ID: 1146552360

View in Genome Browser
Species Human (GRCh38)
Location 17:33792307-33792329
Sequence CTCTGGACAATGACCAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146552356_1146552360 6 Left 1146552356 17:33792278-33792300 CCTGCTACTTCCAAGGGCTGGGA 0: 1
1: 0
2: 0
3: 25
4: 423
Right 1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 169
1146552357_1146552360 -4 Left 1146552357 17:33792288-33792310 CCAAGGGCTGGGAACATGTCTCT 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 169
1146552350_1146552360 22 Left 1146552350 17:33792262-33792284 CCACTGTTCAGTGCCACCTGCTA 0: 1
1: 0
2: 0
3: 20
4: 174
Right 1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 169
1146552353_1146552360 9 Left 1146552353 17:33792275-33792297 CCACCTGCTACTTCCAAGGGCTG 0: 1
1: 0
2: 1
3: 28
4: 233
Right 1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 169
1146552349_1146552360 29 Left 1146552349 17:33792255-33792277 CCATTCTCCACTGTTCAGTGCCA 0: 1
1: 0
2: 4
3: 19
4: 255
Right 1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146552360 Original CRISPR CTCTGGACAATGACCAGGCA AGG Intronic
900913643 1:5619570-5619592 CTCTGAACACAGCCCAGGCAGGG + Intergenic
901379500 1:8863465-8863487 CTCTTGACAAAGCCCAGGCATGG - Intronic
902906554 1:19562524-19562546 CTATGGACAAGAACCAGGCCGGG - Intergenic
903249681 1:22043616-22043638 GTCTGGGCCATGACCAGCCAGGG + Intergenic
904589604 1:31604193-31604215 CTCTAAAAAATGATCAGGCAGGG - Intergenic
904793201 1:33039204-33039226 CTATGCACAGGGACCAGGCAAGG + Intronic
905104752 1:35557700-35557722 CTCTGGCCAATGGCAAGTCAGGG - Intronic
907916016 1:58870687-58870709 CTCTGCACATTGCCCAGCCAGGG + Intergenic
908272867 1:62437384-62437406 CTTTGGGCCATGACCAGGTAAGG + Exonic
912934157 1:113988164-113988186 CTCTGGCAAGTGACCAGGCTGGG - Intergenic
918136181 1:181675830-181675852 CTCTGGACAATGCGCAGCTAAGG + Intronic
918519370 1:185398441-185398463 CTCTGGAAAATGATAAGGCCTGG + Intergenic
920855607 1:209658863-209658885 CACTGGGCAATGAGCAGGCTTGG + Intergenic
1071917619 10:90313106-90313128 CTCTTGACATTGAGCAGGGAGGG - Intergenic
1076257464 10:129039502-129039524 CTCTCTACAATGACTAGGGAAGG + Intergenic
1076544425 10:131235307-131235329 CTCTAGAAAATGAACATGCAGGG + Intronic
1077071618 11:676499-676521 CCGTGGACAATGACCAGGGGAGG + Intronic
1079314380 11:19395435-19395457 CTGTGGAGAATGGCCAGACATGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1083670038 11:64294687-64294709 CTCTCCACAAAGAACAGGCAGGG - Intronic
1087515731 11:99158058-99158080 ATCTAGACAGTGACTAGGCACGG + Intronic
1094316924 12:29145545-29145567 CTCTGTCCAATGGCCAGGCAGGG - Intergenic
1096218060 12:49809307-49809329 CCCTGAACAGAGACCAGGCATGG + Intronic
1098589243 12:72190327-72190349 CACTGCCCAATTACCAGGCAGGG - Intronic
