ID: 1146549581

View in Genome Browser
Species Human (GRCh38)
Location 17:33768913-33768935
Sequence CTCTCAGAGGAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 5, 2: 35, 3: 141, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146549581 Original CRISPR CTCTCAGAGGAGAGGGAAGC TGG (reversed) Intronic
900472393 1:2861280-2861302 CTCTCTGAGGAGAGCAAACCAGG + Intergenic
900715564 1:4141405-4141427 GTCTCAGAGAAGAGGGCTGCTGG + Intergenic
900907618 1:5571864-5571886 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
901138940 1:7015467-7015489 CATTCAGAGGAGAGGCAGGCTGG - Intronic
901184985 1:7367214-7367236 CTCTCTGAGGAGAAGAGAGCTGG - Intronic
901216776 1:7559499-7559521 ATCAGAGAGCAGAGGGAAGCGGG + Intronic
901617517 1:10553539-10553561 CTCTCTGAAGAAAGGGAAGATGG + Intronic
902142336 1:14367246-14367268 CTCTCAGCGGGAAAGGAAGCTGG + Intergenic
902610094 1:17592197-17592219 CACTCAGAGGTGAGGGGTGCAGG - Intronic
902929933 1:19723810-19723832 CTGTGAGAGGAGGGTGAAGCGGG + Intronic
903601682 1:24546565-24546587 CTCTCAGATGGAAGGAAAGCTGG - Intergenic
903687021 1:25139305-25139327 GCCTTAGAGGAGAGGGAGGCTGG - Intergenic
903848111 1:26290486-26290508 GCTTCAGAGGGGAGGGAAGCGGG + Intronic
904357036 1:29946941-29946963 CACTCAGAGTAGAGGTAAGAGGG + Intergenic
904774593 1:32899008-32899030 CTCTCAGTGCAGGGGGAACCTGG + Intronic
904850526 1:33455768-33455790 GGCCCAGAGGAGAGGGAAGGAGG + Intergenic
905243318 1:36595509-36595531 CTCCCAGAGGAGGAGGAAGCCGG - Intergenic
905244871 1:36605814-36605836 CTCTTAGAGGAGTCGGAAGGAGG + Intergenic
905522297 1:38609529-38609551 CTCTCAGCGGAAAGGGAAGCTGG + Intergenic
905836542 1:41127801-41127823 TTCTCACAGGAGAAGGAAGAAGG - Intronic
906017831 1:42598218-42598240 CCTTCAAAGGTGAGGGAAGCTGG + Intronic
906333622 1:44908950-44908972 TTCTGAGAGGAGTGGAAAGCTGG + Intronic
908229211 1:62087183-62087205 CTGTCAGTGGAGAGGGGAGCTGG + Intronic
908988638 1:70057198-70057220 CTCTCAGAGTAGAGAGAATAAGG + Intronic
909474851 1:76071478-76071500 GCCTCTGAGGAGAGGGAAGGTGG + Intergenic
909570535 1:77105125-77105147 CTCTCAGTGGACAAGGGAGCTGG + Intronic
909948682 1:81693126-81693148 CTCTTGGAGGAGAGGAAAGAAGG - Intronic
911205710 1:95090032-95090054 CTCTCAGAGGGAAGGGGAGCTGG + Intergenic
912963670 1:114218211-114218233 GTCTCAGAGGGGAGGGATGAAGG - Intergenic
913223133 1:116675415-116675437 ATCTGAGAGAAGAGGGAAGAAGG + Intergenic
915147280 1:153802586-153802608 GACTCAGAGTGGAGGGAAGCTGG + Intergenic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
916337779 1:163692644-163692666 CTCTCAGCTGAAAGGGAGGCTGG + Intergenic
916349914 1:163837326-163837348 CTCTGAGAGGAGAGAGAAAGAGG - Intergenic
916900295 1:169215105-169215127 CTCTCAGTGGAAAGGGGAGCTGG + Intronic
917162153 1:172069854-172069876 TTCTCAGATGAGTGGGAAGGAGG + Intronic
917210686 1:172628959-172628981 CACTCACAGGAGACGGAAGCAGG - Intergenic
917615832 1:176743266-176743288 CTAAAAGAGGAGAGGGAAACAGG + Intronic
917625937 1:176846378-176846400 CCCTAACAGAAGAGGGAAGCTGG + Intergenic
918202658 1:182281661-182281683 CTCACAGAGGACAGGGATGCAGG + Intergenic
919162795 1:193853397-193853419 CTCTCAGCAGGGAGGGGAGCAGG - Intergenic
919280696 1:195485409-195485431 TTCTCAGGGGAAAAGGAAGCAGG + Intergenic
919314556 1:195954823-195954845 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
919744462 1:200999968-200999990 CTCAGGGAGGACAGGGAAGCTGG + Intronic
920048006 1:203146043-203146065 CTCCCAGAGGAGCTGGAAGGAGG - Intronic
920074707 1:203327639-203327661 CTTTCAGAGAAGGGGGAGGCGGG + Intergenic
920278327 1:204825033-204825055 CTCTCAGTGGAAAGGGAGCCTGG + Intergenic
920812801 1:209302996-209303018 CTCACAGAGGAGAGGAAGGAGGG + Intergenic
922210963 1:223486525-223486547 CTCTCAGAACAAAGGGGAGCAGG + Intergenic
922334066 1:224604910-224604932 CTTTCAGAGGAGAGGGGACATGG + Intronic
922788893 1:228298891-228298913 GTATCACAGGAGAGGGAATCTGG - Intronic
922913828 1:229239547-229239569 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
923171582 1:231422008-231422030 CTCCCTGAGGCGAGGGTAGCGGG - Exonic
923410771 1:233707020-233707042 ATCACAGCGGAAAGGGAAGCAGG + Intergenic
923443112 1:234040112-234040134 CTCTCAGTGGAGAAGGCAGCTGG + Intronic
923863605 1:237916735-237916757 TCCTCAGAGGAGAGGAAAGAGGG - Intergenic
924315567 1:242791892-242791914 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
924319903 1:242838636-242838658 CTCTCAGCAGAGAGGGGAGTTGG - Intergenic
924380625 1:243460744-243460766 TACACAGGGGAGAGGGAAGCTGG - Intronic
1063414594 10:5863175-5863197 ATCCCACAGGAGAGGGAAGGGGG + Intronic
1063954594 10:11254825-11254847 CTCGGAGACGAGAGGGAAGGAGG + Intronic
1064003872 10:11684892-11684914 CTCTCAGAGGAGAGCGAAGAAGG + Intergenic
1064650701 10:17506408-17506430 CTCTCTGAGGAGAGGGGATGGGG + Intergenic
1065078150 10:22101606-22101628 CTCTAAGAGGAGAGAGCAGTGGG + Intergenic
1065365751 10:24935420-24935442 CTCTCAGGCCAGAGTGAAGCTGG - Intronic
1065979522 10:30878439-30878461 CTCTCAGTGGAGAGAGGAGCTGG - Intronic
1066438436 10:35415157-35415179 CACTCAGAGGAGATGGAGCCTGG + Intronic
1066438507 10:35415496-35415518 CTCTCAGAGGAGATGGAGCTGGG + Intronic
1067120940 10:43471615-43471637 CTCTCAGCAGAGAGGGGAACTGG + Intronic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1067497956 10:46775763-46775785 CTCGCAGAGGTCGGGGAAGCAGG + Intergenic
1068015917 10:51516166-51516188 CTCTCAGGAGAGAAGGGAGCTGG + Intronic
1068300426 10:55131684-55131706 CTCTCAGTGGAGAGGAGACCAGG + Intronic
1068443919 10:57095723-57095745 CCCTCAGAGGAGAGGAGACCTGG - Intergenic
1068998921 10:63241923-63241945 CTCTAAGACAAGAGGAAAGCAGG + Intronic
1069121839 10:64577164-64577186 CTCTCAGTGGAGAGGAGACCTGG - Intergenic
1069142176 10:64840180-64840202 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
1069833890 10:71296734-71296756 CTGGCAGAGGTGAGGGAAGTCGG + Exonic
1070204473 10:74242903-74242925 CTCTCAGTGGAGAGGGGAGCTGG - Intronic
1070244881 10:74721469-74721491 ATCTGAGAGTAGAGGGAATCAGG - Intergenic
1070370593 10:75778412-75778434 CTCACAGAGCAGGGGGAAGGTGG - Intronic
1070745709 10:78932454-78932476 GTCTCCGAGGAGAGAGAGGCAGG - Intergenic
1071149770 10:82620392-82620414 CTCTCGGCAGAGAGGGGAGCTGG + Intronic
1071417262 10:85452963-85452985 CTCTCACAGGAGACAGATGCTGG - Intergenic
1071704449 10:87982183-87982205 CTCTAAAATGAGAGGGAGGCAGG - Intergenic
1072188404 10:93062503-93062525 TTCTTAGAGGAGATGGCAGCTGG + Intronic
1073086683 10:100895479-100895501 CTCCCCAAGGAGAGGAAAGCAGG - Intergenic
1073639968 10:105241659-105241681 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1073728803 10:106267411-106267433 CTCTCAGTGGAGTGGGGAGCTGG - Intergenic
1073972501 10:109060815-109060837 CTCTCAGTGGAAAGGGGAGCTGG - Intergenic
