ID: 1146559309

View in Genome Browser
Species Human (GRCh38)
Location 17:33854567-33854589
Sequence TCCCTACTTTGAGGGAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146559309_1146559318 -3 Left 1146559309 17:33854567-33854589 CCAGGATTCCCTCAAAGTAGGGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1146559318 17:33854587-33854609 GGAACTGTGGGTGGGGGAAGCGG 0: 1
1: 2
2: 14
3: 121
4: 1146
1146559309_1146559317 -9 Left 1146559309 17:33854567-33854589 CCAGGATTCCCTCAAAGTAGGGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1146559317 17:33854581-33854603 AAGTAGGGAACTGTGGGTGGGGG 0: 1
1: 0
2: 3
3: 27
4: 317
1146559309_1146559316 -10 Left 1146559309 17:33854567-33854589 CCAGGATTCCCTCAAAGTAGGGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1146559316 17:33854580-33854602 AAAGTAGGGAACTGTGGGTGGGG 0: 1
1: 0
2: 2
3: 28
4: 337
1146559309_1146559319 9 Left 1146559309 17:33854567-33854589 CCAGGATTCCCTCAAAGTAGGGA 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1146559319 17:33854599-33854621 GGGGGAAGCGGCTTCTTTACAGG 0: 1
1: 0
2: 1
3: 21
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146559309 Original CRISPR TCCCTACTTTGAGGGAATCC TGG (reversed) Intronic
900736767 1:4304077-4304099 TCCCTACTTTGAGGGACCTCAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902659508 1:17891412-17891434 TCTCTCCTTTGAGGGCATCCAGG - Intergenic
904490738 1:30857360-30857382 TCCCCATTTTGAGGAAAACCAGG - Intergenic
906689544 1:47783585-47783607 TGCCTACCTTGAGAGAAGCCAGG + Intronic
907092164 1:51735189-51735211 TCCATGCTTTGAGGCAATTCTGG + Intronic
907721633 1:56977645-56977667 TCCAGACCTTAAGGGAATCCAGG - Intergenic
908438168 1:64127351-64127373 TACCTACCTTGAGGGGTTCCTGG + Intronic
908774705 1:67628533-67628555 GCCTTCCTTTGAGGGAATCAAGG + Intergenic
909146785 1:71944418-71944440 TCCCTAAATTGAGGGAATAAAGG + Intronic
911954002 1:104213002-104213024 ACCCTAAGTTTAGGGAATCCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915585485 1:156841690-156841712 TCCCATCTTTGAGGGACTCGGGG + Exonic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
917154983 1:171986914-171986936 TACCTACTTTGAGAGAAATCAGG - Intronic
917424785 1:174902501-174902523 TCCCACCTTTCTGGGAATCCTGG + Intronic
918006218 1:180544265-180544287 TCCCTGCTGTGATGGACTCCTGG + Intergenic
918994503 1:191739418-191739440 TCCCTGCTTTTAGGTAATACTGG + Intergenic
921935852 1:220796378-220796400 TCCCTACCTGGAAGGAATGCAGG - Intronic
1068949917 10:62766552-62766574 TCCATGCTGTGAGGAAATCCAGG - Intergenic
1071107736 10:82117788-82117810 TCACTACTTTGAGGTGATCTAGG - Intronic
1075758543 10:124837004-124837026 TCTCTACTGTTAGGGAATCCAGG - Intergenic
1076028430 10:127137120-127137142 TCCTGACTTTGGGGGACTCCTGG + Exonic
1080729618 11:34936144-34936166 TCACTTCTTTGAGGGAGTCTGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081845658 11:46238725-46238747 TCCCTATTTTGCAGGAAACCCGG + Intergenic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088226039 11:107621337-107621359 TCCCAACTTTGAGGCAATCAAGG + Intronic
1090115338 11:123965866-123965888 TCCTTATTTTGAGGCTATCCAGG + Intergenic
1095525201 12:43117123-43117145 TTCCTTCTTTGAGGGGACCCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096892563 12:54786390-54786412 TCTCGGCTTTGAGGCAATCCTGG + Intergenic
