ID: 1146549787

View in Genome Browser
Species Human (GRCh38)
Location 17:33770323-33770345
Sequence TTCCTCTGTAAAGCGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146549782_1146549787 -6 Left 1146549782 17:33770306-33770328 CCCTGACCCCTAGTGTCTTCCTC 0: 1
1: 0
2: 0
3: 23
4: 254
Right 1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1146549783_1146549787 -7 Left 1146549783 17:33770307-33770329 CCTGACCCCTAGTGTCTTCCTCT 0: 1
1: 0
2: 1
3: 27
4: 291
Right 1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 120
1146549781_1146549787 -3 Left 1146549781 17:33770303-33770325 CCTCCCTGACCCCTAGTGTCTTC 0: 1
1: 0
2: 4
3: 41
4: 434
Right 1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146549787 Original CRISPR TTCCTCTGTAAAGCGAAAGC TGG Intronic