ID: 1146552650

View in Genome Browser
Species Human (GRCh38)
Location 17:33795060-33795082
Sequence CATGGTAATCAGAGCAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146552647_1146552650 -1 Left 1146552647 17:33795038-33795060 CCACTTGTGTCCAGCACTGTATC 0: 1
1: 0
2: 0
3: 15
4: 158
Right 1146552650 17:33795060-33795082 CATGGTAATCAGAGCAAAGCTGG 0: 1
1: 0
2: 1
3: 15
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146552650 Original CRISPR CATGGTAATCAGAGCAAAGC TGG Intronic
905597273 1:39218804-39218826 CCTGGACAACAGAGCAAAGCAGG - Intronic
906255682 1:44348108-44348130 CATGCTAATTAGAACAGAGCAGG + Intronic
906858182 1:49330909-49330931 CATGGAGAACAGAGGAAAGCAGG + Intronic
907421957 1:54353629-54353651 CATGGAAGTCAGAGAAAAACAGG + Intronic
907593725 1:55700608-55700630 CATGGAACTCACAGCTAAGCAGG - Intergenic
908318111 1:62954259-62954281 CTTGGGAATGAGAGCAAAGAGGG + Intergenic
908929357 1:69298651-69298673 AATGGTAAACAGAAAAAAGCAGG - Intergenic
909353617 1:74682092-74682114 GCTGGTTATCACAGCAAAGCTGG + Intergenic
909605936 1:77508384-77508406 CATGGTTACCAGAGTGAAGCTGG - Intronic
910208288 1:84769561-84769583 CAGGGCAAGCAGAGTAAAGCTGG - Intergenic
910534422 1:88280230-88280252 CATGGTGATCAAATCAAATCTGG + Intergenic
910563829 1:88621022-88621044 AATGGAAATCAGAAAAAAGCAGG + Intergenic
912580777 1:110719145-110719167 CCTGGGATACAGAGCAAAGCAGG - Intergenic
912762431 1:112381077-112381099 CAAAGTAATCAGACCAAAGCAGG + Intergenic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
917478010 1:175385402-175385424 GGTGGTAATCAAAGCAAGGCAGG + Intronic
917616632 1:176752465-176752487 CATGGTTAGCAAAGCAAGGCAGG - Intronic
918760546 1:188399370-188399392 TTTGGGAATCAGAGTAAAGCTGG - Intergenic
919166458 1:193900967-193900989 CATGCCATTCAGATCAAAGCTGG - Intergenic
924636634 1:245793889-245793911 CACATTAATCAGAGGAAAGCTGG - Intronic
1064562297 10:16605149-16605171 CCTTGTAATCAAAGCAATGCTGG + Intronic
1067253788 10:44614791-44614813 CTTTGTAATCAGGGTAAAGCTGG - Intergenic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1068957409 10:62830734-62830756 CAGTGTATGCAGAGCAAAGCTGG - Intronic
1071269084 10:83990582-83990604 CAGGGTCATCTGATCAAAGCAGG + Intergenic
1077984605 11:7339174-7339196 AATGGAAATCAGAAAAAAGCAGG - Intronic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078993541 11:16672845-16672867 AATGGAAATCAGAAAAAAGCAGG + Intronic
1080679422 11:34460270-34460292 CATGTTAATCAAGGCAAAGATGG - Intronic
1082234763 11:49810817-49810839 CAAGGTGATCAGAACAATGCTGG + Intergenic
1082608468 11:55271509-55271531 CAAGGTGATCAGAACAATGCTGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083131251 11:60624726-60624748 AATGGTAAACAGAAAAAAGCAGG + Intergenic
1087084940 11:94207959-94207981 CAAGGTAAAAAGAACAAAGCTGG + Intergenic
1087333135 11:96809113-96809135 CATGCTAATCACAACAAAGCTGG - Intergenic
1087399667 11:97649678-97649700 AATGGAAATCAGAAAAAAGCAGG - Intergenic
1088564803 11:111158562-111158584 AATGCTAATCATAGGAAAGCTGG - Intergenic
1093232241 12:16560404-16560426 CTTTGTAATCAGAGGTAAGCAGG - Exonic
1095816566 12:46429109-46429131 CATGGTAAGCATAGCAGTGCAGG - Intergenic
1098839760 12:75464934-75464956 AATGGAAAACAGAACAAAGCAGG - Intergenic
1100741706 12:97600983-97601005 CAGGGTGATCAGAACAAAACAGG - Intergenic
