ID: 1146544389

View in Genome Browser
Species Human (GRCh38)
Location 17:33725679-33725701
Sequence GCAATTGCATCCATATGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146544389 Original CRISPR GCAATTGCATCCATATGCTG AGG (reversed) Intronic
902713958 1:18259802-18259824 GCCATTGCCTACACATGCTGTGG - Intronic
907207528 1:52786670-52786692 GCATTTAAATCCATATGTTGAGG + Intronic
915033799 1:152906035-152906057 GCCAGTGCATCCTTAGGCTGGGG + Intergenic
915075747 1:153307119-153307141 GCGTTTGCAGCCAGATGCTGCGG - Exonic
919456333 1:197824507-197824529 ACAATTGCAGCTATAGGCTGAGG + Intergenic
919964077 1:202503687-202503709 GAAACTGCATCCATATTCTCAGG - Intronic
920567152 1:206983386-206983408 GCAATTACAGGCACATGCTGAGG - Intergenic
922036779 1:221856514-221856536 GGAATTGAATCCATCTGCTATGG + Intergenic
922686525 1:227642914-227642936 CCAATTGCCTCCATTTGATGTGG + Intronic
1064839936 10:19580233-19580255 GCAATTTCAGCCATTTGCAGTGG + Intronic
1066302924 10:34112739-34112761 ACAATTGCATCAATATGGTTTGG + Intronic
1067092152 10:43273025-43273047 GCAATTTCATGCATCTGCTGGGG + Intergenic
1067730820 10:48810287-48810309 CCAATTGCTTCAAAATGCTGTGG + Intronic
1078725056 11:13922892-13922914 GCAACACCATCCATCTGCTGAGG - Intergenic
1080037713 11:27726647-27726669 GCAAATGAAACCATAGGCTGGGG - Intergenic
1080888286 11:36386728-36386750 GCAAGTGAATCCCTATGCTTCGG + Intronic
1083361775 11:62113802-62113824 TCAATTGAAGTCATATGCTGGGG - Intergenic
1084547905 11:69823564-69823586 CCAATTGCAGCCACATTCTGAGG + Intergenic
1086824394 11:91477313-91477335 GCAATAACATCCATAGGCTCAGG + Intergenic
1087846078 11:102974591-102974613 GCAATTGCATTTATATTATGAGG - Intergenic
1087858286 11:103120560-103120582 GCAATATAATCCATATACTGAGG + Exonic
1088934483 11:114385269-114385291 CAAATGTCATCCATATGCTGAGG - Intergenic
1089019651 11:115199856-115199878 GCAATTGCTTTCATGAGCTGTGG + Intronic
1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG + Intronic
1092020454 12:5198178-5198200 GCACATGCATGCATAAGCTGAGG + Intergenic
1092299492 12:7232230-7232252 CTAATTGCATACATATGGTGTGG + Intergenic
1096254688 12:50055931-50055953 GCAATTGCAGCCATTTGAAGAGG + Intergenic
1102196572 12:111029620-111029642 GCCATTGCATACATGTGATGAGG - Intergenic
1102448165 12:113019719-113019741 GCAATTGCAGCTGTAAGCTGAGG - Intergenic
1106922107 13:34574661-34574683 GCCATTGCAGCCTTATGGTGTGG - Intergenic
1110746661 13:79061811-79061833 GCAAGTGACTCCATAGGCTGCGG - Intergenic
1111124098 13:83890627-83890649 GCCATAGCACCCATCTGCTGAGG - Intergenic
1113965684 13:114152239-114152261 GCAATAGCATCCATTTCATGGGG - Intergenic
1116371934 14:44146459-44146481 ACAATTGTTGCCATATGCTGTGG + Intergenic
1120666599 14:87313800-87313822 GCCATTGCATCCAAAAGATGAGG - Intergenic
1121943603 14:98097032-98097054 GCAATTGTGTCCATGGGCTGGGG - Intergenic
1126706207 15:51407848-51407870 GCGTTTTCATCCAGATGCTGTGG + Exonic
1127169134 15:56280882-56280904 GTAATTTCAACCATGTGCTGGGG + Intronic
1128502151 15:68234082-68234104 CCAACTGCATCCTTATGCTTAGG - Intronic
1131640636 15:94288888-94288910 GCTATTGAATCCATATAGTGAGG - Intronic
1133190139 16:4127661-4127683 GCAAATGCAGTCATATTCTGAGG - Intergenic
1140428766 16:74883819-74883841 GGAATGCCATCCACATGCTGGGG + Intronic
1143990415 17:10954971-10954993 GAACTTGCATCCATGTGCTCTGG + Intergenic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1156589028 18:38465206-38465228 GCCATTGCCTCCATTTGGTGGGG - Intergenic
1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG + Intronic
1158354855 18:56606935-56606957 GCAATTACAACAATATACTGTGG - Intronic
1159019549 18:63132086-63132108 GCAACAGCATCTCTATGCTGAGG - Intronic
1162043123 19:7982272-7982294 GCAAGTGCATGGATAAGCTGCGG - Intronic
925082368 2:1080436-1080458 GCAAGTGTATCAATATGCTGAGG - Intronic
927525065 2:23732180-23732202 CCAATTGAATCCCTATGGTGAGG - Intergenic
929418746 2:41769606-41769628 GAAATTGCTGCCATATGGTGTGG - Intergenic
931531630 2:63221327-63221349 ACAATTGCATACATAAACTGTGG + Intronic
933151717 2:78923043-78923065 GCAATTGCATGCAATTGTTGAGG + Intergenic
940577081 2:155522608-155522630 GAAAATGCAGCCATTTGCTGAGG + Intergenic
942807876 2:179955429-179955451 GCAATTGAATTCATATCCTTGGG - Intronic
946931764 2:224678032-224678054 GAAATTGCCTCTAAATGCTGAGG + Intergenic
947470738 2:230399237-230399259 GTATTTGCATCCATGTGTTGTGG - Intronic
1170297022 20:14838969-14838991 GTAATAGAAGCCATATGCTGTGG + Intronic
1171059531 20:21943018-21943040 GCATTAGCATCCACTTGCTGTGG - Intergenic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1174456380 20:50651597-50651619 GCAATTCCATCCACTGGCTGTGG + Intronic
1175499830 20:59441898-59441920 GCACTTGCACCCACAGGCTGAGG - Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1177816837 21:25987020-25987042 GCCAATCCATCCACATGCTGGGG + Intronic
1178103770 21:29297793-29297815 GCATTTGCACCCACAGGCTGTGG - Intronic
1182104683 22:27681018-27681040 GGAATTGAATCCATTTGCTCAGG + Intergenic
1182414508 22:30212504-30212526 GCAAGTGCCTCCCTCTGCTGAGG - Intergenic
1182670568 22:31992075-31992097 GCACTTGCATTCATTTGCTAGGG - Intergenic
952277646 3:31892775-31892797 GCAATTGCAGGCAGATGCAGTGG + Intronic
952718135 3:36502908-36502930 GGAATTGCATCCATAAACTCTGG + Intronic
953216731 3:40925254-40925276 GGAATTTCATCCATTTGCAGGGG - Intergenic
954726069 3:52611841-52611863 CTGATTGCATCCATATGTTGTGG - Intronic
955963448 3:64364144-64364166 GGACTTGCATCCATAGGGTGAGG - Intronic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
958590843 3:96156206-96156228 GCAATTTCAGCCAGATGCAGTGG + Intergenic
960428523 3:117539475-117539497 GAAATTGCAGCCAGATGCCGGGG - Intergenic
960576354 3:119233574-119233596 CCAATTCCTTCCATATACTGAGG + Intronic
963923639 3:150929003-150929025 GAAATGGAAGCCATATGCTGTGG + Intronic
