ID: 1146549781

View in Genome Browser
Species Human (GRCh38)
Location 17:33770303-33770325
Sequence GAAGACACTAGGGGTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 434}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146549781_1146549789 11 Left 1146549781 17:33770303-33770325 CCTCCCTGACCCCTAGTGTCTTC 0: 1
1: 0
2: 4
3: 41
4: 434
Right 1146549789 17:33770337-33770359 GAAAGCTGGCCTCATACAGTTGG 0: 1
1: 0
2: 3
3: 11
4: 144
1146549781_1146549787 -3 Left 1146549781 17:33770303-33770325 CCTCCCTGACCCCTAGTGTCTTC 0: 1
1: 0
2: 4
3: 41
4: 434
Right 1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1146549781_1146549792 30 Left 1146549781 17:33770303-33770325 CCTCCCTGACCCCTAGTGTCTTC 0: 1
1: 0
2: 4
3: 41
4: 434
Right 1146549792 17:33770356-33770378 TTGGTGTAAACATTTAATGGAGG 0: 1
1: 0
2: 0
3: 16
4: 184
1146549781_1146549791 27 Left 1146549781 17:33770303-33770325 CCTCCCTGACCCCTAGTGTCTTC 0: 1
1: 0
2: 4
3: 41
4: 434
Right 1146549791 17:33770353-33770375 CAGTTGGTGTAAACATTTAATGG 0: 1
1: 0
2: 2
3: 38
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146549781 Original CRISPR GAAGACACTAGGGGTCAGGG AGG (reversed) Intronic