1075353959 10:121753833-121753855 CTCAAAGATGAGAGGGAAGTTGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075663992 10:124217924-124217946 CTCTCAGAGGACAGTCAAGGAGG + Intergenic
1076178993 10:128391318-128391340 CTCCCTGAGGACAGTGAAGCAGG + Intergenic
1076225091 10:128768185-128768207 TTCTTTGAGGGGAGGGAAGCTGG + Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076523130 10:131093530-131093552 CACTCAGAGGAGAGACAAGGGGG - Intronic
1077250595 11:1559012-1559034 CTCGCAGAGGCCGGGGAAGCAGG + Exonic
1077275709 11:1706607-1706629 CTCTCAGCAGAGAGGGGAACTGG - Intergenic
1077391540 11:2302733-2302755 CTCTCACGGGACCGGGAAGCTGG + Intronic
1077573262 11:3356858-3356880 CTCTCAGAGGGGAAGTAAGGGGG + Intronic
1077904459 11:6519103-6519125 CTATTAGAGGAGAGGGAATGTGG - Intronic
1079087836 11:17460028-17460050 CTGTCAGAGGAGAGAGAAGTGGG - Intronic
1079245217 11:18747093-18747115 ACCTCAGAGGAGAGGGAACATGG + Intronic
1079646212 11:22866395-22866417 CTCTCAGCAGTGAGGGGAGCTGG - Intergenic
1080425514 11:32150543-32150565 CTTACAGAGGAAAGGGATGCTGG + Intergenic
1080604406 11:33852881-33852903 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1080605573 11:33862199-33862221 CCCTCAGAGGGGAGGGACCCTGG + Intronic
1080883063 11:36340685-36340707 CTCTAAAAGGAGAGAGAAGCAGG + Intronic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081109868 11:39121469-39121491 CTCTCAGTGGAGAGGAGAGCTGG + Intergenic
1081964994 11:47164159-47164181 CTTTCAGAGAAGAGAGAAGCAGG + Intronic
1081990582 11:47335267-47335289 CTATCAGAGGAGTGGGCAGTGGG - Intronic
1082663826 11:55949350-55949372 CTCTCAGGGGAGAGGGGAGCTGG - Intergenic
1082811431 11:57481452-57481474 CTAGCAGAGGGGAGGGAAGTGGG + Intergenic
1083031952 11:59600778-59600800 ATCTCAGAGGTGAGGGACGTGGG - Intronic
1083306021 11:61762420-61762442 CTCTCTGAGAGAAGGGAAGCCGG - Intronic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084647978 11:70471719-70471741 CTCTCGGAGGCCAGGGAAGATGG - Intronic
1084875009 11:72124622-72124644 CTCTCAGCAGAAAGGGGAGCTGG + Intronic
1085278587 11:75315540-75315562 CTCACAGAGGGGAGGGCAGCGGG - Intronic
1086001854 11:81993093-81993115 CTCTCAGTAGATAGGGGAGCCGG - Intergenic
1086002116 11:81996445-81996467 CTCTCAGTGGAGAAGGGAGCTGG + Intergenic
1087439241 11:98161640-98161662 CTCTCAGAGGAAGGGGAAACCGG - Intergenic
1087602975 11:100339346-100339368 CTCTCAGTGGAGAAGGGAGCTGG + Intronic
1087608418 11:100405382-100405404 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1087762018 11:102111342-102111364 CTCTGGGAGGAGTGGGGAGCTGG - Intronic
1087904796 11:103683135-103683157 CTCTCAGAGGAGTAGGAGGAGGG - Intergenic
1088390806 11:109312816-109312838 CTCTCAGAGGAGAAGGCCGAGGG + Intergenic
1088903986 11:114140170-114140192 GTTTCAGATGAGAGGGAAACAGG - Intronic
1089113925 11:116078761-116078783 ATCTCAGAAAAGAGGGAAGAGGG + Intergenic
1089201518 11:116727318-116727340 GCCTCAGAGGAATGGGAAGCTGG + Intergenic
1089577865 11:119459544-119459566 ATCTGAAAGGAGAGGGGAGCAGG + Intergenic
1089659529 11:119977011-119977033 CTCACAGAGGAGAGGGAGCCTGG + Intergenic
1090135857 11:124198763-124198785 CTCTCAGAGGGAAGGGGAGCTGG - Intergenic
1090208324 11:124897850-124897872 CTCACAGTGAAGAGGGAAGGAGG + Exonic
1090320039 11:125835199-125835221 CTTTCAGAGGAGTTGGGAGCAGG - Intronic
1090668063 11:128927947-128927969 CACTCAGAGGGGAGGAAAGCGGG - Intergenic
1090678916 11:129032005-129032027 CTCTCAGAGGGATGGGGAGCTGG - Intronic
1091082205 11:132681529-132681551 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
1091382685 12:72570-72592 CTCTCAGAGGTGAGGCCATCTGG + Intronic
1091635636 12:2194410-2194432 TGCTCAGAGGAGGGGGAAGAGGG - Intronic
1091641149 12:2238647-2238669 CTCTGGGAGCAGAGGGAACCTGG + Intronic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092491912 12:8953219-8953241 CTCTCAGCGGAGAGGGGATGTGG + Intronic
1093592329 12:20917655-20917677 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1093731230 12:22568032-22568054 CTCTCAGCGGAGAGGGGAGCTGG + Intergenic
1093731379 12:22569138-22569160 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1093990754 12:25587402-25587424 CTCACAGCAGAAAGGGAAGCAGG + Intronic
1094191805 12:27705800-27705822 CTCTCAGCCGAGAGGGGAGCTGG + Intergenic
1094453048 12:30602198-30602220 ATCTCAGATGAGAAGGAACCAGG + Intergenic
1095750890 12:45709568-45709590 TGCCCAGAGGAGAGGAAAGCTGG - Intergenic
1095874292 12:47063717-47063739 CTCTCTGAAGAGAGGGACACAGG - Intergenic
1096143752 12:49264457-49264479 CCCTCAGCGGCGAGGGGAGCGGG + Intronic
1096594538 12:52686246-52686268 CTCTCAGAGCAAAGAGCAGCTGG + Intergenic
1096673739 12:53215193-53215215 GTCTCAGAGGTCAGGGAAGTGGG + Intronic
1096896522 12:54826243-54826265 CTCACAGTGAAGAGGGAAGAGGG - Intergenic
1096919884 12:55072446-55072468 TTCTCAGTGGACAGGGGAGCTGG + Intergenic
1097090415 12:56500232-56500254 TCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1097339288 12:58419146-58419168 TTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1097503705 12:60438367-60438389 CTCTCAGCGGGAAGTGAAGCTGG + Intergenic
1097746601 12:63310482-63310504 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1097747848 12:63318825-63318847 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1098545610 12:71707862-71707884 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1099730060 12:86489275-86489297 CTCTCAGTGGGGAGGGGAGCTGG - Intronic
1100293070 12:93235790-93235812 TTCTCAGTGGGAAGGGAAGCTGG - Intergenic
1100531949 12:95469106-95469128 CTCTCAGCGGAAAGAGAGGCTGG + Intergenic
1100757942 12:97773059-97773081 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1101432098 12:104635098-104635120 ATCTCAAAGGAGAATGAAGCTGG - Intronic
1101549516 12:105748996-105749018 CTCTGAGACGAAAGGAAAGCGGG - Intergenic
1101766774 12:107708243-107708265 TTTTGAGATGAGAGGGAAGCAGG - Intronic
1101901984 12:108797732-108797754 CCCTCAGCAGAGAGGGGAGCTGG - Intronic
1101957095 12:109221579-109221601 GTTTCAGAGGAGAGGGACGTGGG - Intronic
1102541225 12:113620699-113620721 TTGTCAGGGGAGAGGGAAGGAGG - Intergenic
1104054160 12:125216616-125216638 CTCACAGAGCAGAGAGAATCAGG - Intronic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104235968 12:126936906-126936928 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1104285152 12:127418262-127418284 CTCTCAGTGGAGAGGAGAGCTGG - Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1104909843 12:132235470-132235492 AGCTCAGAAGAGAAGGAAGCTGG + Intronic
1104927346 12:132320775-132320797 ATCTCAGAGGCGAGGGGAGGTGG + Intronic
1104997488 12:132667688-132667710 CTCCCAGAGCAGAGGGAGCCAGG + Intronic
1105290876 13:19052594-19052616 CTCTCCGAGGAGTGGGATGGGGG + Intergenic
1105434324 13:20363690-20363712 CTCCTAGGAGAGAGGGAAGCAGG - Intergenic
1105461964 13:20599963-20599985 GTCTTAGAAGAGGGGGAAGCTGG + Intronic
1105492687 13:20903242-20903264 CGCTCTGAGGAGGGGAAAGCGGG - Intergenic
1105603801 13:21910240-21910262 TTCTCTGAGGACAGGGAAGATGG - Intergenic
1106525675 13:30539323-30539345 CTCACAGAGGTGAGGGGAACAGG + Intronic
1107037053 13:35912602-35912624 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1107801548 13:44112831-44112853 CTCTCACAGGAAAAGGAAACAGG - Intergenic
1107911118 13:45106638-45106660 CTCTCAGCAAAGAGGGGAGCCGG + Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109855988 13:68128825-68128847 CTCTCAGCCAAGAGGGCAGCTGG + Intergenic
1109883034 13:68506975-68506997 CTCTCGGCAGAGAGGGTAGCTGG - Intergenic
1110175780 13:72553937-72553959 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1111047183 13:82829280-82829302 CTCTCAGCAGAGTGGGAAGCTGG + Intergenic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1111442815 13:88303363-88303385 CGCTCAGAGCAGAAGGAAGTGGG - Intergenic
1111726250 13:92013276-92013298 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1112621564 13:101058781-101058803 CTCGCATGGGAGAGGGAGGCAGG - Intronic
1112759087 13:102672727-102672749 ATCTAAGAGGAGGGGGAAGGAGG + Intronic
1113049007 13:106187755-106187777 AGCTCAGAGGATGGGGAAGCAGG + Intergenic
1113371448 13:109728907-109728929 GTCTGTGAGGAGAGGGAGGCAGG + Intergenic
1113876580 13:113598413-113598435 CTCTCCTGGGAGAGGGATGCTGG + Intronic
1115507758 14:34109223-34109245 CTAGCAGAAGAGAGGGAAGGAGG + Intronic
1116125980 14:40785414-40785436 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1116464194 14:45212914-45212936 CTCTCAGAAGAGGGCCAAGCAGG - Intronic
1116569667 14:46499547-46499569 TCCACAGAGGAGAGGCAAGCTGG - Intergenic
1116712267 14:48383463-48383485 CTCTCAGTGGAGAGGAAAGGTGG + Intergenic
1116716351 14:48431377-48431399 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1117294407 14:54366016-54366038 CTCTCACAGGAGAGTGTAACTGG - Intergenic
1117450559 14:55845695-55845717 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
1117928575 14:60812818-60812840 CTCTTAGCAGAGAGGGGAGCTGG - Intronic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1118406986 14:65434601-65434623 CTTACATAGGAGAGAGAAGCAGG + Intronic
1118473871 14:66099488-66099510 TTCTCAGTGGAAAGGGAGGCTGG - Intergenic
1118486152 14:66216023-66216045 TTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1118495379 14:66303603-66303625 CTCATGGAGGAGAGTGAAGCAGG - Intergenic
1119021684 14:71121595-71121617 TTCTCAGTCGAGAGGGGAGCTGG - Intergenic
1119257130 14:73208414-73208436 CTCTCAGTGGAGAGGAGACCTGG + Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1121254638 14:92522185-92522207 CTAACAGAGGAGGGGGAAGAAGG - Intronic
1121729080 14:96173864-96173886 CTCTGTGAGGAGAGGGCAGGTGG + Intergenic
1121880098 14:97492356-97492378 TTCTCAGAGGAAAAGCAAGCTGG - Intergenic
1122906054 14:104801991-104802013 CCCTCAGCGGAGAGGGCAGCCGG + Exonic
1122997519 14:105273375-105273397 CTCTTAGAGGAGAGGCTGGCGGG - Intronic
1123004869 14:105316291-105316313 TTCCCAGAAGAGAGGCAAGCAGG - Intronic
1123500651 15:20878198-20878220 ATCCCAGAGGAGAGGGGTGCGGG - Intergenic
1123557896 15:21451891-21451913 ATCCCAGAGGAGAGGGGTGCGGG - Intergenic
1123594125 15:21889172-21889194 ATCCCAGAGGAGAGGGGTGCGGG - Intergenic
1124096209 15:26650913-26650935 CTCTCAGTAGAGAGTGGAGCTGG - Intronic
1124215982 15:27807312-27807334 CTCTCAGACCACAGGGCAGCTGG + Intronic
1124254659 15:28130962-28130984 CTCTCAGAGCAGAGGCCCGCGGG + Intronic
1124621338 15:31275795-31275817 ATGTCAGAGGACAGGGAACCCGG - Intergenic
1124782060 15:32645447-32645469 GTCTGAGTGGAGAGGGAAGTGGG + Intronic
1124930478 15:34114810-34114832 CTCTCAGCAGAGAGGAGAGCTGG - Intergenic
1126087484 15:45023384-45023406 GGCTCAGAGGAGAGTGAGGCAGG - Intronic
1127308010 15:57727183-57727205 CTGTCAGAGGTGCTGGAAGCGGG - Intronic
1127395638 15:58542004-58542026 CTCTCAGAGGAAGGGAAAGGAGG - Intronic
1127999891 15:64181128-64181150 CTCTCCGACAAGAGGGAAGATGG + Intronic
1128096290 15:64959030-64959052 CTCACAGAGGAGACAGAAGTGGG + Intergenic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1129919414 15:79307319-79307341 CTCTGTGATGAGAGGGAGGCTGG + Intergenic
1130650133 15:85757802-85757824 CTCCCAGAGAAGCGGGAGGCAGG + Intergenic
1132271364 15:100528889-100528911 CTCTCTGAGGAGAACGAAGCTGG - Exonic
1202966247 15_KI270727v1_random:179063-179085 ATCCCAGAGGAGAGGGGTGCGGG - Intergenic
1132659896 16:1056677-1056699 CTCTCAGAGGGAGGGGGAGCTGG + Intergenic
1132678521 16:1130493-1130515 GCCTCAGAGGAGAGGGATGCAGG - Intergenic
1132967816 16:2669052-2669074 CCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1134365977 16:13579549-13579571 CTCTCAGAAGACAGGGGAGCTGG + Intergenic
1135161958 16:20104255-20104277 CTCATAGAGGCTAGGGAAGCAGG - Intergenic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135492236 16:22919511-22919533 CACTTAGATGTGAGGGAAGCTGG + Intergenic
1135926821 16:26702080-26702102 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1136242824 16:28954939-28954961 CACAGAGAGGACAGGGAAGCTGG - Intronic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137004883 16:35266640-35266662 CTCTGAGAAGAGAGGGACGTAGG - Intergenic
1137263751 16:46852103-46852125 CTCCCAGGGGAGAGGGAAAATGG - Intergenic
1137540625 16:49359280-49359302 CTGTCAGAGGACAGAAAAGCTGG + Intergenic
1137960430 16:52876905-52876927 TTCACAGAGGAGATGGAAGGGGG + Intergenic
1138152331 16:54670235-54670257 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1138902974 16:61296761-61296783 CTCACAGTGGAAAGGGAGGCTGG + Intergenic
1139197270 16:64934069-64934091 CTGTCAGAGGAGATGGAATGAGG + Intergenic
1139587557 16:67913910-67913932 GTCTTAGAGAAGAGGGAACCTGG + Intronic
1139739774 16:69025308-69025330 CTCTCAGCAGAGAAGGGAGCTGG + Intronic
1140076023 16:71699511-71699533 CTCTCAGTGAAGAGTGGAGCTGG - Intronic
1140205913 16:72933315-72933337 CTCCCAGAGGAGTAGGAAGGTGG + Intronic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1140772948 16:78222895-78222917 CTCTCAGAGGAGATGCAAATAGG + Intronic
1140787378 16:78355804-78355826 CTCTCAGTGGAGGGGCAACCAGG - Intronic
1140792802 16:78408423-78408445 CTCTCAGTGGAGAGGGAATGTGG - Intronic
1141738129 16:85869072-85869094 TTCACTGTGGAGAGGGAAGCAGG + Intergenic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143674585 17:8422533-8422555 CCCTTCCAGGAGAGGGAAGCAGG - Intronic
1143706773 17:8703535-8703557 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1143889578 17:10092282-10092304 CTCTCAGAGCAAAGGGTGGCAGG - Intronic
1144888092 17:18477559-18477581 GTCTCAGAGGTGACGGAGGCAGG + Intronic
1145144113 17:20466744-20466766 GTCTCAGAGGTGACGGAGGCAGG - Intronic
1145244535 17:21259716-21259738 CACTCAGAGGAGGCTGAAGCAGG - Intergenic
1145297215 17:21601248-21601270 CTCTTAGATGAGAGGCCAGCAGG - Intergenic
1146521167 17:33526703-33526725 CTCTCAGATGCTAGGCAAGCAGG - Intronic
1146538827 17:33677013-33677035 CTCACAGTGGAAGGGGAAGCAGG - Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146601162 17:34217783-34217805 CACTCTGATGATAGGGAAGCTGG + Intergenic
1146736932 17:35246454-35246476 CTGTCAGAGGAGGGGGCAACAGG - Intronic
1146835167 17:36104863-36104885 TATTCAGAGGACAGGGAAGCAGG + Intronic
1146849781 17:36212109-36212131 TATTCAGAGGACAGGGAAGCAGG + Intronic
1147193661 17:38750934-38750956 CTCGCAGAGGACAGGAACGCGGG + Exonic
1147230771 17:39016201-39016223 CTCTCAGTGGAAAGGGAGGCTGG + Intergenic
1147569132 17:41556887-41556909 CTCTCAGTGGAAAGGGAGGATGG - Intergenic
1147686019 17:42287434-42287456 GGCCCAGAGGAGAGGGAAGCTGG + Intergenic
1147865199 17:43547221-43547243 CTCTCAGATAAGAGGGAAGATGG - Intronic
1148957586 17:51366353-51366375 CTCTCAGTGGAAAGGAAGGCTGG - Intergenic
1149656208 17:58310808-58310830 CTGTCTGGGGAGAGGGGAGCAGG - Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150301321 17:64049426-64049448 ATCTCACATGAGAGGGAACCAGG - Intronic
1150315908 17:64168614-64168636 ATTTCCGAGGAGAGGGGAGCAGG - Intronic
1151018493 17:70584796-70584818 CCCTCAGTGGAGAGGGGAGCTGG + Intergenic
1151311260 17:73293677-73293699 CTCTAAGAGGTGAGGGACTCTGG + Intronic
1151418523 17:73982482-73982504 CCCTCAGAGGAGATTGTAGCTGG - Intergenic
1151806631 17:76409806-76409828 CCCTCCGAGGAGAGGGATTCTGG + Intronic
1152293488 17:79453863-79453885 CTGGCAGAGGAGAGGAAAGGGGG + Intronic
1152442570 17:80317962-80317984 CTCTCCATGGAGAGGGGAGCTGG + Intronic
1152780876 17:82227027-82227049 CCCTCAGAGGGGAGGGGAGCAGG - Intergenic
1152924961 17:83082943-83082965 ATGTGAGAGGAGAGGGGAGCAGG + Intronic
1152936880 17:83144129-83144151 CTTTCAGATGATGGGGAAGCCGG + Intergenic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1153723862 18:7936212-7936234 CTCTAAGAGCACAGGGATGCTGG - Intronic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1154384457 18:13880575-13880597 CTCTCAGTGGACAGGGAAGCTGG - Intergenic
1155017867 18:21863456-21863478 CTCTCAGCAGAGAGGGGAACTGG + Intronic
1155310454 18:24518070-24518092 TTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1155637786 18:27975849-27975871 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1155676223 18:28432226-28432248 CTGTCAGAGGAGGGGCAAGTGGG - Intergenic
1155799964 18:30089388-30089410 CTCTCAGTAGAGAAGGGAGCTGG - Intergenic
1155840206 18:30633612-30633634 TTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1156651666 18:39233512-39233534 CCCTCAGTGGAGAGGGGAGCTGG + Intergenic
1156772169 18:40741820-40741842 CTCTGAGTGGAGTGGGCAGCTGG + Intergenic
1156783662 18:40882462-40882484 CTCTCAGTGGTGAGGGACGTGGG - Intergenic
1156905604 18:42348661-42348683 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1156911638 18:42417541-42417563 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
1156946909 18:42844457-42844479 TTCTCAGTGTAGAAGGAAGCTGG + Intronic
1157127865 18:44974284-44974306 CTCAGAGGGAAGAGGGAAGCAGG + Intronic
1158338158 18:56435720-56435742 GTCTCAGGGGAGAGGGAGGTAGG - Intergenic
1158491760 18:57916442-57916464 CTCTCAAAGCTGAGGGAGGCAGG + Intergenic
1158596416 18:58820364-58820386 CTCTCAGAGGAGAAGGAGAAAGG - Intergenic
1159076264 18:63685108-63685130 CTTTCAGTGGAGAGGGAACATGG + Intronic
1160474132 18:79167405-79167427 CTCTCAGTGGAGAGGAGACCCGG + Intronic
1160474158 18:79167545-79167567 CCCTCAGAGTAGAGGGGACCCGG + Intronic
1161313952 19:3609217-3609239 CTTGCAGAGGACAGGGCAGCAGG - Intergenic
1161479788 19:4504772-4504794 CTCCCACAGGAGCGGGATGCCGG - Exonic
1162765013 19:12913911-12913933 ATGTGCGAGGAGAGGGAAGCTGG + Intronic
1163395568 19:17058569-17058591 CTCTCAGAGGAAGCGGGAGCTGG - Exonic
1163821344 19:19498267-19498289 CTCTCAGAAGCCAGGGCAGCAGG - Intronic
1164084512 19:21889047-21889069 TCCTCAGAGGAGAGGAAAGAGGG + Intergenic
1165127837 19:33613250-33613272 CTCTCTGAGGACAGGGACGGGGG + Intergenic
1166377231 19:42334342-42334364 CTCTGGAAGGAGAGGGAAGTGGG - Intronic
1166766247 19:45253160-45253182 CTGTCGGAGGTGAGGGAAACAGG - Intronic
1166896247 19:46023329-46023351 CACTGAGAGGAGAGACAAGCAGG - Intergenic
1166907283 19:46120111-46120133 CTCTCAGCGGGAAGGGGAGCTGG + Exonic
1167360852 19:49029683-49029705 CTCTCAGAGGACATGGAAACAGG - Intronic
1168325847 19:55537881-55537903 GACTCAGAGGGGCGGGAAGCAGG - Intergenic
925024896 2:599877-599899 CACCCAGAGGAGAGGGAAGAGGG + Intergenic
925172460 2:1758870-1758892 CTCCCACAGGGGAGGGAAGGGGG - Intergenic
925310543 2:2878560-2878582 CTCTCAGCAAAGAGGGGAGCTGG + Intergenic
925319172 2:2948811-2948833 CCCAGAGAGGAGAGGGGAGCTGG + Intergenic
925390421 2:3490418-3490440 CTCTCAGTGGAGAGGTTAGAGGG - Intergenic
925708430 2:6713461-6713483 CTCCCAGACAAGAGGGATGCTGG - Intergenic
926088024 2:10032336-10032358 GTCTCTGAGGAGTGGGCAGCGGG - Intergenic
926114627 2:10204585-10204607 CTCTCAGAGGAGCAGCTAGCTGG + Intronic
926395287 2:12435025-12435047 CACTGATGGGAGAGGGAAGCAGG - Intergenic
926562713 2:14435123-14435145 CTTTCAGCGGAGAGGGGAGCTGG + Intergenic
927061446 2:19426362-19426384 ATCTCAGACGAGAGTGAAACTGG - Intergenic
927289555 2:21392608-21392630 GGCTAAGGGGAGAGGGAAGCAGG - Intergenic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928165132 2:28965717-28965739 CTCTTAGAGAAGAGGGAGGTAGG - Intronic
928252822 2:29696829-29696851 CTCCCAGAGCAGTGGGAAGCTGG - Intronic
929560405 2:42952974-42952996 CTCTGAGAGGAGAAGGGAGGAGG - Intergenic
930533205 2:52615472-52615494 CTCTCAGTGGGATGGGAAGCAGG - Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
931254153 2:60555472-60555494 CGCTCCGAGGAGAGGGAAGGAGG - Intergenic
931851397 2:66254856-66254878 CTCCCAGAGAAGAGGAAAGTGGG - Intergenic
932360773 2:71103837-71103859 CTCTCAATAGAGAGGGGAGCTGG - Intergenic
932821949 2:74909104-74909126 CTCTCAGCGGAAAGGGAGGCTGG - Intergenic
932968747 2:76512397-76512419 TTGCCAGGGGAGAGGGAAGCAGG - Intergenic
933250628 2:80024953-80024975 GTCTCAGAGGGAAGGGGAGCTGG + Intronic
933258577 2:80107509-80107531 CTATCAGCAGAGAGGGGAGCAGG - Intronic
933298225 2:80514595-80514617 CTCTCAGAAGAGAGGGGAGTGGG + Intronic
933336449 2:80965694-80965716 CTCCTAGATGAGAGGGAGGCTGG + Intergenic
933681185 2:85102393-85102415 CTCTCAGTGGAGGGGCAACCAGG + Intergenic
934041335 2:88129761-88129783 CTGTCAGAGGAGGGCCAAGCAGG - Intergenic
934818690 2:97353222-97353244 TTCACAGGGGAGAGGGAAGTGGG - Intergenic
934857830 2:97739846-97739868 CGCTCAGACAAGAGGGAAGCTGG - Exonic
935050848 2:99523811-99523833 CTCTCAGAGAAGGGGGAAAGGGG + Intergenic
935729857 2:106056294-106056316 CTGTCAGCGGAAAGGGAGGCTGG + Intergenic
936027804 2:109046855-109046877 CTGACAGTGGAGAGGGGAGCAGG + Intergenic
936846562 2:116842031-116842053 CTCTCAGCAGAGAGGGGATCTGG - Intergenic
937268770 2:120633739-120633761 CTCTCACAGGAGATGAAAGCTGG + Intergenic
