026243696 7:68599293-68599315 CTCCATCTACTTATGTAGGTGGG + Intergenic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1031530378 7:122868187-122868209 CTCCATCAACTTCCAGAGCTAGG - Intronic
1033470961 7:141648353-141648375 CACCATGAACCCACGGAGCTTGG - Intronic
1036449847 8:8856201-8856223 CTCCAGCAGCCAAAGGAGCTGGG + Intronic
1037772662 8:21811532-21811554 CTCCATCCACCTAGGGCACTCGG + Intronic
1040522378 8:48189269-48189291 TCCCCTTAACCTATGGAGCTTGG + Intergenic
1052864899 9:33458899-33458921 CTCCCCCAAAGTATGGAGCTGGG + Intergenic
1055717529 9:79134350-79134372 CTCCATCAACCATGGTAGCTAGG + Intergenic
1059112001 9:111566419-111566441 CTCCAGCAGCCACTGGAGCTTGG - Intronic
1202788466 9_KI270719v1_random:58202-58224 CTGTAACAACCTATGGTGCTTGG + Intergenic
1189486070 X:41433191-41433213 CTCCTTCATCCACTGGAGCTGGG + Intergenic
1192753329 X:74018406-74018428 CTCACTCAACCTGTGGAGCCTGG - Intergenic
1194649415 X:96497811-96497833 CTCCAAAATCCTATGGACCTGGG - Intergenic
1197083044 X:122441283-122441305 CTCCAGCAGACTCTGGAGCTAGG - Intergenic