970548770 4:17157505-17157527 GAAATTGCATCCAAATTCGGTGG - Intergenic
971368952 4:26000197-26000219 GCAATTGCATTATGATGCTGAGG - Intergenic
971737523 4:30475013-30475035 AAAATTGCATCAATATTCTGAGG - Intergenic
974287533 4:59888828-59888850 GGAATTGCTTCCCTATGTTGTGG - Intergenic
975263471 4:72333399-72333421 GCTATTGAATCCATGGGCTGAGG - Intronic
977791553 4:101110696-101110718 GCAAATAAATCCATATTCTGAGG + Intronic
979935321 4:126686700-126686722 CCCTTTGCATCTATATGCTGTGG + Intergenic
981427754 4:144623183-144623205 GAAATTGCATCCAAAAGATGTGG + Intergenic
987325445 5:16808030-16808052 GCATCAGCATCGATATGCTGAGG + Intronic
991388711 5:66118713-66118735 GCAACTGTATACATATGCTAGGG + Intergenic
992627843 5:78649992-78650014 ACACTTGCATCCATATGCGCAGG + Intronic
993652216 5:90535853-90535875 GCAATTGCAGGCAGATGCGGTGG + Intronic
996364181 5:122682912-122682934 GCTAATGCGTCCATTTGCTGAGG - Intergenic
998947929 5:147361026-147361048 GCACTTGCAGCCATCTGTTGGGG - Intronic
1006609906 6:35288130-35288152 ACAGTGGCATCCTTATGCTGAGG + Intronic
1010940119 6:81906842-81906864 GCAAGTGCATAAATATGCGGTGG - Intergenic
1011103396 6:83749938-83749960 CCAATTGAATCCCTATGGTGAGG - Intergenic
1011897135 6:92242399-92242421 ACATTTGCTTCCATATGCTAGGG + Intergenic
1018963704 6:168466977-168466999 GCCATTGCAGCCACATCCTGCGG + Intronic
1023083701 7:36548982-36549004 GCAATTGCATCAATAAGCACAGG + Intronic
1024283116 7:47735760-47735782 GCACTTTCATCCTTACGCTGTGG + Intronic
1028441603 7:90869442-90869464 GCAATGGCATTCAGATTCTGTGG + Intronic
1031572388 7:123375252-123375274 GCAACTGCAGCCATATGCACAGG - Intergenic
1033794264 7:144828976-144828998 GCAAATACAGCCATATTCTGAGG - Intronic
1034439318 7:151078602-151078624 GCAATGGCTTCCAGAAGCTGGGG + Exonic
1044158875 8:88887626-88887648 GCTATTGCATCCAGAGGATGTGG - Intergenic
1046607306 8:116385877-116385899 GTAAGTGCAGCCATATTCTGAGG - Intergenic
1048156105 8:131953900-131953922 ACAATCTTATCCATATGCTGAGG - Exonic
1049051970 8:140204933-140204955 GGAATTTCATCAAAATGCTGAGG + Intronic
1053168830 9:35863859-35863881 GCCATTGCACCCACATGCAGAGG - Intergenic
1055115975 9:72606012-72606034 GCAAATGCCTCCACATTCTGAGG + Intronic
1056623442 9:88234528-88234550 GCAACTGTTTCCATATGCGGGGG - Intergenic
1056938956 9:90938681-90938703 GCTATTGCCTCCATATGATTTGG - Intergenic
1186604813 X:11078802-11078824 ACAATTGCCTCCTAATGCTGAGG + Intergenic
1187478429 X:19632616-19632638 GCTATTGCATCTCTTTGCTGAGG - Intronic
1191965446 X:66752500-66752522 GCAATGGCATATATTTGCTGGGG + Intergenic
1192200541 X:69063761-69063783 GCACTGTCATCCATATGCTCTGG - Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1199981854 X:152925417-152925439 GCAATGACAACCATATGATGGGG - Intronic
1202299722 Y:23399528-23399550 GAAACTGCATCCATATTCTCAGG - Intergenic
1202571087 Y:26271070-26271092 GAAACTGCATCCATATTCTCAGG + Intergenic