1101250144 12:102925317-102925339 CATGTTTTTCAGAGCAAAGGAGG + Intronic
1101740101 12:107494140-107494162 CCTGGAAAGCTGAGCAAAGCTGG - Intronic
1104536706 12:129624502-129624524 AATGGTCATCAGAGCTCAGCTGG + Intronic
1105396479 13:20041374-20041396 AATGGAAACCAGAGAAAAGCAGG - Intronic
1106648406 13:31662411-31662433 AATGGAAATCAGAAGAAAGCAGG - Intergenic
1107069201 13:36252026-36252048 CATGGTAGTAAGTGCAGAGCTGG + Intronic
1107243908 13:38269308-38269330 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1108709261 13:53016937-53016959 CTTGGTAAAGAGGGCAAAGCTGG + Intergenic
1109598837 13:64595954-64595976 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1111351174 13:87033583-87033605 AATGGGAATCAGATAAAAGCTGG - Intergenic
1112711825 13:102138251-102138273 CATGGAAAACAGTGCAGAGCTGG + Intronic
1112711867 13:102138543-102138565 CATGGAAAACAGTGCAGAGCTGG + Intronic
1113428099 13:110226616-110226638 CAAGGTAATCTCAGCAGAGCTGG + Intronic
1113746580 13:112749583-112749605 GATATTAATCAGAGAAAAGCTGG + Intronic
1114278936 14:21172279-21172301 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1114849027 14:26360127-26360149 CCTGGTATTCAAAGCAAAGGTGG - Intergenic
1114880790 14:26783052-26783074 AATGGTAATTAGAGAAATGCTGG + Intergenic
1115452482 14:33564235-33564257 CATGGTAACCAAAGCAAAAAGGG + Intronic
1116028401 14:39540507-39540529 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1116212006 14:41959544-41959566 AATAGTAACCAAAGCAAAGCAGG - Intergenic
1117718133 14:58601609-58601631 CCTGGTAAAGAAAGCAAAGCAGG - Intergenic
1118818048 14:69326546-69326568 CATGGATATCAGAGGAGAGCTGG + Intronic
1118877953 14:69800423-69800445 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1120548456 14:85839994-85840016 CATGGAAACCAGAAGAAAGCTGG + Intergenic
1122277789 14:100604063-100604085 CAAGGTGATCAGAGCAAATCAGG - Intergenic
1123069086 14:105632384-105632406 CATGGGACTCAGAGCTGAGCAGG - Intergenic
1123951065 15:25275863-25275885 CATGTTAATCAAGGCAAAGAAGG - Intergenic
1126715765 15:51515778-51515800 CATGGTAATGAGTGCAAAGGAGG + Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1129233601 15:74210095-74210117 GATGGTGATCAGATCCAAGCTGG - Intronic
1130779406 15:87018939-87018961 AATGGAAAACAGAGAAAAGCAGG + Intronic
1132904596 16:2276085-2276107 CATGGTAGTCACCGCGAAGCCGG - Exonic
1135863028 16:26074771-26074793 CATGGTAGTTACAGGAAAGCAGG - Intronic
1137370322 16:47899159-47899181 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1137625916 16:49908493-49908515 CCTGGTGATAAGAGAAAAGCAGG + Intergenic
1141849481 16:86635453-86635475 CCTGGTAACCAGAGAAAAGCAGG + Intergenic
1143335138 17:6166516-6166538 AATGGAAATCAGAGTAGAGCAGG - Intergenic
1143486912 17:7260429-7260451 CCTGGGAATGAGAGCAAGGCTGG - Exonic
1146552650 17:33795060-33795082 CATGGTAATCAGAGCAAAGCTGG + Intronic
1146576632 17:33999181-33999203 AATGGTAACCAAAGAAAAGCAGG - Intronic
1149934224 17:60787873-60787895 CATGGTAAGAAGAGCAAGACAGG + Intronic
1152280209 17:79380660-79380682 CTTGGTTCTCAGTGCAAAGCTGG - Intronic
1153252384 18:3135650-3135672 CAAGTCAAACAGAGCAAAGCGGG + Exonic
1157355411 18:46929090-46929112 ATTAGAAATCAGAGCAAAGCCGG - Intronic
1158249687 18:55473772-55473794 CATAGTAATCAAATCAAAGCAGG + Intronic
1161340226 19:3737624-3737646 CAAGGTCATGAGAGCAAAGTGGG - Intronic
1165894413 19:39132885-39132907 GATTTTAATCAGAGCAAAGTGGG + Intronic
1166462935 19:43005269-43005291 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166469063 19:43061730-43061752 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166480204 19:43165247-43165269 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166588403 19:43971575-43971597 AATGGAAATCAGAAAAAAGCAGG + Intronic
1167870333 19:52363796-52363818 CATTGGAATCAGAACAAAACAGG - Intronic
925196102 2:1927145-1927167 CACGGAAATCAGAGAAGAGCTGG + Intronic
927050366 2:19321918-19321940 CATGGACCTCAGAACAAAGCTGG - Intergenic
928475967 2:31628293-31628315 AATGGAAAACAGAGAAAAGCAGG - Intergenic
929426692 2:41851225-41851247 CATGGGAATCTGATCAAAGCAGG - Intergenic
929435925 2:41928255-41928277 CAAGGTGATCAGGGCACAGCCGG + Intergenic
930118051 2:47736795-47736817 CACGGTAATCAGAACTCAGCTGG - Intronic
931274233 2:60730246-60730268 AATAGTAATCAGGCCAAAGCAGG + Intergenic
932121323 2:69103153-69103175 CTTGGTAAGCAGAGCAAGGCTGG + Intronic
932583167 2:73005778-73005800 CATGGCATTCAGCACAAAGCTGG + Intronic
934072754 2:88400089-88400111 CATGGTCACCAGAGAAAATCTGG + Intergenic
935290322 2:101604680-101604702 TAAGGTAAACAGAGCAAAGGGGG - Intergenic
936841374 2:116773797-116773819 TATGGTAATCTGAGCAGGGCAGG - Intergenic
937006277 2:118519657-118519679 CATGGTAAGCAGAGCCAAGAGGG - Intergenic
937610757 2:123857774-123857796 GATGGAAAGCAGAGAAAAGCAGG + Intergenic
939179918 2:138792699-138792721 AATGGAAAACAGAGAAAAGCAGG - Intergenic
939583476 2:143979049-143979071 CCTGGTTGTCAGAGTAAAGCAGG - Intronic
940124431 2:150309018-150309040 CATGGAGATCAAAGAAAAGCAGG + Intergenic
940288517 2:152055600-152055622 AGTGATAATCAGAGCACAGCAGG - Intronic
941467558 2:165847477-165847499 CATGGTGATCACAACTAAGCTGG - Intergenic
943152865 2:184136639-184136661 AATGGGAAACAGAGGAAAGCAGG - Intergenic
945761385 2:213920105-213920127 TATGGAAAACAGAGAAAAGCAGG - Intronic
945806144 2:214492127-214492149 CATAGTAAACAAACCAAAGCAGG + Intronic
946706924 2:222467364-222467386 CAGGGTACTCAGATCAGAGCAGG - Intronic
1169150637 20:3286724-3286746 GATGGGAATTGGAGCAAAGCTGG - Intronic
1173582537 20:44157788-44157810 CATGGTCTTCAGAGTTAAGCAGG - Intronic
1177137062 21:17316135-17316157 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1177995712 21:28094637-28094659 TATGGCAATGAGACCAAAGCTGG - Intergenic
1181792890 22:25282126-25282148 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1181813529 22:25420464-25420486 CAGGCTAAGCAGAGCAAAGTGGG - Intergenic
1181930375 22:26396086-26396108 CAGGGTGCTCAGAACAAAGCAGG + Intergenic
1182591992 22:31388604-31388626 AATGGAAATCAGAAAAAAGCAGG - Intergenic
1185079035 22:48699272-48699294 CATTGTAATCAGAACAATGAAGG - Intronic
1185303118 22:50094051-50094073 TATGCTAATAAGAGCAAAGAAGG - Intronic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951357401 3:21684717-21684739 GTTATTAATCAGAGCAAAGCTGG + Intronic
951778168 3:26333581-26333603 CAAGGTACTCAGAGAAATGCTGG - Intergenic
954377253 3:50201700-50201722 TATGGTGAGCAGAGCTAAGCAGG - Intergenic
955169211 3:56546821-56546843 CTTGGTAATGCGAGGAAAGCAGG + Intergenic
958817423 3:98931002-98931024 AATGGAAAACAGAGAAAAGCAGG + Intergenic
959147180 3:102562646-102562668 AATGGTAAACAGAAAAAAGCAGG + Intergenic
960060481 3:113315251-113315273 AATTTTAATCAAAGCAAAGCAGG + Intronic
965315692 3:167187436-167187458 CGTGTGCATCAGAGCAAAGCTGG + Intergenic
965600679 3:170451547-170451569 CATGGTCATCAGACCACAGAAGG + Intronic
966423606 3:179758105-179758127 CATGGTAGGAAGGGCAAAGCAGG + Intronic
968293823 3:197558161-197558183 CCTGGTTGTCACAGCAAAGCTGG - Intronic
969990101 4:11253373-11253395 CATGGTATTTAGAGCAGAGCTGG - Intergenic
970067605 4:12116654-12116676 CATGGAGATCTGAGCAACGCAGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
971637180 4:29075888-29075910 CATTGAATTCAAAGCAAAGCTGG + Intergenic
976871491 4:89799365-89799387 CATTGTCACCAGAGCATAGCAGG - Intronic
977508783 4:97936201-97936223 AATGGTAAACAGAAAAAAGCAGG - Intronic
978060629 4:104333196-104333218 GATGGAAAACAGAGAAAAGCAGG + Intergenic
979160239 4:117450371-117450393 AATGGAAAACAGAGAAAAGCAGG + Intergenic
980141134 4:128918745-128918767 AATGGAAAACAGAACAAAGCAGG + Intronic
980645072 4:135633651-135633673 AATGGTAAACAGAAAAAAGCAGG - Intergenic
980989560 4:139727718-139727740 CTTGGCAATCAGAGCAGTGCAGG - Intronic
982367548 4:154596786-154596808 CATGGTATTCAGTGCATTGCTGG + Intergenic
986048569 5:4065162-4065184 CATCATAATCAGAGCAAAGAGGG + Intergenic
988529597 5:32016072-32016094 CAAGGAAAGAAGAGCAAAGCAGG + Intronic
990743619 5:58936877-58936899 CAGGATACTCAAAGCAAAGCAGG - Intergenic
991254566 5:64600010-64600032 GATGGTGATTTGAGCAAAGCTGG - Intronic
993018889 5:82566650-82566672 AATGGGAATCAGAAAAAAGCAGG + Intergenic
994500002 5:100563320-100563342 AATGGTAACCAAAACAAAGCAGG + Intronic
996313133 5:122129434-122129456 GATGGGAAACAGAGCAAAGTAGG - Intergenic
997838708 5:137218453-137218475 CATTTCAATCAGAACAAAGCAGG - Intronic
999138815 5:149343218-149343240 CATGGAACTCAGAGACAAGCAGG + Intergenic
1000574453 5:162959695-162959717 CATGGTTACCTGAGGAAAGCGGG + Intergenic
1000952910 5:167506419-167506441 CTTGGTTTTCAGAGCAAACCAGG + Intronic
1001349639 5:170947625-170947647 CATTGTAATCAGATGACAGCTGG + Intronic
1004684911 6:17933941-17933963 CATTGTAATAAGATAAAAGCAGG - Intronic
1009709208 6:67296108-67296130 CTGGGCAATCAGAACAAAGCTGG - Intergenic
1012337805 6:98082904-98082926 AATGGAAATCAGAAAAAAGCAGG - Intergenic
1012454207 6:99386475-99386497 CATTGTAAACAAAACAAAGCCGG + Intronic
1012589841 6:100967835-100967857 CATGGAAAACAGAAAAAAGCGGG + Intergenic
1016487596 6:144559373-144559395 CAGGGAAAACAGAGCAAAACTGG + Intronic
1018015894 6:159712188-159712210 TATGGTGATCAGAGCAATGTGGG - Intronic
1018124919 6:160672656-160672678 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1019650313 7:2153747-2153769 CATGTTTATCACAGCAAAGATGG + Intronic
1020513986 7:9092967-9092989 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1020776784 7:12464376-12464398 CATGGTACTCATATAAAAGCAGG - Intergenic
1020969443 7:14916468-14916490 AATGCTAATCAAAGTAAAGCTGG + Intronic
1021020564 7:15593222-15593244 CAAGGTAATGAGACCAAAGATGG + Intergenic
1022519734 7:30998401-30998423 CGTGGGAGTCAGGGCAAAGCCGG + Intergenic
1023156255 7:37255604-37255626 CGTGGTAAAGACAGCAAAGCAGG - Intronic
1023283021 7:38591126-38591148 CATGGGAATCAGAGGAGACCTGG - Intronic
1023886139 7:44358157-44358179 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1024412178 7:49057035-49057057 CATGGTATTGAGAGAAAACCAGG - Intergenic
1025242199 7:57286341-57286363 CTTGGAAAGCAGAGAAAAGCTGG - Intergenic
1026167010 7:67919083-67919105 CTTGGAAAGCAGAGAAAAGCTGG - Intergenic
1030029989 7:105360204-105360226 AATGGAAAGCAGAGAAAAGCAGG - Intronic
1030833867 7:114258874-114258896 CATGGTAGGCAGAGAAAACCTGG + Intronic
1031096918 7:117431378-117431400 AATGGAAAACAGAGAAAAGCAGG - Intergenic
1031182874 7:118438998-118439020 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1031254526 7:119430454-119430476 AATGGAAAACAGAGAAAAGCAGG + Intergenic
1032487614 7:132299827-132299849 AACGTGAATCAGAGCAAAGCAGG + Intronic
1032775404 7:135108035-135108057 AATGGAAATCAGAAAAAAGCAGG - Intronic
1035736685 8:1892792-1892814 CATGGAAAACAGAGCAAAACAGG - Intronic
1037170479 8:15886085-15886107 CATGATAGTCAGAGGAAAGCAGG + Intergenic
1037466845 8:19169235-19169257 CATGGGAGTCAGAGGAAAACGGG + Intergenic
1037956218 8:23062015-23062037 CTTGGGTATCAGAGCAATGCTGG + Intronic
1038663748 8:29519709-29519731 CATGGTAATGAAATCAAAGAAGG - Intergenic
1039138816 8:34359459-34359481 AATGGAAAACAGATCAAAGCAGG - Intergenic
1041089482 8:54288611-54288633 CATGGTTATTTGAGAAAAGCTGG + Intergenic
1041138388 8:54786729-54786751 CAAGATAATAAGAGCAGAGCAGG - Intergenic
1041615183 8:59898831-59898853 CATGGAAAACCGAGAAAAGCAGG + Intergenic
1044508343 8:93047329-93047351 CATGGAAAGCAGAAAAAAGCAGG - Intergenic
1047697885 8:127420945-127420967 CATGTTCATCAGCACAAAGCTGG + Intergenic
1048363806 8:133720869-133720891 AAGGTTAATCAGAGCAGAGCTGG + Intergenic
1049153795 8:141055042-141055064 CAGGGTAATCAGAACAGAGGGGG - Intergenic
1051884764 9:21879374-21879396 AATGGAAATCAGAAAAAAGCAGG - Intronic
1051918145 9:22231613-22231635 AATGGAAATCAGAAAAAAGCAGG + Intergenic
1053180172 9:35961949-35961971 CATGGTATTCAGAGAAAATTTGG - Intergenic
1055052206 9:71992150-71992172 CCTTGTGATCAGTGCAAAGCAGG - Intergenic
1055747076 9:79459854-79459876 CATGGGAAAAAGAACAAAGCAGG + Intergenic
1056110191 9:83387788-83387810 CATGGTCCCCAGACCAAAGCTGG + Intronic
1056904696 9:90635285-90635307 CATAGTAATCATAGCTAATCTGG + Intronic
1058514349 9:105753983-105754005 AATGGAAAACAGAGAAAAGCAGG + Intronic
1188289526 X:28370330-28370352 AATGGAAATCAGATAAAAGCAGG - Intergenic
1191576160 X:62708463-62708485 CATTTAAATCAGAGCAAAGGGGG - Intergenic
1192067403 X:67901239-67901261 CATGGAAATCAGTACAAAGCAGG - Intergenic
1192109680 X:68351531-68351553 CATGGTCACCAAAGCACAGCTGG + Intronic
1193312566 X:80025083-80025105 CTTGGGAATAAGAGCAAAACTGG + Intronic
1193398682 X:81015946-81015968 CTTGGAACTCAGTGCAAAGCAGG + Intergenic
1193533415 X:82684653-82684675 AATGGAAAGCAGAACAAAGCAGG - Intergenic
1193613832 X:83664795-83664817 AATGGAAAACAGAGAAAAGCAGG - Intergenic
1194263780 X:91731633-91731655 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1195796616 X:108655391-108655413 CCTGGTAATCCGGGCAAACCAGG - Exonic
1196574225 X:117300097-117300119 AATGGAAAACAGAGAAAAGCAGG - Intergenic
1197930339 X:131688210-131688232 AATGGTAATCATAAGAAAGCTGG - Intergenic
1198816001 X:140590996-140591018 CATGTTAAGCTGAGCAAAGATGG - Intergenic
1199437533 X:147829132-147829154 GATGGAAAACAGAGAAAAGCAGG + Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic