ID: 1146552914

View in Genome Browser
Species Human (GRCh38)
Location 17:33797569-33797591
Sequence ATGCATGTTGATGTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146552913_1146552914 3 Left 1146552913 17:33797543-33797565 CCATGATTGATCATTAGTAAATA 0: 1
1: 0
2: 1
3: 29
4: 323
Right 1146552914 17:33797569-33797591 ATGCATGTTGATGTGAAGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146552914 Original CRISPR ATGCATGTTGATGTGAAGCT TGG Intronic
902156064 1:14487499-14487521 TTGTATGTGGATATGAAGCTGGG - Intergenic
902817619 1:18925315-18925337 ATGGAAGTGGATGTGAGGCTTGG - Intronic
903385366 1:22922725-22922747 TTGCAGGTTGATCTGGAGCTAGG + Intergenic
905012850 1:34759000-34759022 ATGAAGGTTAATGTGCAGCTAGG - Intronic
907608049 1:55839410-55839432 ATGCAGGTTAATGAGAAGCCAGG + Intergenic
910757525 1:90708189-90708211 AAGCATGTTGACTTCAAGCTTGG + Intergenic
911547321 1:99234139-99234161 ATGCATTGTTCTGTGAAGCTAGG + Intergenic
911688942 1:100809174-100809196 ATTTATGTTTATGTGTAGCTTGG - Intergenic
912149908 1:106845853-106845875 ATGCATGTTGATGTCAATATTGG - Intergenic
912624895 1:111198760-111198782 AGACAAGTGGATGTGAAGCTGGG + Intronic
913533750 1:119751832-119751854 ATGCATGTTGTTTTGCAGCATGG - Intronic
915552956 1:156645914-156645936 GTCCATGGTGATGTGAAGGTAGG + Intronic
916194952 1:162213831-162213853 ATGCCTGTTGCAATGAAGCTTGG + Intronic
916964454 1:169921573-169921595 ATGCATGTTGATGTTATTGTGGG - Exonic
918072339 1:181142119-181142141 AGACATGCAGATGTGAAGCTGGG - Intergenic
921240554 1:213177087-213177109 ATGCATGTGGGTGTGAAGTGAGG - Intronic
924721027 1:246623261-246623283 GAGCATGTTTATGTAAAGCTGGG - Intronic
1065514047 10:26506960-26506982 ATGCATGTGGGTGTGGTGCTGGG + Intronic
1065694913 10:28370743-28370765 ATGCATATTGCTGTGCAGTTTGG - Intergenic
1065963358 10:30752098-30752120 ATGCCTGTTTGTGTCAAGCTGGG + Intergenic
1066710450 10:38227804-38227826 ATGCTTGTAGATTTGATGCTTGG - Intergenic
1066979557 10:42399643-42399665 ATGATTGTAGATGTGATGCTTGG + Intergenic
1067539432 10:47141088-47141110 ATGGAAGCTGATGTGCAGCTTGG - Intergenic
1072575063 10:96691708-96691730 TTGCTTGGTGAAGTGAAGCTTGG + Intronic
1074460798 10:113635349-113635371 ATGCAGGTAGAAGTAAAGCTAGG + Intronic
1075595624 10:123727111-123727133 GTGCATGTAGATGTGAATTTAGG + Intronic
1076480752 10:130783778-130783800 GTGCATTTGGATGTGAAGTTTGG - Intergenic
1076597584 10:131634879-131634901 ATACATATAGATGTGAAGATGGG + Intergenic
1076848438 10:133081414-133081436 ATGCATGTCGCTGTTAAGATCGG + Intronic
1078348132 11:10569749-10569771 ATGCATGTTTCTGAGAAACTGGG - Intronic
1080900592 11:36486723-36486745 CTGAATGTTGATTTGAAGTTTGG - Intergenic
1081906632 11:46674460-46674482 ATACATTTTGAAGTGTAGCTCGG - Intronic
1082081796 11:48018055-48018077 ATGCTTATTTATGTGAAACTTGG + Intronic
1083864273 11:65445334-65445356 AGACATGTGGATGTGAAGCTGGG + Intergenic
1085463639 11:76710002-76710024 AGGCATGTTGGTGTGGAGCTGGG + Intergenic
1092470955 12:8780372-8780394 ATCCATGTTCATGCTAAGCTGGG - Intronic
1092501198 12:9049960-9049982 ATGCATCTTGATTTGAAGTGAGG - Intergenic
1095609958 12:44115969-44115991 ATTTATTTTAATGTGAAGCTTGG - Intronic
1095767866 12:45916634-45916656 ATGGACTTTGATGTGAATCTTGG + Intergenic
1099110808 12:78558319-78558341 ATGCATGTTGACATCAAGGTAGG - Intergenic
1100307656 12:93365842-93365864 ACACATGCTGATGTGAAGGTTGG + Intergenic
1104717772 12:131027717-131027739 ATGCAGGGTGATGAGAAGTTTGG - Intronic
1109633891 13:65088053-65088075 TTCCATGGTGATTTGAAGCTAGG - Intergenic
1115005514 14:28478369-28478391 TTACATGTTGATGTAAAGCAAGG - Intergenic
1115104175 14:29740155-29740177 AGGCGTGTGGATGTGCAGCTTGG + Intronic
1118068508 14:62218804-62218826 ATGCCTGGTAATGTGAAGCCTGG + Intergenic
1119049084 14:71348550-71348572 ATGCATGTTGAGGTGCACATGGG + Intronic
1119416532 14:74474123-74474145 ATGGATGTGCATGTGTAGCTTGG - Intergenic
1120137623 14:80888402-80888424 AAGCATTTTGATGTGCTGCTGGG - Intronic
1125421187 15:39506226-39506248 ATACTTGTTGAAATGAAGCTAGG + Intergenic
1126171786 15:45701317-45701339 ATGCTTGTTTATGTGATGTTTGG + Intergenic
1127013632 15:54658161-54658183 ATGCAGGTTTATGTTAGGCTGGG + Intergenic
1130628767 15:85543795-85543817 ATGCATTTTGCTGTGCGGCTGGG + Exonic
1134533045 16:15000041-15000063 AATAATGCTGATGTGAAGCTAGG + Intronic
1139862986 16:70040687-70040709 AATAATGCTGATGTGAAGCTAGG - Intergenic
1146552914 17:33797569-33797591 ATGCATGTTGATGTGAAGCTTGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147952877 17:44116774-44116796 AGGCAGCTTGATGTGCAGCTGGG - Intronic
1152553888 17:81043478-81043500 AGGGATGTGGCTGTGAAGCTGGG + Intronic
1154215505 18:12413036-12413058 CTGCATGTTTGTGTGAGGCTGGG - Intronic
1154292777 18:13124634-13124656 GGGCATGTTGATGTAATGCTGGG - Exonic
1155035093 18:22019365-22019387 ATGCATGTGGATGCTACGCTAGG - Intergenic
1155840723 18:30639377-30639399 CTACATGTTGATGTGAAGTGAGG + Intergenic
1155867677 18:30986189-30986211 ATGCATGTTGATGTATAGATTGG + Intergenic
1156112511 18:33745160-33745182 AAGCCTGTTGATTTCAAGCTTGG - Exonic
1158462630 18:57659893-57659915 TTGCATGTTCCTGTGATGCTGGG - Intronic
1158959734 18:62579623-62579645 ATGCTAGTTAATGTGAATCTGGG - Intronic
1159662117 18:71110675-71110697 ATGCATGTAAATGTTAAGCATGG + Intergenic
1159758329 18:72393356-72393378 ATCCCTGTTGATGTTAACCTTGG - Intergenic
1160705946 19:530384-530406 ATGCTCCTTGCTGTGAAGCTTGG - Intergenic
1165084013 19:33330057-33330079 ATGAATGAAGGTGTGAAGCTGGG - Intergenic
1165389133 19:35528276-35528298 ATGCATATTGCTGGGAAGGTCGG + Exonic
1166567518 19:43774266-43774288 GTGCGTGTTCATGTAAAGCTTGG + Exonic
927650835 2:24912810-24912832 ATGCATGATGATGACAAACTGGG + Intronic
928109503 2:28495207-28495229 ATGCTTGTGGGTGTGAGGCTGGG - Intronic
928592477 2:32832109-32832131 CTGCATTTTGAGGTGAAACTTGG + Intergenic
928782175 2:34836947-34836969 GTACATGTTGATGTAAAGATGGG + Intergenic
931790132 2:65657589-65657611 ATGCATGCTTGTGTGAAGGTGGG - Intergenic
932230711 2:70082068-70082090 AGGCATGTGAATGTGAACCTGGG - Intergenic
932780718 2:74556822-74556844 ATGCATGGTGGTGCCAAGCTCGG + Exonic
933669511 2:84993498-84993520 TAAAATGTTGATGTGAAGCTGGG - Intronic
934755385 2:96820869-96820891 ATGCAGGTTGAAATGTAGCTAGG + Intronic
937403205 2:121603754-121603776 ATCCATGTTGCTGTGAAGGACGG - Intronic
939493776 2:142904996-142905018 ATGCATCTTGATGGGCAGCCAGG - Intronic
939764183 2:146225332-146225354 ATGCATATTCATGGAAAGCTGGG - Intergenic
940177726 2:150897460-150897482 ATTCATGTTCATGTGAAAATGGG - Intergenic
940825358 2:158406137-158406159 ATCCATGTCAATGTGAATCTGGG - Intronic
940944879 2:159604733-159604755 ATAAATGTTGATGGGAAGTTGGG + Intronic
941748838 2:169114650-169114672 ATGCATGTAGCTGTAAAGATGGG + Intergenic
942689952 2:178574679-178574701 ATGCATGCTGATGTGATGCCTGG + Exonic
943123102 2:183761978-183762000 ATTCATGTTGATGTGACCATTGG - Intergenic
943394824 2:187321349-187321371 CTGCATGGTCCTGTGAAGCTTGG - Intergenic
943520146 2:188939083-188939105 ATACATGCAGATCTGAAGCTAGG + Intergenic
943845707 2:192644220-192644242 AGGAATGTTGATATGAAGCATGG - Intergenic
1168995074 20:2127000-2127022 AAGCATCTTGATGTGGGGCTTGG + Intronic
1170243155 20:14192599-14192621 ATTCATGAAGATGTGTAGCTGGG + Intronic
1172077410 20:32309871-32309893 GTGGATGTGGATGTTAAGCTGGG + Exonic
1174845019 20:53935797-53935819 ATGCAGTTTGAAGAGAAGCTTGG - Intergenic
1175082106 20:56429322-56429344 ATGCAACTTGAGGTGATGCTTGG - Intronic
1175226685 20:57448635-57448657 ATGCATGTAGAAGTGTGGCTGGG - Intergenic
1177783263 21:25642066-25642088 ATTGCTGTTGATGTGAACCTAGG + Intronic
1177999677 21:28146550-28146572 ATACATGTTGAATTGAAACTTGG - Intergenic
1178384848 21:32140754-32140776 ATGCATGTTGATGTAAACGGTGG + Intergenic
1181789606 22:25254253-25254275 ATGTATGTTGATGTTAACATAGG - Intergenic
1181824426 22:25503077-25503099 ATGTATGTTGATGTTAACATAGG - Intergenic
1182262786 22:29087218-29087240 ATTCATGTTGATTTCAAGCCAGG + Intronic
1182675804 22:32038830-32038852 AGGCATGATGATGTGAAGGGAGG - Intergenic
952000579 3:28781362-28781384 TTGCTTTTTGATGTGTAGCTTGG + Intergenic
954649472 3:52151860-52151882 TTGCATTTTCATGTGAATCTTGG - Intronic
955730687 3:61982447-61982469 ATGCATGTTTAGGTGTATCTGGG - Intronic
958016459 3:87944239-87944261 ATGCATCTTGATGGGGAGCTGGG - Intergenic
961656173 3:128443212-128443234 ATGCCCCTTGATGTGAACCTGGG - Intergenic
964909007 3:161755237-161755259 ATGAATGTGGATGTGATACTGGG + Intergenic
966110878 3:176399917-176399939 ATGAATGTTCCTGTGAAGCAGGG + Intergenic
967201775 3:187078117-187078139 ATACATGTTGGTGTGAAGACTGG + Exonic
968580767 4:1393064-1393086 ACGTGTGTTGATGTGGAGCTGGG + Exonic
969588238 4:8106914-8106936 GTGCATGTGGATGAGAAGCACGG - Intronic
970147459 4:13051978-13052000 AAGCAGGTTGATGTAAAGTTTGG + Intergenic
971439147 4:26661104-26661126 AGGCATGGTGATGGGAATCTGGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978874264 4:113619759-113619781 ATCCATGTTGGTATAAAGCTAGG + Intronic
980099158 4:128523970-128523992 ATTCATGTTGATGGGCACCTAGG - Intergenic
981261387 4:142723982-142724004 ATGTATGTTGCTGTGGAGGTTGG - Intronic
983331834 4:166339916-166339938 ATGGATGTTGTTGTGAAGATGGG + Intergenic
985231494 4:187822720-187822742 ATGCATGTTGTGGTTTAGCTGGG - Intergenic
986896801 5:12381090-12381112 ATGCTTTTTGATGTGCTGCTGGG + Intergenic
988433075 5:31142331-31142353 CTGGATGTTGGTGTGAATCTTGG - Intergenic
988865795 5:35333171-35333193 ATACATATGGATGGGAAGCTAGG - Intergenic
989098330 5:37801462-37801484 ATGTATCTTGGTGTGAAGCTTGG + Intergenic
989608737 5:43271582-43271604 ATGCAAGTTTGTGTGAAACTGGG - Intronic
991560471 5:67946126-67946148 ATGCGTGTTGATTTGAAGAAGGG - Intergenic
992494165 5:77275534-77275556 ATGAATGTGGATCTGATGCTTGG + Intronic
993694290 5:91041762-91041784 ATTAATATTGATGTTAAGCTAGG - Intronic
997106612 5:131027621-131027643 ATGCATGTTGTTGTTAAGAAAGG - Intergenic
1003846991 6:10183789-10183811 ATGAATGTAGATGTGAATATGGG - Intronic
1004048082 6:12045589-12045611 ATGCATGTTGAGTTAATGCTTGG + Intronic
1004072511 6:12313826-12313848 ATATATCTTGATGTGCAGCTTGG - Intergenic
1004201571 6:13553829-13553851 ATGAATGCAGATGTGATGCTTGG - Intergenic
1007730995 6:43946389-43946411 GTGAATGTGGATGTGGAGCTGGG - Intergenic
1009533337 6:64849116-64849138 ATGCATTTTGACATCAAGCTTGG + Intronic
1009548564 6:65055827-65055849 GTGTATGTTGATGTTAACCTTGG + Intronic
1011778492 6:90759828-90759850 AGGGAGGTTGATGGGAAGCTGGG + Intergenic
1012035706 6:94135957-94135979 ATGCATCTTTATGTACAGCTCGG - Intergenic
1014199818 6:118596558-118596580 ATGTGTGTTGATGTAACGCTTGG - Intronic
1014760267 6:125348523-125348545 ATAGATGTTGCTGTGAAGGTAGG - Intergenic
1014869680 6:126577588-126577610 ATGCTTGATGAACTGAAGCTAGG + Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1017586746 6:155935149-155935171 AGGTATTTTGATGTGCAGCTGGG + Intergenic
1022568442 7:31427303-31427325 CTGAATTTTGACGTGAAGCTGGG + Intergenic
1022912464 7:34912298-34912320 ATGCAAATTGTAGTGAAGCTTGG + Intergenic
1023108484 7:36786664-36786686 ATACAAGTTGATGTGATTCTTGG - Intergenic
1023323742 7:39029567-39029589 ATGCATGGTGTTGTGAAGTCAGG - Intronic
1024287246 7:47768999-47769021 ATGCAGGTCTATGTGAAACTTGG - Intronic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1025831497 7:65055094-65055116 CTGCAGGTTGATGTGTAGTTGGG - Intergenic
1025918635 7:65888981-65889003 CTGCAGGTTGATGTGTAGTTGGG - Intronic
1026460830 7:70613868-70613890 ATGCATGTTGATGAAAAGGTAGG - Intronic
1031316352 7:120262205-120262227 ATGCATGATGATCTGAATGTTGG - Intergenic
1031537951 7:122958440-122958462 ATGCAAGTTGTTCTGAAGTTGGG - Intergenic
1031945245 7:127832937-127832959 ATGCTTGATGATCTGAAGGTGGG + Intronic
1033116556 7:138630999-138631021 ATGGATTTTTATGTAAAGCTGGG + Intronic
1035333258 7:158110234-158110256 ATGCGTGCATATGTGAAGCTTGG - Intronic
1036293817 8:7518554-7518576 GTGAATGTAGATGTGAAGCCAGG + Intergenic
1036328744 8:7802441-7802463 GTGAATGTAGATGTGAAGCCAGG - Intergenic
1036584943 8:10115069-10115091 ATACATGTTCATGTTAACCTGGG - Intronic
1037268650 8:17099797-17099819 ATGACTGTTGATTTGAAGCATGG - Intronic
1041710976 8:60894151-60894173 ATGACTGTTGATGTTAACCTTGG - Intergenic
1044402278 8:91786486-91786508 ATCCATGTTGCTGCGAAGCCTGG + Intergenic
1048107327 8:131425881-131425903 ATGCATGATAATATGAGGCTTGG - Intergenic
1051551639 9:18336747-18336769 ATGCAAGTTAATGTGAATGTTGG + Intergenic
1052266491 9:26579502-26579524 ATGCATGTGTGTGTGCAGCTGGG - Intergenic
1052640746 9:31163992-31164014 ATACCTGTTGATCTGGAGCTGGG - Intergenic
1059805392 9:117794068-117794090 AGGCATGATGAGGTGAAGATAGG + Intergenic
1062265873 9:135686227-135686249 ATTCATGTCTCTGTGAAGCTCGG + Intergenic
1186136829 X:6530060-6530082 ATGCGTGGGGATCTGAAGCTGGG + Intergenic
1186267513 X:7848370-7848392 ATGCGTGGGGATCTGAAGCTGGG - Intergenic
1186297532 X:8166499-8166521 ATGCGTGGGGATCTGAAGCTGGG + Intergenic
1186376669 X:9010760-9010782 ATGCGTGGGGATCTGAAGCTGGG - Intergenic
1190003681 X:46713641-46713663 CTGCATGTTGACATGAACCTAGG - Intronic
1193285321 X:79707304-79707326 ATGCATGTAAAAGTTAAGCTTGG + Intergenic
1193503935 X:82316693-82316715 ATGTAAGTTGAAGTGAGGCTGGG + Intergenic
1194462054 X:94182999-94183021 TGGCATATGGATGTGAAGCTTGG - Intergenic
1196145563 X:112313015-112313037 ATGTGTGTTGAGGTGAAGATGGG + Intergenic
1196744627 X:119059166-119059188 ATGCATGTAGATCTTAAGTTTGG - Intergenic
1197688709 X:129473996-129474018 ATGCATGTTGAAGTGTTTCTGGG + Intronic
1199154634 X:144533018-144533040 ATGACTGTTGATGTTAAGCTTGG - Intergenic
1201438210 Y:13981610-13981632 ATGCGTGGGGATCTGAAGCTGGG + Intergenic
1201951821 Y:19573646-19573668 ATCCTTGTTGATGGGATGCTAGG + Intergenic