1101098936 12:101372282-101372304 CTTTGGACACAGACTAGGCATGG + Intronic
1101851973 12:108410588-108410610 GGCTGGACAATGACTTGGCAGGG - Intergenic
1104640650 12:130464842-130464864 CTCTGAACAAGAGCCAGGCAGGG + Intronic
1109133492 13:58618319-58618341 CCCAGGACAATGAGGAGGCAAGG - Intergenic
1110113527 13:71781666-71781688 ATCTGGACCTTGGCCAGGCATGG - Intronic
1110696358 13:78495762-78495784 ATCTAGACAGGGACCAGGCAGGG + Intergenic
1111714553 13:91863649-91863671 CTCTGGATAATGAGGATGCATGG - Intronic
1111743054 13:92228805-92228827 CACTGGAAAATAACCAAGCATGG + Intronic
1113870866 13:113559256-113559278 CTCTGGTCACTGACCACGCCGGG - Intergenic
1114053323 14:18942454-18942476 CTCTGGACAATAACCAAGGTGGG - Intergenic
1114109236 14:19459472-19459494 CTCTGGACAATAACCAAGGTGGG + Intergenic
1119085035 14:71731713-71731735 GTCTGGACAATGACCACGTGTGG - Intronic
1119373428 14:74167554-74167576 TTCTGGACATAGGCCAGGCATGG - Intronic
1122355238 14:101119340-101119362 CCCTAGACAAAGACCAGGCCCGG + Intergenic
1122974843 14:105166872-105166894 CCCAGCACAATGACCAAGCAGGG + Intronic
1123795944 15:23770014-23770036 ACCTAGACAATGGCCAGGCATGG - Intergenic
1123900122 15:24868342-24868364 CTCTGGACAACAGCCAGCCAAGG - Intronic
1125549356 15:40533631-40533653 TGCAGGACAATGGCCAGGCATGG - Intronic
1125756011 15:42065501-42065523 CTCTGGAGAGTGAGCCGGCATGG - Intergenic
1128090027 15:64912943-64912965 TTCTGGACAAAGACCCAGCATGG + Intronic
1128608129 15:69053714-69053736 CTGTGGAGGATGACCTGGCATGG - Intronic
1128818433 15:70630797-70630819 CTTTGCACAAGGCCCAGGCAGGG + Intergenic
1129866727 15:78914603-78914625 CTCAGGAACATGGCCAGGCAGGG - Intergenic
1130743391 15:86625116-86625138 ATTTGGAGAAGGACCAGGCAGGG + Intronic
1131030595 15:89183148-89183170 ATCTGGACACTGACTAGACATGG - Intronic
1131623262 15:94089766-94089788 CCCTGGTCAATGACCCAGCAAGG - Intergenic
1135142790 16:19935973-19935995 TGCTGGACAGTGACCAGGAAAGG - Intergenic
1135529438 16:23240053-23240075 GTCTGCACAATGACCAGCCCTGG + Intergenic
1137509501 16:49086506-49086528 CTCTGGACATAGACCAGCAAAGG + Intergenic
1137556142 16:49471615-49471637 CTTTGGAGAAGGACGAGGCAGGG - Intergenic
1141464296 16:84196177-84196199 CCCAGGACACTGTCCAGGCAGGG - Exonic
1141806273 16:86343752-86343774 CTCTGGGCAATTAGCAGACAGGG + Intergenic
1143256610 17:5562275-5562297 GTTTGGACAATGCCCAAGCAGGG + Intronic
1143390854 17:6558381-6558403 GCCTGGACAATGTCCAGGCTTGG + Intergenic
1146552360 17:33792307-33792329 CTCTGGACAATGACCAGGCAAGG + Intronic
1149261104 17:54880552-54880574 TTCTCTACAATGACCATGCAAGG - Intergenic
1149638020 17:58185720-58185742 GGCTGGATACTGACCAGGCAGGG + Intergenic
1152610717 17:81313920-81313942 CTGTGAACAAAGACCAGGTAAGG + Exonic
1152662913 17:81551258-81551280 CTCTTCACAATAACCTGGCATGG + Intronic
