ID: 1146553590

View in Genome Browser
Species Human (GRCh38)
Location 17:33803702-33803724
Sequence TTGTCTGAATAGAAGGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146553590_1146553596 15 Left 1146553590 17:33803702-33803724 CCGCCTGCCTTCTATTCAGACAA 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1146553596 17:33803740-33803762 TGTGTTCTCCAATTCACCAGCGG 0: 1
1: 0
2: 2
3: 12
4: 155
1146553590_1146553597 20 Left 1146553590 17:33803702-33803724 CCGCCTGCCTTCTATTCAGACAA 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1146553597 17:33803745-33803767 TCTCCAATTCACCAGCGGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 68
1146553590_1146553599 30 Left 1146553590 17:33803702-33803724 CCGCCTGCCTTCTATTCAGACAA 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1146553599 17:33803755-33803777 ACCAGCGGTAAGGAAGATAAAGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146553590 Original CRISPR TTGTCTGAATAGAAGGCAGG CGG (reversed) Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
903756883 1:25668447-25668469 TTTTCTGAATGGATGTCAGGTGG + Intronic
903963171 1:27070172-27070194 TTGGGTGAACTGAAGGCAGGTGG + Intergenic
907291547 1:53416625-53416647 CTGTTTGCATAGAAGCCAGGGGG + Intergenic
908045779 1:60166984-60167006 TTGTCTGACTAGATGGATGGTGG - Intergenic
908404609 1:63802234-63802256 TTGTCAGAATAGAACTCAAGAGG + Intronic
908842069 1:68289916-68289938 CTGTCTCAATTGAAGACAGGTGG + Intergenic
912739449 1:112180230-112180252 TGTTCTGAATAGAATCCAGGTGG - Intergenic
914245068 1:145879407-145879429 TTGTGTGAATATAGGGCATGAGG + Intronic
917489311 1:175484120-175484142 TTGTATGAATGGAAGTCAGATGG + Intronic
918507810 1:185277111-185277133 CTGGCTTAATAGAAGGCAGTGGG + Intronic
919962087 1:202481443-202481465 TTGGCTTAATAGAAGACAGTGGG - Intronic
920216444 1:204364416-204364438 TTGTATTAATAGAAAGCAAGCGG - Intronic
921470613 1:215543753-215543775 TTTTGTCAATAGAGGGCAGGAGG - Intergenic
922943908 1:229493807-229493829 TTTTCTGAATTGGAGGCATGAGG - Intronic
923318459 1:232805214-232805236 TTGTCTTAATACAAGGTTGGTGG + Exonic
924946667 1:248851134-248851156 ATGTATGAATTGAAGGCAGTGGG + Intronic
1063838370 10:10042448-10042470 TTGTCTGAGTGGAAGGAAGCTGG - Intergenic
1068311583 10:55283614-55283636 GTGACTGGATAGAAAGCAGGTGG - Intronic
1068615130 10:59105925-59105947 TTGTCTTAAAAGAGGGCATGGGG + Intergenic
1068758437 10:60681213-60681235 TTGTCTGAAAAGTAGGTGGGAGG - Intronic
1069814712 10:71186544-71186566 TAGTCAAACTAGAAGGCAGGGGG - Intergenic
1072392043 10:94997369-94997391 CTGCCTGTAAAGAAGGCAGGTGG - Intergenic
1072588405 10:96803442-96803464 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1074333910 10:112548987-112549009 TTTCTTGAAGAGAAGGCAGGAGG - Intronic
1074372850 10:112914192-112914214 CTGTCTGAAAAGAAAGAAGGAGG - Intergenic
1076291130 10:129346611-129346633 GTGTCTAAATTGTAGGCAGGTGG - Intergenic
1076322351 10:129592729-129592751 CTGGCTTAACAGAAGGCAGGTGG - Intronic
1076474767 10:130744245-130744267 TTGTCTGCAGGGACGGCAGGGGG - Intergenic
1080388995 11:31826927-31826949 TTTTCTGTCTAGAACGCAGGCGG + Intronic
1081835355 11:46149188-46149210 ATGTCTGAAGTGGAGGCAGGAGG - Intergenic
1081835418 11:46149544-46149566 ATGTCTGAAGTGGAGGCAGGAGG + Intergenic
1083635490 11:64118476-64118498 TTAAAAGAATAGAAGGCAGGAGG + Exonic
1086964142 11:93010127-93010149 CTCTGTGAATAGAAAGCAGGTGG + Intergenic
1087319792 11:96644025-96644047 TTTTGGGAATAGAAGGCAGCTGG + Intergenic
1087463889 11:98479684-98479706 TTGTTGGAATTGTAGGCAGGAGG + Intergenic
1089462936 11:118663278-118663300 TTCTCTCCAAAGAAGGCAGGGGG - Intronic
1089562070 11:119348438-119348460 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
1091635977 12:2196988-2197010 TTTTCTGAGCAAAAGGCAGGTGG - Intronic
1093857753 12:24126565-24126587 TGGGCTGAATAGAATGGAGGTGG - Intergenic
1100777831 12:97991733-97991755 ATGGCAGAAAAGAAGGCAGGAGG - Intergenic
1102321621 12:111940657-111940679 TTGTATGCATAGAAAGCAGTAGG + Intronic
1108593044 13:51927523-51927545 ATTACTGAATATAAGGCAGGTGG + Intergenic
1110559021 13:76890037-76890059 TGGTTTGAAGAGAAGGCAGTAGG - Intergenic
1111684906 13:91489715-91489737 TTGTCTTATTAAAAGGAAGGTGG - Intronic
1115009242 14:28523727-28523749 TTGTCTGAAGAGAACACAGTAGG - Intergenic
1116070918 14:40044528-40044550 TTTTGTGAACAGAAGGCAGATGG - Intergenic
1116751371 14:48889698-48889720 TTGTGTGGATGGAAGGCAGTAGG - Intergenic
1116811004 14:49540288-49540310 TTTCCTGACTAGAAGCCAGGAGG - Intergenic
1119790799 14:77348055-77348077 TTGGCTTAATAAAAGGCAGTTGG - Intronic
1121916260 14:97839156-97839178 TTGTATGAAAATAAGGCAGGCGG - Intergenic
1122338371 14:101008334-101008356 TTCTCTGTAAAGAAGGCAAGTGG - Intergenic
1123482292 15:20643300-20643322 TTGTCTGTGCAGCAGGCAGGGGG - Intergenic
1124724868 15:32147828-32147850 TTTTCTGAACAGAAGACAGAGGG - Intronic
1128292259 15:66486919-66486941 CTCTCTCAATAGAAGGAAGGGGG + Intronic
1133626759 16:7577332-7577354 ATGTATGAAGGGAAGGCAGGAGG - Intronic
1136568310 16:31082710-31082732 TTGTCAGAGCAGAGGGCAGGTGG + Intronic
1137906726 16:52331156-52331178 TTGTCTGAGTAGACTGCAGAGGG + Intergenic
1139198264 16:64946535-64946557 GTGTGTGAAGAGAAGCCAGGAGG + Exonic
1139915152 16:70423553-70423575 TTGTCTGAATTGCAGGCAGGGGG - Intronic
1140422940 16:74835725-74835747 CTGTCTCAAAAGGAGGCAGGAGG - Intergenic
1141486117 16:84341433-84341455 TGGTCCAAAGAGAAGGCAGGTGG + Intergenic
1141521347 16:84581803-84581825 CTGTTTCAATAGAAAGCAGGAGG - Intronic
1142650519 17:1348166-1348188 TTCTCAGAGTAGAAGGGAGGAGG - Intronic
1144191896 17:12854051-12854073 TTGGCAGAACAAAAGGCAGGTGG + Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1145838064 17:27969855-27969877 TTCACTGAATAGGAGACAGGAGG - Intergenic
1146553590 17:33803702-33803724 TTGTCTGAATAGAAGGCAGGCGG - Intronic
1147025220 17:37576555-37576577 TATTCTGAATCGGAGGCAGGGGG - Intronic
1148138555 17:45311737-45311759 GTGGCTGAAAAGGAGGCAGGTGG + Intronic
1148902162 17:50886510-50886532 GTTTCTGAAGAGCAGGCAGGAGG + Intergenic
1150168000 17:62963376-62963398 TTGGCAGAATAGAAGGATGGTGG + Intergenic
1153687630 18:7562408-7562430 TTGTAGGAAGAGAAGGTAGGAGG - Intergenic
1155139831 18:23034964-23034986 TTGGCTTAATAGAAGACAGTTGG - Intergenic
1157500024 18:48183821-48183843 ATGTCTGACTTGGAGGCAGGGGG - Intronic
1161015703 19:1981834-1981856 TTGTCTGGGGAGAAGGCACGGGG - Intergenic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1164749572 19:30642529-30642551 TTGGCTGATTAGAAGGTAGAAGG + Intronic
1165334018 19:35156626-35156648 TTTTAAGAATAGCAGGCAGGTGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165920400 19:39294154-39294176 CTGCCTGGAGAGAAGGCAGGCGG - Intergenic
1166116318 19:40657231-40657253 TTTTCTAAATAGAAGGGTGGGGG - Intergenic
1167670148 19:50847418-50847440 CTGGCTTAATAGAAGGCAGCTGG - Intergenic
926233527 2:11022643-11022665 TCGACTGAAAAGAAGACAGGAGG + Intergenic
926771840 2:16385150-16385172 TTTACTGTATAAAAGGCAGGGGG - Intergenic
927539100 2:23891428-23891450 TTTTTTGAAAAGAAGGAAGGTGG + Intronic
928042105 2:27889220-27889242 TTTTCTGAGTAGAATACAGGTGG + Intronic
928719879 2:34107920-34107942 ATGTCTGCATGGTAGGCAGGAGG + Intergenic
930533839 2:52622703-52622725 TTTCCTGAATACAAGGCAGTGGG - Intergenic
932467109 2:71931005-71931027 TTGTGCTAAGAGAAGGCAGGAGG + Intergenic
932806072 2:74784574-74784596 TTGGCTGGAGATAAGGCAGGAGG + Intergenic
937028621 2:118719777-118719799 TTGTCTGTCTTGAAGGCAGATGG - Intergenic
937571372 2:123366920-123366942 TTATCTTTTTAGAAGGCAGGTGG + Intergenic
940051394 2:149468812-149468834 ATGTCTGAAGAGAAGGCAGCTGG - Intronic
941169807 2:162122438-162122460 ATGACTTAATAGAAGACAGGTGG - Intergenic
942285522 2:174412290-174412312 TTGTCTGAGGAGAGGGAAGGTGG + Intronic
943709295 2:191072473-191072495 TTATCTGAATAGTAGGCAGAGGG - Intronic
946126174 2:217565077-217565099 TTGTCTGTCTAGCAGACAGGAGG - Intronic
946505779 2:220299216-220299238 TTGCTTGAATATAAGGCAGAAGG + Intergenic
946939869 2:224759516-224759538 TTGTTAGAAAAAAAGGCAGGAGG - Intergenic
947094776 2:226553569-226553591 GTTTCTGAATATAAGCCAGGTGG + Intergenic
947301997 2:228698029-228698051 TTATCTGAAGACAAAGCAGGAGG + Intergenic
947507939 2:230724292-230724314 TTGTGTGAACAGGAGGCATGTGG + Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
1169642580 20:7771019-7771041 TTGTCTGCATAGAATTCAAGTGG - Intergenic
1170664906 20:18378390-18378412 TTTTCTGAATGGAAGGAAGAGGG - Intergenic
1174409246 20:50322844-50322866 TTGAATAGATAGAAGGCAGGAGG - Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1185059491 22:48598853-48598875 CTGACTGAATATAAGTCAGGGGG + Intronic
951634240 3:24755630-24755652 TTGACTGAATTGAAGCCAGAAGG - Intergenic
954079238 3:48203312-48203334 CTTTCTTAATAAAAGGCAGGAGG + Intergenic
956083192 3:65581532-65581554 TTGTATGAATAGCAGCAAGGGGG - Intronic
956180257 3:66510931-66510953 TTGACTGTATTGAATGCAGGTGG - Intergenic
956571078 3:70695837-70695859 ATGTCTGACTAGAAGGCAGAAGG + Intergenic
956659131 3:71582275-71582297 TTGTCTGAAAAGGAGGGAGGCGG + Intronic
959186468 3:103053067-103053089 TTCTCTGACCAGAAGGCTGGTGG + Intergenic
961075569 3:123978766-123978788 ATGTCTGGATAGAATGGAGGGGG + Intronic
961308118 3:125973742-125973764 ATGTCTGGATAGAATGGAGGGGG - Intronic
963600538 3:147374618-147374640 TTCTCTGCATGGAAGGCAAGAGG - Intergenic
964265736 3:154893484-154893506 CTGTCTTATTAGAGGGCAGGTGG - Intergenic
965211330 3:165793328-165793350 CTGTCTGAAGAGATGGTAGGAGG - Intronic
966458338 3:180143754-180143776 TTCTATTAATAGAATGCAGGTGG + Intergenic
969092978 4:4709933-4709955 TTATATGGAAAGAAGGCAGGCGG - Intergenic
970215250 4:13751993-13752015 TTGGCTGTATAGATGGAAGGAGG - Intergenic
970359866 4:15298269-15298291 GTGTCTGTAAAGAAGGCATGGGG - Intergenic
973264839 4:48200778-48200800 TTGTCTGAATTGCAAGCTGGAGG - Intronic
973344155 4:49036376-49036398 TTCTCACAACAGAAGGCAGGTGG - Intronic
974373853 4:61051046-61051068 ATGTCTGAAGAAAAGGCATGTGG - Intergenic
974800326 4:66809153-66809175 TTGGCTGAACAGAAGACAGTTGG + Intergenic
976406706 4:84667629-84667651 CTGGCTCAATAGAAGACAGGTGG - Intergenic
976466443 4:85374580-85374602 GTGGCTGAATAGAAGGCAACTGG - Intergenic
979194490 4:117904147-117904169 TTGTCAGTATATAAGGCAAGTGG + Intergenic
979947938 4:126857913-126857935 TTGGCTTAATAGAAGACAGTTGG + Intergenic
980235564 4:130100546-130100568 TGGTCAGAATAGAAGGCATTAGG + Intergenic
980487955 4:133484437-133484459 TTGTCTGTAGAGATGCCAGGTGG + Intergenic
982771808 4:159403360-159403382 TTGTCTGAACAGAGAGCATGAGG - Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
983441436 4:167791523-167791545 TTATCTGAAGAAAAGGTAGGAGG - Intergenic
985430680 4:189876749-189876771 TGGTATGAACAGGAGGCAGGAGG + Intergenic
987277932 5:16381639-16381661 TTGGTTTAATAGAAGGCAGCTGG - Intergenic
988863621 5:35310401-35310423 AGGTCTGAATATTAGGCAGGAGG + Intergenic
992387665 5:76301367-76301389 TTGTCTGCATTGTTGGCAGGTGG + Exonic
992798796 5:80277244-80277266 TTGGCTGAGTCGAATGCAGGAGG - Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
995064092 5:107840896-107840918 TTGTCTGAGGAGAGGGAAGGTGG - Intergenic
996362506 5:122665664-122665686 GTTTCTGAAGAGAAGGGAGGAGG + Intergenic
998268470 5:140684930-140684952 CTGACTGAATAGAAGACAGCAGG + Intronic
998355808 5:141535333-141535355 TAGTCTGAAAAGAATGCAGAAGG - Intronic
1001122543 5:168992193-168992215 GTGTCTGACTAAAACGCAGGAGG - Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1002349616 5:178574825-178574847 TGGTTTGAAGAGAAGTCAGGTGG - Intronic
1002802126 6:533669-533691 TTGTCTCACCAGCAGGCAGGAGG + Intronic
1003964040 6:11236294-11236316 TTGGTTGAAGAGCAGGCAGGCGG - Intronic
1004604765 6:17183553-17183575 TTGTCTGTGCAGCAGGCAGGAGG + Intergenic
1005402888 6:25452701-25452723 TTGACTTAATAGAAGACAAGTGG + Intronic
1010610202 6:77945400-77945422 TTCTCTGAATAATATGCAGGCGG - Intergenic
1013938816 6:115634922-115634944 CTGTCTGACTTTAAGGCAGGAGG + Intergenic
1017361916 6:153583359-153583381 ATGTCTGAAAAGAAACCAGGGGG + Intergenic
1017543815 6:155429748-155429770 TTGTCACAAAAGAAGACAGGAGG - Intronic
1018740600 6:166725686-166725708 GCATCTGAAGAGAAGGCAGGTGG - Intronic
1022888015 7:34666491-34666513 ATGTCTGAATTCAAGTCAGGGGG - Intronic
1026679232 7:72452734-72452756 TTATCAGAATAGAATCCAGGAGG + Intergenic
1029243922 7:99184770-99184792 TTGCCTGAAAAAAAGGAAGGGGG - Intronic
1030085487 7:105811951-105811973 TTGTCTGAAGACAAGGTATGGGG - Intronic
1031528603 7:122850576-122850598 TTGTCTGGAAAGAAGGGAGCTGG + Intronic
1032214885 7:129950293-129950315 TTGTCAGAAAGGAAGGAAGGTGG + Intronic
1037416824 8:18660174-18660196 GTGTCTTTATAGAAGGCAGACGG + Intronic
1038621190 8:29144581-29144603 CTGGCTGAATATAAGGTAGGAGG - Intronic
1038647742 8:29375025-29375047 TGTTCTGGATAGAAGGGAGGGGG + Intergenic
1040792444 8:51248382-51248404 TTGTCTTATTAGTAGGAAGGCGG + Intergenic
1045634029 8:104161969-104161991 TTCTCTGACTGGAAGGCAGAAGG - Intronic
1046353951 8:113054199-113054221 TTTTCTGAATAGAAGGAAAATGG - Intronic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1047682109 8:127264752-127264774 TTCTCTCAATAGAAGGTAAGTGG - Intergenic
1049558195 8:143294117-143294139 TGGCCTGCATAGGAGGCAGGAGG - Intronic
1054917878 9:70512395-70512417 CTGTCTTAATAGAAGACAGCTGG - Intergenic
1058097547 9:100880146-100880168 TTGTCTGAAATTAAGGCAAGGGG - Intergenic
1060023472 9:120151572-120151594 TTGTCTGGATTGCTGGCAGGTGG - Intergenic
1061369593 9:130191018-130191040 GTGTCTGAATAAAAGTCAGAGGG - Intronic
1061480561 9:130895953-130895975 TAGTCTGATGAGAGGGCAGGCGG + Intergenic
1062144148 9:134979400-134979422 TTGCCTGAATGGGAGGGAGGAGG + Intergenic
1187823582 X:23313245-23313267 TTGGCTTAATAGAAGACAGCTGG - Intergenic
1190762369 X:53447215-53447237 TTGTCTAAATAGCATGAAGGGGG + Intergenic
1192303606 X:69933746-69933768 TCGTCTGAATGGAAGGAAGGGGG - Intronic
1192505428 X:71678743-71678765 TTCTCTAAAAGGAAGGCAGGAGG - Intergenic
1196357585 X:114811708-114811730 TAGTCTGAAAAGAAGATAGGGGG + Intronic
1196641508 X:118068298-118068320 TTGTCTTTATGGAAGGGAGGAGG - Intronic
1197615256 X:128683515-128683537 TTTTCTGAAGAGAGGGCAGGTGG + Intergenic
1197884018 X:131199224-131199246 TGGTTTGAATGGAAGGCTGGGGG + Intergenic
1198158193 X:133983589-133983611 TTGGCTGATTCGAAGCCAGGAGG - Intronic
1198992176 X:142527150-142527172 TTTTTTTAATAAAAGGCAGGAGG - Intergenic
1201536674 Y:15056431-15056453 TTGTCTCAATTGAGAGCAGGTGG - Intergenic