937384146 2:121411210-121411232 TTCTGATATGAGAGGGAAGCGGG + Intronic
937907588 2:127059739-127059761 ATCACAGAGGAGTGGGCAGCTGG + Intronic
938016663 2:127872912-127872934 GTGTCAGAGGAGAGGAAACCTGG - Intronic
939583978 2:143984838-143984860 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
940173134 2:150850050-150850072 CTCCCAGCAGAGAGGGGAGCTGG + Intergenic
940345327 2:152622786-152622808 TTCTCAGAGGAAATGGAAGAGGG - Intronic
940537199 2:154960318-154960340 GTCTCAGAAAATAGGGAAGCTGG + Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
943345754 2:186735003-186735025 CCCTGAGAGCAGAGGGATGCTGG + Intronic
943960259 2:194254713-194254735 CTCTCAGAAGAGAGGAAACCTGG - Intergenic
944845104 2:203660173-203660195 CTCTCAGAGGAGACGGGAGAAGG + Intergenic
945471143 2:210228995-210229017 CTCTCAGTGGAAAGGGAAACTGG + Intergenic
945874942 2:215268127-215268149 CCCTCAGGTCAGAGGGAAGCTGG - Intergenic
946811541 2:223530787-223530809 CTTTCAGAGGAGAGGAGAGCTGG - Intergenic
946907423 2:224430134-224430156 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
947227295 2:227852772-227852794 GTCTCAGCAGAGAGGGAAGCTGG + Intergenic
947573068 2:231250558-231250580 CTCCCAGAGGGGAGGGTAGACGG + Intronic
947828533 2:233123039-233123061 CACTGAGAGGAGAGTGAAGGAGG + Intronic
947933572 2:233984328-233984350 ATCTCAGAGGAGGGGGCAGTGGG - Intronic
948056213 2:235010890-235010912 CTCTCCTAGGAGAGGGAGGAAGG - Intronic
948326608 2:237126813-237126835 TTCTCAGAGGACAGGAAAGAAGG + Intergenic
948376571 2:237524898-237524920 CTCCAGGAGGAGGGGGAAGCAGG + Intronic
948383852 2:237569401-237569423 CTGTCAGGGGATAGGGAAGAGGG + Intergenic
948967130 2:241391556-241391578 CTCTCAGAAGTGGGGGAAGGTGG - Intronic
1168938134 20:1685708-1685730 ATTACAGAGGAGTGGGAAGCAGG + Intergenic
1169027816 20:2385060-2385082 CTCTCAGAGGTACGGCAAGCTGG + Intronic
1169028096 20:2386583-2386605 CTCTCAGAGGTATGGCAAGCTGG + Intronic
1169557544 20:6767438-6767460 CTCTCAAAGGAGAGATCAGCTGG - Intergenic
1170620916 20:17995161-17995183 GTCTCAGGGGAGAGGGAAATGGG - Intronic
1170807661 20:19647138-19647160 CTCTGAGAGGAGAGGGAGCTGGG - Intronic
1170858901 20:20084519-20084541 CTCTCAGACTCGAGGGAAGCAGG + Intronic
1172182256 20:33010699-33010721 CTCCCAGAGGAGATGGGATCTGG + Intronic
1172486955 20:35304144-35304166 CTCCCAGAGGAGAGGAAGGAAGG + Intronic
1172913110 20:38424817-38424839 CTGTCAAAGGACAGTGAAGCAGG - Intergenic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173054350 20:39596978-39597000 CCCTCAGTGTAGAGGGAACCTGG + Intergenic
1173058187 20:39636324-39636346 CTCTCAAAGGAGAGGGGATGTGG - Intergenic
1173282764 20:41643987-41644009 CCATCAGAGGAGAGGGAGGATGG + Intergenic
1174102261 20:48136777-48136799 CTCTCAGTGGAAAGGGAGGCTGG - Intergenic
1174303756 20:49600692-49600714 CTCTGAGAGCAGAGGGGAGGGGG - Intergenic
1174578829 20:51556597-51556619 ATCTAAGAGGAGATGGAAACTGG + Intronic
1174737789 20:52982116-52982138 CTCTCAGAGGAGGGGACATCTGG + Intronic
1174774486 20:53331497-53331519 CTCTGAGGGGAGAGGGGAGAGGG + Intronic
1175299080 20:57930157-57930179 CTCAGAGATGAGAGAGAAGCGGG + Intergenic
1175369071 20:58474878-58474900 ATCTAAGAGGAGAGGGGAGCGGG - Intronic
1175543344 20:59762055-59762077 GTCAGAGAGGAGAGGGAAGATGG + Intronic
1176717861 21:10368512-10368534 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1177962089 21:27679948-27679970 CTCTCAGCAGAGATGGGAGCTGG + Intergenic
1177967353 21:27744527-27744549 CTCTCAGTGGAGAGGGTTGCTGG + Intergenic
1178179117 21:30139546-30139568 CTCTCAGTGGAGAGTGAAGATGG + Intergenic
1178466545 21:32853650-32853672 CTCTCAGTGGAGAGGGAACATGG + Intergenic
1178719047 21:34992134-34992156 CCCTCTCAGGAGAGTGAAGCGGG + Intronic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179452623 21:41475991-41476013 ATCCCAGAGGAGAGGGACGGTGG + Intronic
1179716535 21:43291453-43291475 CACTCAGAGAAGAGGGCAGAAGG + Intergenic
1179790987 21:43755867-43755889 CTCCCAGAGGTGAGGTCAGCAGG - Intronic
1180299087 22:11021418-11021440 ATTTCTGAGAAGAGGGAAGCAGG + Intergenic
1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG + Intronic
1181632370 22:24157883-24157905 CTCTCAGCAGAGAGGGCTGCTGG - Intronic
1181665517 22:24393297-24393319 CTCACAAATGAGAGGGAATCTGG + Intronic
1181807870 22:25385923-25385945 ATTTCAAAGGTGAGGGAAGCAGG + Intronic
1183684740 22:39355216-39355238 CTCTGAGGGCAGTGGGAAGCTGG + Intronic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184273037 22:43395628-43395650 CTCTCAGTGGAGGGGACAGCTGG + Intergenic
1184620769 22:45674512-45674534 CTCTCAGAGGAGCAGGAGTCTGG - Intronic
1184716467 22:46285114-46285136 CTCTGAGAGGAGGTGGAGGCCGG + Intronic
1185262142 22:49873326-49873348 GTCTCAGGGAAGAGGGAGGCTGG + Intronic
1185388858 22:50548408-50548430 GCCTAAGAGGAGAGGGAACCAGG + Exonic
949227405 3:1711163-1711185 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949414336 3:3799655-3799677 CTCTCAGAGGCCAGGGCAGGGGG - Exonic
949426194 3:3918729-3918751 CTGTAAGAGCAGAGTGAAGCAGG + Intronic
949474603 3:4431503-4431525 CTCTCAGTGGAGAGGGGACATGG - Intronic
949675434 3:6447909-6447931 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949708193 3:6842851-6842873 CTCTCAGCGGGAAGGGGAGCTGG - Intronic
949875127 3:8621495-8621517 CTGTCAGAGGAGAGGCCAGGGGG + Intronic
950203784 3:11062655-11062677 CTCCCTGAGGGGAGGGCAGCGGG - Intergenic
950204444 3:11067931-11067953 CTCTCAGTGGGATGGGAAGCTGG - Intergenic
950254472 3:11493161-11493183 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
950620075 3:14198086-14198108 CTCTCAGTGGAGGGGCAACCAGG - Exonic
950997471 3:17518522-17518544 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
951004357 3:17599466-17599488 CTCTCAGTGGAATGGGGAGCTGG - Intronic
951238663 3:20264959-20264981 CTGTCAGTGGAGAGGAGAGCTGG - Intergenic
951651826 3:24959330-24959352 CTCTCAGTGGGAAGGGGAGCTGG + Intergenic
952257358 3:31706915-31706937 CTGTCTGAGGAGGGGAAAGCAGG - Intronic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
953010452 3:39020551-39020573 CTCTCAAGGGACAGGAAAGCTGG - Intergenic
953082720 3:39635618-39635640 CACGCAGAGGAGGAGGAAGCAGG + Intergenic
953690412 3:45112897-45112919 CTCTCAGAAGTGAGGAAAGCAGG - Intronic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
953864634 3:46573628-46573650 CTCTCAGAACAGCTGGAAGCTGG + Intronic
953920572 3:46948675-46948697 CACTCAGAAGAGAGGCACGCTGG + Intronic
954407803 3:50355242-50355264 TGCTCTGAGGAGAGGGAAGAAGG - Exonic
954445785 3:50546126-50546148 CTCCCAGAGGTGAGTCAAGCAGG - Intergenic
956301274 3:67775163-67775185 CTCTTAGTGGAGAGGGGAGCTGG + Intergenic
957227747 3:77471763-77471785 CTCATAGAGGAGAGGAAAGTGGG + Intronic
958540533 3:95465071-95465093 CTCTCAGTGGAGAGGGCACATGG + Intergenic
958973408 3:100638301-100638323 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
959693533 3:109224719-109224741 CTCTCAGCAGAGAGGGGAGCCGG + Intergenic
960240062 3:115330507-115330529 CTCCCAGAGCAGAGCTAAGCAGG - Intergenic
960420949 3:117444626-117444648 CTCTCAGTGGGATGGGAAGCTGG + Intergenic
960487975 3:118276514-118276536 TTATGAGAGGGGAGGGAAGCAGG + Intergenic
961598917 3:128043505-128043527 CTCTCAGCAGAGAAGGGAGCTGG + Intergenic
961629306 3:128284601-128284623 CTCTCAGGGGAAAGGCAAGTGGG - Intronic
962100269 3:132334607-132334629 ACCTCAGAGGAGAGGGAGGAAGG + Intronic
962334735 3:134517010-134517032 CTCTCTGAGGAATGGGAAGTTGG - Intronic
962408916 3:135124256-135124278 CTCTCAGAGCAGAGGCCATCTGG - Intronic
962474359 3:135742373-135742395 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
963015411 3:140819938-140819960 CTCAGGGAGGAGAGAGAAGCAGG + Intergenic
963248172 3:143082126-143082148 GTCTCACAGGAGAGGGAAGAAGG - Intergenic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
964307540 3:155357135-155357157 GTCTCAGTGGAGAGGGGAGCTGG + Intergenic
964920542 3:161890759-161890781 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965039702 3:163490574-163490596 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965123643 3:164595671-164595693 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965216296 3:165868574-165868596 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
965679544 3:171235975-171235997 CACCCAGAGGAGAGAGAAGTGGG - Intronic
965811223 3:172593096-172593118 CTCTCAGAGGAAGGGGTAGGCGG - Intergenic
965890893 3:173512365-173512387 CTCTCAGTAGAGAGGGGAGCTGG + Intronic
966434751 3:179870654-179870676 TTCATAGAGGAGAGGGAAGTAGG - Intronic
966448076 3:180025934-180025956 CTGTCACAGGTGAGGAAAGCGGG + Intronic
966875731 3:184320593-184320615 CTATAAGATGAGTGGGAAGCAGG - Intronic
966879393 3:184341452-184341474 CACCCAGAGGAGATGGAGGCAGG - Intronic
967065460 3:185911318-185911340 TTCTCAGGGGAGAGGGGACCAGG - Intergenic
967074736 3:185991800-185991822 TTCTCAGGGGAGAGGGGATCAGG - Intergenic
967551011 3:190796193-190796215 CCCTCAGTGGAGAGGTATGCAGG - Intergenic
968838299 4:2981463-2981485 CCCTCAGAGGAGAGGAGACCTGG + Intronic
969202361 4:5616192-5616214 TTCTCAGGGGAGAGGGAAGGTGG - Intronic
969594816 4:8142989-8143011 CCTGCAGAGGGGAGGGAAGCTGG - Intronic
970195026 4:13544233-13544255 CTCTTTGGGGAGAGGGACGCGGG - Exonic
971959824 4:33471348-33471370 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
972425251 4:38926882-38926904 TTCTCAGAGGGGTGTGAAGCAGG - Intronic
972472722 4:39422460-39422482 CACTTAGAGGAGAGGAAACCAGG - Intronic
973022450 4:45220397-45220419 TTCTCAGAGGAGACGGGAGCTGG + Intergenic
973136157 4:46709160-46709182 CTCTCAGTGGGGAGGTGAGCTGG - Intergenic
973651746 4:53003695-53003717 CTCCCAGAGGAGACAGAAACAGG + Intronic
974574553 4:63701372-63701394 CTCTCAGTGTAGAGTGGAGCGGG + Intergenic
975830391 4:78362748-78362770 TTCTCAGAAGAGAGTGGAGCTGG + Intronic
976658089 4:87510603-87510625 CTCTCAGTGGAGAGGTGAGCTGG - Intronic
976883598 4:89960472-89960494 CTCTCAGAGGAAGGGTGAGCTGG + Intergenic
977220475 4:94332210-94332232 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
977797985 4:101191695-101191717 CACTCTGAGGAGAGTTAAGCAGG - Intronic
978619987 4:110628469-110628491 CTCTCAGAGGAGAAAAAGGCAGG - Intronic
979188117 4:117824318-117824340 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
979346701 4:119595597-119595619 GTCTCAGAGGAGGGAGAAGATGG - Intronic
979661374 4:123259435-123259457 CTCTGAGGGGAGACTGAAGCAGG + Intronic
979942534 4:126779777-126779799 CTCTCAACGGAAAGGGAGGCTGG - Intergenic
980627489 4:135391922-135391944 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
980680645 4:136155403-136155425 CTCTCAGCTGAGAGGGGAGCTGG + Intergenic
980688619 4:136261773-136261795 CACTCAGATGAGAAGGAATCAGG + Intergenic
980985726 4:139692436-139692458 CTCACAGAGGACTGGGGAGCAGG - Intronic
983120982 4:163884459-163884481 CTCTCAGAGGTAAGAGAGGCTGG - Intronic
983154695 4:164332250-164332272 ATGTCAGAGGAGAAGAAAGCTGG - Intronic
983172528 4:164552101-164552123 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
983697868 4:170554623-170554645 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
983923566 4:173371767-173371789 GTCGCAGAGGAGAAGGAAGAGGG - Intronic
984245939 4:177275344-177275366 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
984300568 4:177912108-177912130 CTCTCAGCGGGAAGGGGAGCTGG + Intronic
984417220 4:179477214-179477236 CTCTCAGTGGGGTGGGGAGCTGG - Intergenic
985063981 4:186104460-186104482 CTCTCTGACGATAGGGAAGGTGG - Intronic
985705536 5:1399589-1399611 CTCTCAGAGGAGAGAGGCTCTGG + Intronic
985867911 5:2529749-2529771 CTCCGAGAGGAGCTGGAAGCTGG - Intergenic
986076192 5:4340428-4340450 CTCTCAGTGGAGAGGGGAGTTGG + Intergenic
986164749 5:5263963-5263985 CTCTCAGCAGAGAGGGTAGCTGG + Intronic
986190467 5:5492219-5492241 CTTTCAGTGCAGAGGTAAGCAGG + Intergenic
986350247 5:6871078-6871100 CTCTGTGAGGAGATGGATGCAGG - Intergenic
986594661 5:9408917-9408939 CTCTCAGAGGAGAGGGAGGCTGG - Intronic
987059225 5:14226104-14226126 CTCACACAGGAGAGGCAAGGAGG + Intronic
987224105 5:15821778-15821800 CTCTCAAAGGAGAAAGCAGCAGG + Intronic
987433335 5:17863327-17863349 CTCTCAGTGGAGAAGGCTGCTGG - Intergenic
987486445 5:18532976-18532998 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
988361329 5:30239864-30239886 CTCTCAGTGGAGAGGGGACATGG - Intergenic
988431442 5:31123550-31123572 CTCTCAGAGGGAAGGAAAGGAGG + Intergenic
988603586 5:32661651-32661673 CTGTCAGTGGAGAGGGGAGCTGG + Intergenic
989161281 5:38393962-38393984 CTCTCAGCGGAAAGGGAGGCTGG + Intronic
989549926 5:42722568-42722590 CTCACAGGGCAGAGGGCAGCAGG - Intergenic
990502204 5:56407833-56407855 CTCTGAAAGGAGAGGGTTGCAGG + Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
992847829 5:80771565-80771587 CTCTGAGAAGTGAGGGAGGCAGG + Intronic
993405036 5:87500500-87500522 CTCTAAGACTAGTGGGAAGCTGG - Intergenic
994434024 5:99706039-99706061 TTCTCAGCAGAGAGGGAAGCTGG - Intergenic
994775270 5:104031319-104031341 CTCTCGGTGGGAAGGGAAGCTGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
996294088 5:121890831-121890853 CTCTCAGTAGAGAGGGGACCTGG + Intergenic
996557886 5:124797666-124797688 CTCTCAGTGGAAAGGGGAGCTGG - Intergenic
996644267 5:125795512-125795534 CTCTCAGTGGAGAGGCAAAATGG - Intergenic
997419898 5:133757658-133757680 CTCTCAGAGGAGTGAGTAGAAGG + Intergenic
997423385 5:133786609-133786631 CACCCAGGGGAGAGGGATGCAGG + Intergenic
998008248 5:138671946-138671968 CACTCAGAGAAGAAGGAACCTGG - Intronic
998463251 5:142324575-142324597 GTCTCAGAGGGCGGGGAAGCCGG + Intronic
998903287 5:146878142-146878164 GTCTCACAGGAGAGGGGGGCAGG + Exonic
999856166 5:155596673-155596695 CTCCCAGAAGACAGGGAAGCAGG - Intergenic
999924553 5:156360776-156360798 CTCTCAGTAGAAAGGGGAGCTGG - Intronic
1000230661 5:159312288-159312310 CTCACAGAGGTCAGCGAAGCAGG + Intergenic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1001041550 5:168339268-168339290 CTCTAAGAGCAGAGGGATGAGGG + Intronic
1001380617 5:171304255-171304277 AGGTTAGAGGAGAGGGAAGCAGG - Intergenic
1001545426 5:172567995-172568017 CTCTCTGAGGAGATGCAAGCTGG + Intergenic
1001973732 5:175979340-175979362 CTCTCAGCGGAGAGGGGAGTTGG - Intronic
1002211461 5:177601923-177601945 TCCTCATAGGAGAGGGGAGCAGG + Intronic
1002243700 5:177864439-177864461 CTCTCAGCGGAGAGGGGAGTTGG + Intergenic
1002591378 5:180293149-180293171 CTCTGAGAGGAGTGGGGGGCGGG + Intergenic
1002602772 5:180363428-180363450 TCCCCAGTGGAGAGGGAAGCAGG - Intergenic
1002999747 6:2319815-2319837 CTCTCAGAGGAGAGGGGAGCTGG + Intergenic
1004481654 6:16025421-16025443 CTCTCATAGGAGAGGGGAAGTGG - Intergenic
1005026433 6:21466934-21466956 CCCTCAGCAGAGAGGGGAGCTGG - Intergenic
1006409582 6:33864797-33864819 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
1008909267 6:56715893-56715915 TTCACAGGGGAGAGGGAAGGGGG - Intronic
1009524670 6:64728880-64728902 CTCTCTGTGGGGAGGGGAGCTGG + Intronic
1009537590 6:64908611-64908633 GTCTCAGAGGAGAGGGGAGCTGG + Intronic
1010070592 6:71739736-71739758 AACATAGAGGAGAGGGAAGCCGG + Intergenic
1010194239 6:73223976-73223998 CTCAGGGAGGAGAGGGTAGCAGG - Intronic
1010294723 6:74182722-74182744 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1010494218 6:76513807-76513829 CTCTCAGGGGAATGGGGAGCTGG + Intergenic
1010556156 6:77281947-77281969 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1011626076 6:89285006-89285028 TTCACAGAGGAGAGGGATACGGG - Intronic
1011899531 6:92275085-92275107 CTCTCAGCAGGAAGGGAAGCTGG + Intergenic
1012749500 6:103140101-103140123 CTCTCAGTGGAGAGGAAACCTGG + Intergenic
1013670717 6:112399613-112399635 CTCTCAGTGGAGAGGGCATCTGG + Intergenic
1013950236 6:115771326-115771348 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1014107407 6:117582673-117582695 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1014190967 6:118496275-118496297 CTCTGTGAGGAGATGGACGCAGG + Intronic
1014547107 6:122746851-122746873 CTCTGAAAGGAGAGGGAAAGGGG - Intergenic
1014740507 6:125143440-125143462 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
1015669414 6:135671985-135672007 CCCACAGAGGAGAGTGAAGATGG + Intergenic
1015919265 6:138250401-138250423 TTCTAGGAGGAGAGAGAAGCAGG - Intronic
1016039466 6:139417376-139417398 CTCTTGGAGAAGAGGGAAGAGGG + Intergenic
1016082992 6:139878380-139878402 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1016191734 6:141276826-141276848 CTCACAGAGGGGAGGGAAGATGG - Intergenic
1016205773 6:141466743-141466765 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1016206482 6:141473473-141473495 CTCTCAGTGGAGAGGGCAGCTGG + Intergenic
1016367222 6:143332536-143332558 AGATCAGAGGAGTGGGAAGCTGG + Intronic
1016902148 6:149113505-149113527 CTCTCAGTGGGATGGGAAGCTGG - Intergenic
1017130500 6:151104502-151104524 CTCTCAGATGGGAGGGAACTAGG - Intergenic
1017375383 6:153762081-153762103 ATCACAGAGGAAGGGGAAGCAGG + Intergenic
1017584858 6:155909405-155909427 CTGTCAGAGGGAAGGGTAGCTGG - Intergenic
1018650137 6:165986271-165986293 CTCGGAGAGGAGAGTGAAGGTGG + Intronic
1018654772 6:166024757-166024779 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1018902842 6:168059960-168059982 CTTTCTGATGGGAGGGAAGCTGG + Intronic
1019061666 6:169261866-169261888 ATCTCAGGGAAGAGGGAGGCCGG - Intergenic
1019104251 6:169656044-169656066 CTCTCAGCAGAGAGGGGACCCGG + Intronic
1019936430 7:4261268-4261290 CTCTCAGATGAGGGAGCAGCTGG + Intronic
1020138596 7:5599861-5599883 CACCCACAGGAGAGGGAGGCTGG - Intronic
1020564559 7:9778869-9778891 CTCTCAGCGAAGAGGGTAGCTGG + Intergenic
1021034018 7:15774600-15774622 CTCTCAGTGGAGAGAAAAGCTGG - Intergenic
1021115734 7:16744698-16744720 CTCTCAGTGGAGAGGGGAAGTGG + Intergenic
1021376944 7:19920196-19920218 ATCCCAGAGCTGAGGGAAGCTGG + Intergenic
1021386380 7:20035768-20035790 CTCTCAGCTGAGAGGAAAGTTGG + Intergenic
1021420362 7:20439864-20439886 CTCTCAGTGGAAAGAGAGGCTGG - Intergenic
1022321346 7:29290899-29290921 CACTCAGAGGAGAGCCAAGCAGG + Intronic
1023350889 7:39319302-39319324 CTTTCAGAGGAAAAGAAAGCAGG + Intronic
1023500491 7:40844387-40844409 CTCTCAGTGGGAAGGGGAGCTGG + Intronic
1024365007 7:48510344-48510366 CTCTAAGAGAAGAAGGAACCAGG + Intronic
1024652539 7:51417898-51417920 CTCTCAGTGGTGAGGGAGACAGG + Intergenic
1024768923 7:52695015-52695037 CTCCCAGAGGTGAAGAAAGCAGG + Intergenic
1025015117 7:55433151-55433173 CTCTCAGACGAGGAGGCAGCGGG + Exonic
1025037720 7:55608543-55608565 CTCTCAGTGGTGAGGGAGACAGG + Intergenic
1025062580 7:55823372-55823394 CTCTCAGTGGAGAGGGGACCTGG - Intronic
1025618224 7:63142986-63143008 CTTTCAGTGGAGAGGGGACCTGG - Intergenic
1026060077 7:67018081-67018103 GGCTCAGAGGAGAGGGAGGAAGG + Exonic
1026462862 7:70630212-70630234 TCCTCAGAGGAGCGGAAAGCTGG + Intronic
1026718041 7:72807106-72807128 GGCTCAGAGGAGAGGGAGGAAGG - Exonic
1026918708 7:74139429-74139451 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1027242187 7:76338371-76338393 CTCACAGATGAGAGGAGAGCTGG + Intronic
1028020781 7:85768444-85768466 CTCTCAGCGGAGAGGGCATGTGG - Intergenic
1029941554 7:104485767-104485789 CTGTCAGAGGGGTGGGAGGCTGG - Intronic
1030787864 7:113684694-113684716 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1032078384 7:128846738-128846760 CTCTCAGGGGAGCGGGCACCGGG + Exonic
1032538767 7:132686103-132686125 CTCTCAGTGGAGAGGGGATGCGG - Intronic
1032634697 7:133693782-133693804 CTGTAAGAGGAAGGGGAAGCAGG + Intronic
1033380423 7:140811432-140811454 CTCTCAGGGGAGAGGGGAGTAGG + Intronic
1033627892 7:143128711-143128733 CTCTCAGAGGTGAGAGAAGCTGG - Intergenic
1034998089 7:155591053-155591075 CTCTCAGCAGAAAGGGAGGCTGG + Intergenic
1035232074 7:157471279-157471301 ACCTCAGACCAGAGGGAAGCCGG + Intergenic
1035259348 7:157651896-157651918 CACTCAGAGGAGGGAGAGGCAGG - Intronic
1035694241 8:1582883-1582905 CTCTGAAAGAAGAGGGCAGCAGG + Intronic
1036591734 8:10174520-10174542 CTCACAGAGGGGAGGTGAGCTGG - Intronic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1037056274 8:14445550-14445572 TTTTCAGTGGAGAGGGCAGCTGG - Intronic
1037062655 8:14534239-14534261 GGCACAGAGAAGAGGGAAGCAGG + Intronic
1037286997 8:17311928-17311950 AACTCAGAGGGGAGGGAAGAGGG - Intronic
1037473006 8:19229115-19229137 CTCTCAGCAGAGAGGGGAACTGG + Intergenic
1037533429 8:19802292-19802314 CTCTCAGTAGAGAAGGGAGCTGG - Intergenic
1037594496 8:20343532-20343554 CTGTCAGTGGAGGGGGGAGCTGG + Intergenic
1037670664 8:21012687-21012709 ATGTCACAGAAGAGGGAAGCAGG - Intergenic
1038215975 8:25562074-25562096 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1038229998 8:25690945-25690967 CTCACAGAGGAGAGGGATGATGG - Intergenic
1038286008 8:26207026-26207048 CTGTCAGTAGAGAGGGGAGCTGG - Intergenic
1038520353 8:28226985-28227007 CTCTCAGCAGAGAGGGAATGTGG - Intergenic
1038821064 8:30952240-30952262 CTTTCAGAGGAAACAGAAGCAGG + Intergenic
1038935413 8:32244518-32244540 GTCTCAAAAGAAAGGGAAGCAGG + Intronic
1039076388 8:33693829-33693851 CTCTTAATGGAGAGGGGAGCTGG - Intergenic
1039370727 8:36981579-36981601 CTGTCAGAGGAGAGGACAGGAGG - Intergenic
1039476964 8:37844078-37844100 CCCTCAGAGGAGCGGGAACTGGG - Exonic
1039661369 8:39470844-39470866 CTCTCAGTGGAAAGGGGAGCTGG - Intergenic
1040592233 8:48804329-48804351 CCTTCAGAGGAGAGGGAGGGTGG + Intergenic
1040663690 8:49604914-49604936 CTCTCAGTGGAGAAGAGAGCTGG - Intergenic
1040879949 8:52193547-52193569 CTGTCAGATGTGAGGGAAGCGGG - Intronic
1041131957 8:54710653-54710675 CTGTCAGCGGAGAGGGGAGCTGG + Intergenic
1042054894 8:64754201-64754223 TTCTCAGAGGAATGGGAAGTCGG + Intronic
1042238700 8:66640791-66640813 CTCTCAGTGGGGTGGGGAGCTGG - Intronic
1042839313 8:73107852-73107874 CCCTTAGAGGAGAGGAAAGTTGG - Intronic
1043438961 8:80260214-80260236 CTTTCAGTGAAGAGGGGAGCTGG + Intergenic
1043439004 8:80260441-80260463 TTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1043687558 8:83106880-83106902 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1043951281 8:86311702-86311724 CTCTCAGTGGACAGGGGAGTTGG - Intronic
1044343455 8:91074209-91074231 CTCTCATAGGAGAGCGAAGCTGG + Intronic
1044631023 8:94278697-94278719 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1045099371 8:98829002-98829024 CTCTCAGAGCAGAGAGCAGATGG - Intronic
1045300696 8:100907966-100907988 CTCTCAGGGGAGAGGAGACCCGG + Intergenic
1045803007 8:106123327-106123349 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1046910489 8:119621022-119621044 ATGTCGGAGGAAAGGGAAGCAGG - Intronic
1047431702 8:124798713-124798735 CTTCCAGAGAAGAGGGAACCTGG - Intergenic
1048343221 8:133556420-133556442 CTTTCAGAGGAGTGAGATGCTGG + Intronic
1048616080 8:136076876-136076898 ATCTCAGTGGAGAGGGGAGGTGG + Intergenic
1048800412 8:138189279-138189301 CTCTCAGTGGGAAGGGGAGCTGG - Intronic
1048948832 8:139476023-139476045 CCCTCAGAGGAAAGAGAAGGGGG + Intergenic
1049252356 8:141596150-141596172 CTCTCTAAGTAGAAGGAAGCAGG + Intergenic
1049266809 8:141671936-141671958 CCCTCCCAGGAGAGGGAGGCAGG - Intergenic
1049294816 8:141826850-141826872 CTCGGAGATGAGAGGGAAGGGGG + Intergenic
1049446208 8:142632688-142632710 CACTCAGAGAAGAGGGATCCTGG - Intergenic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049730296 8:144173939-144173961 CTCTTGGGGGAGAGGGGAGCTGG + Intronic
1049938994 9:526688-526710 TCCTCTGAGGAGAGGGAATCAGG - Intronic
1050792831 9:9495644-9495666 CTCTCAGCAGAGAGGGGAGTCGG - Intronic
1050939709 9:11443343-11443365 CTGTCAGCAGAGAGGGGAGCTGG - Intergenic
1051147679 9:14045873-14045895 TTCTCCAAGGAGGGGGAAGCTGG + Intergenic
1051505059 9:17817872-17817894 CTCTCAGAGTCCATGGAAGCTGG - Intergenic
1051530208 9:18093916-18093938 CTCTAAGAGGAGAGGAAAAGAGG + Intergenic
1051996126 9:23219941-23219963 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1052216432 9:25972115-25972137 CTCTCAGTGGATAGGGGAGCTGG - Intergenic
1052609839 9:30758549-30758571 CTCTCAGAGGAGAGGAGACCTGG + Intergenic
1052909530 9:33868070-33868092 CTCTCAGCGGAAAGGGAGGCTGG + Intronic
1052998869 9:34566306-34566328 CTGTCAGAGAAGAAGGAAGCAGG + Intronic
1053160088 9:35808108-35808130 CTGTCAGAGAGGAGGAAAGCAGG - Exonic
1053467125 9:38316701-38316723 CTGTCAGAGGATAAGGAGGCAGG + Intergenic
1053520115 9:38769025-38769047 AACTCAGAGGAGAGGTAAGGGGG - Intergenic
1055135497 9:72824492-72824514 CTCTCAGCAGAGAGGGCAGTTGG + Intronic
1055649357 9:78392261-78392283 TTCACAGGGGAGAGGGAAGTAGG - Intergenic
1056059560 9:82870235-82870257 CTCTTAGTGGAGAGGGGAGCTGG - Intergenic
1056429830 9:86516371-86516393 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1056552390 9:87663078-87663100 GACTCAGCGGAGAGGGAAGGTGG - Intronic
1056604933 9:88077823-88077845 CTCTCATGGGAGAGGGGAGAGGG + Intergenic
1056827359 9:89885545-89885567 ATCTCAGAGAAAAAGGAAGCAGG - Intergenic
1057115243 9:92514751-92514773 CTCTGGGAGGAGCAGGAAGCGGG + Exonic
1057542793 9:95990927-95990949 CTCTCAGCAGAAAGGGAGGCTGG + Intronic
1060931429 9:127491772-127491794 CACACAGATGAGAGGGCAGCAGG + Intronic
1061663749 9:132148253-132148275 TTCTCAGAGGAGGGAGCAGCAGG + Intergenic
1061670428 9:132185298-132185320 CTCTCAGAGAAGAGGAGAGGGGG + Intronic
1062447277 9:136600229-136600251 CTCTCAGAGCAGACAGAGGCTGG - Intergenic
1185542643 X:915804-915826 GTTTCTGAGAAGAGGGAAGCAGG - Intergenic
1185610656 X:1392227-1392249 CCCTCAGAGGCGAGGCACGCAGG - Exonic
1185756275 X:2655490-2655512 CTCCCAGAGGAGGGGGAGACTGG + Intergenic
1185765151 X:2719399-2719421 CTCTCAGAGGAGAGGCAGTGGGG - Intronic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1187283899 X:17884456-17884478 CTCTCAGAGCAGAGCTGAGCTGG - Intergenic
1187384304 X:18833349-18833371 CTCTCAGCAGAAAGGGAGGCTGG - Intergenic
1187775416 X:22751197-22751219 CTCTCAGTGGAAAGTGAAGAGGG + Intergenic
1188180599 X:27050658-27050680 CTCTCAGCAGACAGGGAAGCTGG - Intergenic
1188495491 X:30779429-30779451 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188911304 X:35851269-35851291 CTCACAGAAGAGAGGGAAGTGGG + Intergenic
1190705606 X:53024239-53024261 CTCTCAGTAGAGCGGGGAGCGGG - Intergenic
1193111119 X:77731809-77731831 GGCTCAGTGGAGAGGGGAGCTGG - Intronic
1193532643 X:82674799-82674821 CTCTCAGTGGGAAGGGAAACTGG + Intergenic
1195106125 X:101603049-101603071 CTCTCAAAGAGGAGGGAAGGAGG + Intergenic
1195551849 X:106180442-106180464 CTCTCAAAGGAGTAGGAAGATGG - Intronic
1195858768 X:109358491-109358513 CTCTCAGTGGGAAGGGGAGCTGG - Intergenic
1195920460 X:109978297-109978319 CTCTCTGAGGAGAGGGCATCTGG + Intergenic
1196845925 X:119896606-119896628 CTCCAACAGGAGAGGGAAGATGG - Intronic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1198336213 X:135669150-135669172 CTTTCAGGGGAGAAGGCAGCTGG - Intergenic
1198363418 X:135917498-135917520 CTCGCAGCAGAGAGGGGAGCTGG + Intergenic
1198454580 X:136803862-136803884 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1199728312 X:150606614-150606636 CTCTCAGATGCGAGGGAAGGAGG - Intronic
1199777808 X:151030966-151030988 CTCTCTGAGGAGGAGGAAGTGGG + Intergenic
1199834812 X:151578727-151578749 CACTCAGAGGAGAGGGAGAGGGG - Intronic
1200104406 X:153704316-153704338 CTCTCAGAGGGGCTGGAAGCAGG + Intronic
1200876552 Y:8161767-8161789 CTCTGAGAGTAGAGAGCAGCTGG - Intergenic
1201192779 Y:11461854-11461876 CTGTCAGCGGAGTGGGAGGCTGG - Intergenic
1201219194 Y:11750251-11750273 CACTGAAAGGAAAGGGAAGCTGG + Intergenic
1201508734 Y:14734102-14734124 CTCTCAGGGGGAAGGGAAGCTGG + Intronic