1157487584 18:48099629-48099651 CTCCTGACAATGAACTGGCAGGG + Intronic
1157615817 18:48987155-48987177 GTCTGGACAATGAATAGGAAGGG + Intergenic
1164228179 19:23264527-23264549 CTGTGGGCATGGACCAGGCAGGG + Intergenic
1164232952 19:23307234-23307256 TTGTGGACAGGGACCAGGCAGGG - Intronic
1166326739 19:42055634-42055656 CTATGGAAAAAGACAAGGCAGGG + Intronic
1168067758 19:53928707-53928729 CTGTGGACAATGAGGAGCCAAGG + Intronic
1168213625 19:54909477-54909499 CACTGGGGAAAGACCAGGCATGG - Exonic
1202692353 1_KI270712v1_random:101050-101072 CACTGGGCCATGACAAGGCAAGG + Intergenic
925103153 2:1266593-1266615 CTCAGGACAATGAACCCGCAAGG + Intronic
925639179 2:5971165-5971187 CTCTTGACAGTGCCCAGGAAGGG - Intergenic
926487365 2:13478463-13478485 CTCTAGAGAATTACCAGGCTTGG - Intergenic
927502328 2:23591122-23591144 CTCTGAGCAAAGACCTGGCAAGG + Intronic
928205091 2:29278285-29278307 CTCTGAACAGAGATCAGGCAAGG + Intronic
935107941 2:100062948-100062970 CTATCAAAAATGACCAGGCAGGG + Intronic
935930307 2:108117043-108117065 CTCTGAACAAGGAACAGGCTAGG + Intergenic
936325361 2:111500200-111500222 GACAGGACATTGACCAGGCACGG + Intergenic
937296579 2:120813129-120813151 ATATGGACAATGTCCTGGCAGGG + Intronic
938663815 2:133513325-133513347 CTGTGGTCCATGACCAAGCAGGG + Intronic
947629126 2:231640551-231640573 ATTTGGACAGTGTCCAGGCAAGG - Intergenic
948237108 2:236399641-236399663 CTGTGTCCACTGACCAGGCATGG + Intronic
948510673 2:238462216-238462238 CTCTGGAGGAGGTCCAGGCATGG - Intergenic
948602395 2:239114931-239114953 CACTGGACAGTGACCGCGCAAGG + Intronic
1169136314 20:3199955-3199977 CTCTGACCCTTGACCAGGCAAGG - Intronic
1169884031 20:10377852-10377874 CTTTGGACAATTACCTGTCACGG + Intergenic
1170307975 20:14960451-14960473 CTGTGGAAGCTGACCAGGCAAGG - Intronic
1170339426 20:15306886-15306908 CTCTGCAGAATGTCCAAGCATGG + Intronic
1170918608 20:20653979-20654001 CTCTGGACAAAGAACAGGATTGG + Intronic
1171373540 20:24676591-24676613 CCCTGGCCAGTGACCAGGCCAGG + Intergenic
1172737769 20:37140915-37140937 ATGTGGTCTATGACCAGGCACGG - Intronic
1173082866 20:39886545-39886567 CTCTGAACAAACACCAGGCAGGG - Intergenic
1173988168 20:47278977-47278999 CTCTGGAGAATCAAGAGGCAGGG + Intronic
1177861917 21:26464249-26464271 ATCTCGTCAATGACCATGCATGG + Intergenic
1178191204 21:30282981-30283003 CTTTTGACAATCACCAGGGAAGG - Intergenic
1181055991 22:20260696-20260718 CTCTGCCCAAGGACCAGTCAGGG + Intronic
1181584832 22:23847480-23847502 GGCTGGACAATCACCTGGCACGG - Intergenic
1181612440 22:24026262-24026284 CTCTGGAACCTGGCCAGGCATGG - Intronic
1182435954 22:30329981-30330003 CTCTGGAGTTTGGCCAGGCATGG - Intergenic
1183298539 22:37046530-37046552 ATCCGGACAAAGCCCAGGCACGG + Intergenic
1184353113 22:43958041-43958063 TTCTGGACAAAGGCCAGGCGTGG - Intronic
1184402658 22:44282801-44282823 CACTGGAGAATGTCCAGGCAAGG - Intronic
1184404715 22:44293304-44293326 CGCTGGAGAATGACAAGGGATGG + Intronic
1184953118 22:47860270-47860292 CTCTGGAGAATCACCTTGCAAGG - Intergenic
1185216095 22:49600762-49600784 CTCTGGAAAATGCCCGGGAATGG + Intronic
950878248 3:16298366-16298388 CTGTGGACCAGGACCAGGCCAGG - Intronic
951169696 3:19526591-19526613 CTGTGGACACTGACAACGCATGG + Intronic
953538979 3:43797874-43797896 CTTTTGACATTGCCCAGGCAGGG - Intergenic
954653200 3:52177794-52177816 GCCTGGACAGTGACCAGGGAAGG + Intergenic
960978411 3:123199611-123199633 CTCTGAAAATTGGCCAGGCATGG - Intronic
961463888 3:127070030-127070052 CACTGGACCAAGACCAGCCAGGG - Intergenic
962236444 3:133711455-133711477 TTCTGGAAAAGGACCAGGCTCGG - Intergenic
966423298 3:179755268-179755290 TTCTGAACAATGACCAGTGATGG - Intronic
968044066 3:195613696-195613718 CACTGGCCAGTGACCAGACAAGG - Intergenic
968934113 4:3601115-3601137 TTCTGGACAATGTCCAGGTGAGG - Intergenic
974940181 4:68458168-68458190 CACTGGAAAATGACAAGTCAAGG - Intronic
975842731 4:78492718-78492740 TTCAGGACAAGGACAAGGCAAGG + Intronic
984854980 4:184187262-184187284 CCCTGACCAATGACCAAGCAAGG - Intronic
989484872 5:41977727-41977749 ATATGGACAGCGACCAGGCATGG - Intergenic
991502409 5:67290008-67290030 CCCTGGATAATGACCAGTCTTGG + Intergenic
995014538 5:107295074-107295096 CTGGGGACAATGACCTGGCCTGG - Intergenic
995736173 5:115302182-115302204 CTGTGGAAAATGAGCAAGCAGGG - Intergenic
995972126 5:117985316-117985338 ATTTCGACAATGACCAGACAAGG - Intergenic
996642659 5:125776128-125776150 CTCTGGAAAAGGAGGAGGCAAGG - Intergenic
998105022 5:139462907-139462929 CTATGCACAATGACCAACCATGG + Intergenic
998283461 5:140835369-140835391 AACTGTACAATGACCAGCCAGGG - Exonic
999494594 5:152084711-152084733 CTCTGGGCAATGAGCAGGGCAGG - Intergenic
1000397652 5:160792467-160792489 CACTGGAATATGAGCAGGCATGG + Intronic
1000762812 5:165247187-165247209 CTCTGTAGACTGAGCAGGCAAGG + Intergenic
1001492132 5:172163368-172163390 CTCTGGACAGTCATCAGGAAAGG - Intronic
1001964883 5:175903155-175903177 CTCTGCACAGTGTCCAGGCAAGG - Intergenic
1002252072 5:177936033-177936055 CTCTGCACAGTGTCCAGGCAAGG + Intergenic
1002779541 6:355807-355829 CTCTGGGCAATGAAAAGGAAAGG - Intergenic
1003749749 6:9042104-9042126 CTTTGGTCAACCACCAGGCATGG + Intergenic
1006565446 6:34952495-34952517 CTCTGGACTTTGACAAGCCAGGG + Intronic
1006716440 6:36123674-36123696 CTCTGGACAATGACTCTGTAAGG - Intergenic
1007503490 6:42316351-42316373 CTTTGGATAGTGACCAGGAAGGG - Intronic
1007581847 6:42964495-42964517 CTGTGGTCTATGCCCAGGCAGGG + Intronic
1007683707 6:43652014-43652036 CCCTGGGCATTGGCCAGGCACGG + Intronic
1007714753 6:43849316-43849338 CTCTGGACACTAACAGGGCAGGG + Intergenic
1010992028 6:82490132-82490154 CTCTGCACAATGACCTGGGTGGG - Intergenic
1012984032 6:105856032-105856054 CTTTTGACATTGGCCAGGCATGG - Intergenic
1013173189 6:107655807-107655829 CTTTGGACAAAGACCAAACACGG - Intronic
1015555741 6:134459642-134459664 CTCTGGAGAAAGACAAGGCTGGG - Intergenic
1015937861 6:138420646-138420668 CTCTTGCCAAAGACCAAGCAAGG + Exonic
1017127308 6:151078239-151078261 CTCTGTACATTGCCCAGGCTGGG - Intronic
1017797414 6:157858510-157858532 CTCTGGACAATGGCCGGGCATGG - Intronic
1022421930 7:30231398-30231420 CAAGAGACAATGACCAGGCAGGG - Intergenic
1023602405 7:41892771-41892793 CTCCCCACAATGACCAGGCATGG + Intergenic
1025613187 7:63096147-63096169 CTCAGGACATGGGCCAGGCATGG - Intergenic
1027344722 7:77246132-77246154 CTCTGGTGACTGACCAGTCAGGG - Intronic
1033077998 7:138267716-138267738 CTCTGGCCAAAGACCAGGAAAGG + Intergenic
1033870638 7:145750340-145750362 ATATGGACAATGACCAGTCTTGG + Intergenic
1034758481 7:153647285-153647307 CTTTGGACAATGTGAAGGCAGGG - Intergenic
1035282494 7:157786844-157786866 CTCTGGGCACTGGGCAGGCAAGG - Intronic
1035412575 7:158656914-158656936 CTCTGGACACTGAAGAAGCAGGG + Intronic
1042182833 8:66109131-66109153 CTCTGGCCAATGACTGAGCAAGG + Intergenic
1046975769 8:120275413-120275435 TTCTGGACATTGACCTGGCAAGG + Intronic
1048854231 8:138673067-138673089 CTCTGCACTGTCACCAGGCAGGG - Intronic
1048886313 8:138912778-138912800 CTCTGGAAGATGACAAGTCATGG + Intronic
1049311246 8:141935024-141935046 GTGTGGACAGTGACCTGGCATGG - Intergenic
1049327491 8:142030819-142030841 CTCTGGAGAAAGCCCAGGCAGGG - Intergenic
1049683325 8:143929444-143929466 CGCTGGACAAAGAGCCGGCACGG - Exonic
1051893093 9:21963204-21963226 TTCTAGACATTGACTAGGCAAGG - Intronic
1053006185 9:34606230-34606252 TACAGGATAATGACCAGGCAGGG - Intergenic
1054456040 9:65430864-65430886 TTCTGGACAATGTCCAGGTGAGG + Intergenic
1054967816 9:71049679-71049701 CTACCCACAATGACCAGGCAAGG - Intronic
1055178321 9:73349352-73349374 GTCTGGACCATGACCCGGAAAGG + Intergenic
1058802192 9:108555379-108555401 GGCTGGACAATGACCATTCAGGG + Intergenic
1059292284 9:113236877-113236899 TTCTGGATAATTCCCAGGCAAGG - Intronic
1061136553 9:128737537-128737559 GACTGGCCAATCACCAGGCATGG - Intronic
1061934339 9:133849162-133849184 CTCATGCCAATGAGCAGGCACGG + Intronic
1062154115 9:135036780-135036802 GTCTGCACAATGAGGAGGCAAGG + Intergenic
1062396771 9:136355781-136355803 CCCTGGACGATGGCCAGGCCGGG + Exonic
1185501524 X:600250-600272 CACAGGGCAATGAGCAGGCAGGG - Intergenic
1188866989 X:35325559-35325581 CTCTGGAGAATGAGAAGCCATGG - Intergenic
1189819558 X:44857392-44857414 CTTTGGTTTATGACCAGGCACGG + Intergenic
1195956519 X:110336773-110336795 CTCTGGAAAGTGACTTGGCATGG - Intronic
1197434632 X:126410790-126410812 CTCAGGGCAGTGGCCAGGCATGG - Intergenic
1198825412 X:140693497-140693519 ATCTGGAGAAGGGCCAGGCACGG + Intergenic