1097085231 12:56462960-56462982 TTTCTAATTTGTGGGAATCCTGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097904710 12:64907884-64907906 TCTCTACTCTGAGTCAATCCTGG - Intergenic
1100294913 12:93252049-93252071 TCCCTCCTTTTTGGGGATCCAGG - Intergenic
1102270337 12:111529176-111529198 TCTCAACTTTGCAGGAATCCTGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106073317 13:26435135-26435157 TCCTTACTTTGGGCCAATCCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109091270 13:58049312-58049334 TCTGTACTTTGAGGCAATGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1111009297 13:82291204-82291226 TTCCTTCTTTGAGGGGACCCAGG - Intergenic
1117973828 14:61279443-61279465 TCCCAAATTTGAGGGAATATGGG + Exonic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121525895 14:94619091-94619113 TCCCTCCTATGAGGGACTCTGGG + Intronic
1126072715 15:44879847-44879869 TCCCTCTTTTGGGGGGATCCAGG - Intergenic
1130133254 15:81161007-81161029 TCCCTACTTGGAGGGAAGGAAGG - Intronic
1130984026 15:88833098-88833120 CCCATAATTTGATGGAATCCAGG + Intronic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1137960498 16:52877373-52877395 TCCCTGCTTGGTGGGATTCCTGG + Intergenic
1139663887 16:68442519-68442541 GTCCTCCTTTGAGGGACTCCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145844379 17:28025229-28025251 TGACTAGTTTGAGGGAACCCAGG - Intergenic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1146929302 17:36766432-36766454 CCCCTACGCTGAGGGAATCCAGG + Intergenic
1147992835 17:44345549-44345571 TCCCTGCTTTGGGGGAATGCTGG - Intronic
1148886129 17:50774316-50774338 GCCATTCCTTGAGGGAATCCTGG + Intergenic
1151463316 17:74268692-74268714 TCCGGAGTTTGAGGGAGTCCTGG - Intergenic
1152314987 17:79575009-79575031 TCCCAACTTTGAGTGCATACTGG + Intergenic
1153645680 18:7194137-7194159 TCCCTAGTGAGAGGGAAACCTGG + Intergenic
1154233682 18:12582449-12582471 TCCCTACTTTAGGGGAACCATGG + Intronic
1155132289 18:22950087-22950109 TCCTCACTTTGAGGGAGTCTAGG + Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1158184954 18:54760827-54760849 TCCCTTCCATGAGAGAATCCAGG - Intronic
1159070392 18:63616594-63616616 TCAGTACTCTGAGGGAACCCAGG - Intergenic
1159077792 18:63701056-63701078 GCTCTGCTTTCAGGGAATCCAGG + Intronic
1161209705 19:3060042-3060064 TTTCTACTTGGAGGAAATCCAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1166159883 19:40944542-40944564 TCCCTCCTGTGTGGGCATCCTGG + Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
925250962 2:2436859-2436881 TGACCACTTTGAGGGATTCCAGG + Intergenic
925912865 2:8584408-8584430 TCCCTGCTGTGAAGGAGTCCTGG - Intergenic
926447930 2:12967598-12967620 TCCCAATTTTGAGGAAATCTTGG - Intergenic
927482402 2:23464650-23464672 TCCCCTTTTTGAGGGCATCCAGG + Intronic
927690181 2:25202631-25202653 GCCCTTCTTTGAGGAATTCCGGG - Intergenic
928372260 2:30748695-30748717 TTTCCACTTTAAGGGAATCCTGG - Intronic
931021534 2:58049775-58049797 TACCTCCGTTGAGGGAATCTTGG + Intronic
936105159 2:109616393-109616415 TCCTTACTTTGCAGGCATCCAGG - Exonic
936288564 2:111200313-111200335 TCCCTGCTGTGAGGGAAACACGG - Intergenic
936531710 2:113280652-113280674 TCCCTGGTGGGAGGGAATCCTGG - Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938645166 2:133323138-133323160 TCCCTACTTTTAGGCAAACTTGG - Intronic
939021017 2:136958602-136958624 TCACTATTTTGAGGGAATTGGGG + Intronic
941648131 2:168064057-168064079 TCCCTGTTCTCAGGGAATCCCGG + Intronic
942117516 2:172742782-172742804 TCCCCAGTCTGAGGGAGTCCAGG - Intronic
943394050 2:187310655-187310677 TCCCGACTTTAAAGGAATCAGGG - Intergenic
944502266 2:200374331-200374353 GCACTACTTTGAGGCAATACTGG - Intronic
946115516 2:217458638-217458660 TCCCCACTTTGAGTGAGACCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948892160 2:240912800-240912822 CCCCTACTTTGCGGCTATCCAGG + Intergenic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169000346 20:2163701-2163723 TCCCTACTTGGAGGAAAACCAGG - Intronic
1169708700 20:8536922-8536944 TCCCTACCTTATGGGAATCTTGG - Intronic
1170294054 20:14805245-14805267 TACCTACTTTCAGGCAGTCCTGG + Intronic
1174122514 20:48276867-48276889 TCCCTACTGTGGGGGAGCCCAGG - Intergenic
1174979941 20:55382215-55382237 TCACTACATGGAGGGTATCCCGG + Intergenic
1176191030 20:63809708-63809730 TCCCAACGCTGAGGGAAGCCGGG + Intronic
1176369054 21:6051719-6051741 TCCCTGTTTTGAGGCACTCCAGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1179754465 21:43486822-43486844 TCCCTGTTTTGAGGCACTCCAGG + Intergenic
1182915530 22:34025964-34025986 TCCCTTCTTTGTGGGTGTCCTGG + Intergenic
1184225417 22:43126886-43126908 TCCCTACTTGGAGGGGATGCGGG - Intronic
949260511 3:2098874-2098896 TCCCTACTTGCAGCCAATCCTGG - Intronic
950191907 3:10982682-10982704 ACCCTACTTTGAGGGGCTCAAGG - Intergenic
950939652 3:16880352-16880374 TGGCTACCTTGAGGGAATCTTGG - Intronic
954369403 3:50162338-50162360 CCCCTAATCTGAGGGAACCCTGG - Intronic
954910596 3:54104146-54104168 CCCCTACTTTAAAGGACTCCAGG - Intergenic
958451369 3:94277489-94277511 CCCTTACTTAGAGGAAATCCAGG + Intergenic
958968437 3:100585204-100585226 TCCCTCTTTTGGGGGGATCCAGG - Intergenic
959843617 3:111006940-111006962 TCCTTACTTTGAAAGAGTCCTGG - Intergenic
960777167 3:121269737-121269759 TCCCTACTTTGAGACATTTCAGG - Intronic
962090758 3:132241916-132241938 TCCCTCCTGATAGGGAATCCTGG - Intronic
962144298 3:132823715-132823737 GCTCTGCTTTGGGGGAATCCAGG + Intergenic
962304216 3:134271435-134271457 TCCTTGCTTTGAGGAAATACAGG - Intergenic
963599856 3:147369469-147369491 TCCCTACGTTCAGCGAATACAGG + Intergenic
964985163 3:162729048-162729070 TCCTTACTTTGAGGTAATAAGGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966107450 3:176353838-176353860 TCCTGACTTTGAGGGAAGACAGG + Intergenic
966150106 3:176858588-176858610 TCCCTGCTTCTAGGGTATCCTGG + Intergenic
967933414 3:194707127-194707149 CCCCTACTTTGGGGGTATCTTGG + Intergenic
968223870 3:196960042-196960064 TCCCCACTTTGTGGGAATGGAGG + Intronic
975412531 4:74070656-74070678 TCCCCTCTTTTTGGGAATCCAGG - Intergenic
977210163 4:94208937-94208959 TCAATATTTTGAGGGAATACTGG - Intronic
977321572 4:95523009-95523031 GCTCTTCTTTTAGGGAATCCAGG - Intronic
977527201 4:98159780-98159802 TCCCTCCTTTTGGGGTATCCAGG + Intergenic
978724655 4:111956058-111956080 TTCCTGCTTTAAGGGAAACCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982746859 4:159113075-159113097 TCAATACTTTCAGGGAATACTGG - Intronic
988447096 5:31299616-31299638 TTCCTACTCTGGGGGAATCGGGG - Exonic
989712948 5:44423206-44423228 TCCCTACTTGGAGGTCATCAGGG - Intergenic
991089628 5:62681594-62681616 TACCTACTGTGAGGGAGACCTGG + Intergenic
995623053 5:114048948-114048970 ACTCTACTTTGAAGGAATCAGGG + Intergenic
997414335 5:133713521-133713543 ATCCTACTTTTTGGGAATCCTGG - Intergenic
1002190607 5:177475528-177475550 TCCCTATTTTCAGGGAAGCAAGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006739483 6:36297161-36297183 TTCCTACTTGGAGTGATTCCAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1012201106 6:96406909-96406931 TCCCTTCTTTGGGGGGATCCAGG + Intergenic
1013381142 6:109572312-109572334 CCCCTACTTGCAGGGAATCTGGG - Intronic
1018236343 6:161727565-161727587 ACCATACATTGAGCGAATCCAGG - Intronic
1019059848 6:169249104-169249126 TCCCTTTTTTATGGGAATCCTGG + Intronic
1019298290 7:290422-290444 TCCCTACTTTGGGGAGAGCCAGG + Intergenic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023074823 7:36472378-36472400 CTTCCACTTTGAGGGAATCCGGG + Intergenic
1026261899 7:68762567-68762589 TGCCTAGTTTGAGGAAATCCAGG - Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027200961 7:76063646-76063668 GCCCTGCTTTGAGGTGATCCCGG + Intronic
1028108985 7:86916162-86916184 TCCCTACTCTCAGGGATGCCTGG + Intronic
1030201085 7:106905231-106905253 TCCCCACTGTGAGGGCATCCCGG - Exonic
1031829913 7:126613875-126613897 CACCCAGTTTGAGGGAATCCGGG - Intronic
1037652654 8:20852977-20852999 TCCCTTCTTTCTGGGAGTCCAGG - Intergenic
1038958325 8:32491112-32491134 TCCCTACCTTGCAGAAATCCTGG + Intronic
1041738968 8:61139067-61139089 CGCCTCCTTTGAGGGCATCCTGG - Intronic
1042636055 8:70876552-70876574 TCTCTACTTTGAAGAAATCTGGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044198394 8:89405124-89405146 TCCCTTCTTTTGGGGGATCCAGG + Intergenic
1044261366 8:90126863-90126885 TCCATACTTTCAGGGACTTCAGG + Intergenic
1045970042 8:108069747-108069769 TGTCTACTCTGTGGGAATCCTGG - Intronic
1049251118 8:141589526-141589548 TCCTTACCTTGAGGGACTCTGGG - Intergenic
1049271511 8:141698624-141698646 TCCCAAGTCTGAGGGACTCCAGG - Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055777593 9:79782738-79782760 GCCCTACTTTTAGGGAACTCAGG + Intergenic
1055923147 9:81482827-81482849 TCCTTACTTTCCGGGAATCTTGG + Intergenic
1057781177 9:98051753-98051775 TCCCTTCTTTTTGGGGATCCAGG - Intergenic
1058131473 9:101258720-101258742 TCCCTTCTTTGAGGCAGCCCTGG + Intronic
1058148622 9:101439703-101439725 TCCCTACTTTCAGTAAATTCTGG + Intergenic
1060184724 9:121557435-121557457 TCCCTACCTCCAGGCAATCCTGG - Intergenic
1060306777 9:122420847-122420869 TCCCTCCTTTTTGGGGATCCAGG - Intergenic
1061033428 9:128100457-128100479 TCCCTGCTCTCAGGGAAGCCAGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186856747 X:13634382-13634404 TCCCTAGTGTGAGAGAATCTGGG + Intergenic
1187309248 X:18125212-18125234 TCCTTGCTTTGAGTCAATCCAGG + Intergenic
1190477990 X:50847246-50847268 TCCCTCCTTTTTGGGGATCCAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191213914 X:57916230-57916252 TACAAACTTTGAGGGAATACTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197245604 X:124163519-124163541 ACCCTACTTTGACTGAATCAAGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic