ID: 1146558588

View in Genome Browser
Species Human (GRCh38)
Location 17:33848682-33848704
Sequence CATTCTAGGCAGTAGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146558581_1146558588 -8 Left 1146558581 17:33848667-33848689 CCCTGCTCCCCAAGGCATTCTAG 0: 1
1: 0
2: 0
3: 18
4: 342
Right 1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 134
1146558582_1146558588 -9 Left 1146558582 17:33848668-33848690 CCTGCTCCCCAAGGCATTCTAGG 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 134
1146558580_1146558588 -1 Left 1146558580 17:33848660-33848682 CCTAATTCCCTGCTCCCCAAGGC 0: 1
1: 0
2: 1
3: 21
4: 308
Right 1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG 0: 1
1: 0
2: 1
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146558588 Original CRISPR CATTCTAGGCAGTAGCTGGA TGG Intronic
901940301 1:12656764-12656786 CATACCAGGCAGTGGATGGATGG - Intronic
902607454 1:17576491-17576513 CATTCCACGCAGTAGCAGGAAGG + Intronic
902958226 1:19941601-19941623 CATTCTAGGCACTGGCGGGCTGG - Intergenic
904880476 1:33692836-33692858 CAGGCCAGGCACTAGCTGGATGG + Intronic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
906529253 1:46513850-46513872 CATTCCAGTGACTAGCTGGAGGG - Exonic
909634273 1:77798287-77798309 CATTCTTGGCTGTAGCAGCATGG + Intronic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920898741 1:210085011-210085033 CATTCTAGGCAGTGCCTGCATGG - Intronic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
923668909 1:236023182-236023204 CATTATTTGCAATAGCTGGAAGG + Intronic
1063633412 10:7756594-7756616 CAGTAGAGGCACTAGCTGGAAGG + Intronic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065267391 10:23991850-23991872 CATGATAGGAAGTAGCTGGTTGG + Intronic
1069370475 10:67742491-67742513 CATTCAAGGCAGTGTGTGGAGGG + Intergenic
1069530277 10:69213030-69213052 CATGCCAGGCAGTATCTGTAAGG + Intergenic
1072383061 10:94895323-94895345 CATTCAAGGCAGTATGTAGACGG + Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1074392732 10:113071591-113071613 CGTTCTGGGCAGCAGCTGTAGGG + Intronic
1078265347 11:9751937-9751959 CATTTTATTCAGTAGCTGGCAGG + Exonic
1080347067 11:31336856-31336878 CATTCTAGGTAGCAGAAGGAAGG - Intronic
1081101995 11:39013866-39013888 AATTCTAGGCAGCAACAGGATGG - Intergenic
1081969761 11:47189612-47189634 CATTCTAGGCAGGAGCTTCAGGG + Intergenic
1082135539 11:48545056-48545078 CATTCAAAGCAGTAGGTAGAGGG - Intergenic
1084381037 11:68812910-68812932 CATTCTAGACAGTAGCAGGCTGG - Intronic
1084564077 11:69919828-69919850 CACTCCAGGCAAGAGCTGGATGG - Intergenic
1084870174 11:72093390-72093412 CCATCCAGGCTGTAGCTGGAGGG - Intronic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1088155454 11:106797757-106797779 CATTCAAAGCAGTATGTGGAGGG + Intronic
1096238179 12:49943719-49943741 CATTGTGGGCACTAGCAGGAGGG - Intergenic
1100343859 12:93707928-93707950 CATTCTAGTCATTTGATGGATGG + Intronic
1104212155 12:126699203-126699225 CATTCCAGGTAGCAGCTGGTAGG + Intergenic
1106288857 13:28342289-28342311 CTTTGAAGGCTGTAGCTGGAAGG - Intronic
1111140244 13:84108157-84108179 CATTCTAAGCAGTCGTTGGAAGG + Intergenic
1111689514 13:91544877-91544899 CAGTCTTGGCTGGAGCTGGAGGG + Intronic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112883029 13:104133044-104133066 CATTCTGGGGAGTGGCTGGGAGG + Intergenic
1113397959 13:109966114-109966136 CATCCTAGGCTGCAACTGGATGG - Intergenic
1113871165 13:113560734-113560756 CAATGTAGGCAGAAGCTGGGAGG + Intergenic
1118590956 14:67400607-67400629 CACCCAAGGCTGTAGCTGGAAGG + Intronic
1126448447 15:48778194-48778216 TTTACTAGGCAGTAGCTTGAGGG + Intronic
1128671213 15:69576025-69576047 CCTTCTGGGAAGTAGATGGAGGG + Intergenic
1129650245 15:77481233-77481255 CCTTCTAGGGAGTAGCCAGATGG + Intronic
1131480131 15:92773580-92773602 CATACAAGGCAGAAGCTGGGTGG - Intronic
1134193549 16:12140700-12140722 CATTCTAAGCGGTAGCCCGAAGG + Intronic
1137011820 16:35328970-35328992 CATTCTAGACAGGAGCATGAAGG - Intergenic
1137018571 16:35399682-35399704 CATTCTAGACAGGAGCATGAAGG - Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1141898433 16:86973835-86973857 CATTCTAGGCACAAGCAGGCTGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144772045 17:17765325-17765347 CAGTCCAGGCAGGAGGTGGAGGG + Intronic
1145756988 17:27399617-27399639 CATTCTACACAGTAACTGGTTGG - Intergenic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1146585445 17:34078026-34078048 CATTCTGGACAGAAGCTGTAGGG - Intronic
1150603617 17:66672502-66672524 CATTCTTGGAAGTAGCTTAAAGG - Intronic
1155800381 18:30094194-30094216 CATTCTAAACACTAGATGGATGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1167582309 19:50352503-50352525 CATCCCTGGCAGTAGCTGCATGG - Intronic
929663162 2:43810151-43810173 CATTCTCAGCTGTAGCTGGGAGG + Intergenic
930329086 2:49959670-49959692 CAATCTATGCAGTAGTTGTAGGG + Intronic
930653148 2:53982580-53982602 AATTCTAGGCAGTGGGTGGAAGG - Intronic
931958240 2:67452163-67452185 CATACAAGGCAGTAGCTGAAGGG - Intergenic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
938389374 2:130892994-130893016 CATCCTAGGCAGTGGCTTGCAGG + Intronic
938982810 2:136542635-136542657 CGTTCTAGACAGCAGGTGGAAGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
942961001 2:181829697-181829719 CAATCTAGAGAATAGCTGGAGGG - Intergenic
943004324 2:182371081-182371103 CATCCAAAGCAGCAGCTGGATGG + Intronic
945659724 2:212671022-212671044 CATTATAGGCAGTGAATGGAAGG - Intergenic
948403432 2:237700938-237700960 AATTCTACACAGAAGCTGGAAGG - Intronic
948594928 2:239073790-239073812 CAGTCTAGTCAGTGGCAGGATGG + Intronic
1170047291 20:12098762-12098784 CATTGTCAGCAGCAGCTGGAAGG + Intergenic
1171020523 20:21580733-21580755 AATTCGGGGCAGTAGCTGAATGG - Intergenic
1174987773 20:55474677-55474699 CATTCTAGGAGGTTGATGGAGGG + Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1178201141 21:30406773-30406795 CATGCTGGCCAGTAGCTAGATGG - Intronic
1180905633 22:19409062-19409084 AATTCCAGGCAGCACCTGGAAGG - Intronic
1181559423 22:23691636-23691658 CATTCTAGTCAGAATCTGGGAGG - Exonic
1181712713 22:24700697-24700719 CATTCTAGTCAGAATCTGGGAGG - Intergenic
1181855343 22:25777531-25777553 CTCCCTAGGCAGTGGCTGGATGG + Intronic
1184218107 22:43080725-43080747 CATTCTCAGCCTTAGCTGGATGG + Intronic
950089215 3:10283513-10283535 CATCCTAGGCAGTAGAGCGAGGG + Intronic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
954793723 3:53150741-53150763 CTTTCCAGGCAGAAACTGGAGGG - Intergenic
956937246 3:74117085-74117107 CATTCTAGGCAGAAGGAGCAGGG - Intergenic
961685834 3:128630116-128630138 CATCCTGGGCAGCAGCAGGAAGG + Exonic
961865085 3:129948105-129948127 CTCTCTAGGGAGTATCTGGATGG + Intergenic
963194438 3:142510783-142510805 CATTCTTGGCAATAAGTGGATGG - Intronic
964838633 3:160969291-160969313 CAGCTTAGGAAGTAGCTGGAGGG + Intronic
967956077 3:194878410-194878432 GGTTGTAGGCAGAAGCTGGAAGG + Intergenic
970204553 4:13643108-13643130 GGTTCTAGGCAGTAAGTGGATGG - Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
977084055 4:92571873-92571895 CATTCAAGGCAGTGTGTGGAAGG + Intronic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
982200571 4:152956594-152956616 GATTCAAGGCAGTGCCTGGATGG - Intronic
985332601 4:188856302-188856324 CAAACTATGCAGTTGCTGGAGGG + Intergenic
988260771 5:28883543-28883565 CATGCAAGCCAGTATCTGGAGGG - Intergenic
989763517 5:45050068-45050090 CAATCATGGCAGAAGCTGGAGGG + Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
990469238 5:56098527-56098549 CAAGCTGGGCAGTAGCTAGAGGG - Intergenic
993296971 5:86153200-86153222 CAAACTAGGCAGGAACTGGAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995633537 5:114160155-114160177 CATTCTAAGCAGTATGTAGAGGG - Intergenic
1000156351 5:158555873-158555895 AATTCAAGGAATTAGCTGGATGG - Intergenic
1001117283 5:168950216-168950238 CATGTGAGGAAGTAGCTGGAAGG + Intronic
1002890545 6:1327805-1327827 CACTCTCAGCAGTAGCTGGCTGG - Intergenic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1009748274 6:67848218-67848240 CATTCCAGGCAATAGCTCAAAGG + Intergenic
1010163519 6:72888211-72888233 CATCCTAGGCAGTACAAGGAAGG + Intronic
1015986472 6:138889224-138889246 CATTCTATCCAGTAGCTGGCTGG - Intronic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1016381235 6:143483456-143483478 CATTCTGGGCAGAAGCTACAGGG + Intronic
1016979022 6:149837297-149837319 ATTGCTAGGCAGTGGCTGGAAGG - Intronic
1018478954 6:164170954-164170976 CATTCCAGGCTATCGCTGGAAGG - Intergenic
1020282963 7:6659860-6659882 CATACGAGGCAGAAGCTGTATGG + Intergenic
1021909231 7:25367760-25367782 CATTCCAGGCAGAAGCTTTAGGG - Intergenic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1026181768 7:68047882-68047904 CATTCTGGGCAGAACCTGGTAGG + Intergenic
1027950662 7:84810663-84810685 CATTCTAGGCTGTTGCTACAGGG + Intergenic
1028416686 7:90587947-90587969 CATTCTAGGTAGGGACTGGAAGG - Intronic
1029974859 7:104823401-104823423 CATACAATGCTGTAGCTGGAAGG - Intronic
1030531890 7:110721182-110721204 CATTCCAGGGACAAGCTGGAAGG + Intronic
1030651354 7:112119332-112119354 CAGTCCAGGCAGTAGGTGAAGGG + Intronic
1031712384 7:125065244-125065266 CATTTTAGCAAGAAGCTGGATGG - Intergenic
1041717962 8:60949202-60949224 TATTCTGGGAAGTAGCAGGAGGG + Intergenic
1044748699 8:95395790-95395812 CATCTTAAGCAGTAGTTGGATGG - Intergenic
1047058841 8:121198880-121198902 AATTCCAGGCAGTACCTGTATGG - Intergenic
1047356777 8:124129570-124129592 CATTCTAGGAAGCACCCGGATGG + Intergenic
1048558155 8:135502703-135502725 AATTCTAAGCAGCAGCTCGACGG - Intronic
1049299607 8:141862584-141862606 TGTTCTAGGAAGTATCTGGAAGG - Intergenic
1057577956 9:96259031-96259053 CAATCCTGGCACTAGCTGGATGG - Intronic
1058090698 9:100802390-100802412 CAGTCTAGACAGTAGTTTGAGGG + Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1187552646 X:20321638-20321660 CATTCTAGGCAGAAGGTACATGG + Intergenic
1188981803 X:36733512-36733534 CAGTCTAGGGAGAACCTGGAAGG - Intergenic
1189137703 X:38565878-38565900 CATTTTTGGCCATAGCTGGAGGG + Intronic
1189222197 X:39382092-39382114 CAATCAAGGGAATAGCTGGAGGG + Intergenic
1192069523 X:67922496-67922518 CATTCTCAGCAGTGGCTGCATGG + Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1196119294 X:112031300-112031322 CATTCAAGGCAGGGACTGGAGGG - Intronic
1199437821 X:147832689-147832711 CATTCCAGGCAGGAGATGGGAGG + Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic