ID: 1146559340

View in Genome Browser
Species Human (GRCh38)
Location 17:33854779-33854801
Sequence GGCAGATGACAAATGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 1, 2: 5, 3: 65, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146559340_1146559348 0 Left 1146559340 17:33854779-33854801 CCAGCTCCCATTTGTCATCTGCC 0: 1
1: 1
2: 5
3: 65
4: 357
Right 1146559348 17:33854802-33854824 CTGGGATGAACTTTCCTTGTGGG 0: 1
1: 1
2: 2
3: 15
4: 140
1146559340_1146559351 18 Left 1146559340 17:33854779-33854801 CCAGCTCCCATTTGTCATCTGCC 0: 1
1: 1
2: 5
3: 65
4: 357
Right 1146559351 17:33854820-33854842 GTGGGATTGTCCTTCCCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 163
1146559340_1146559352 21 Left 1146559340 17:33854779-33854801 CCAGCTCCCATTTGTCATCTGCC 0: 1
1: 1
2: 5
3: 65
4: 357
Right 1146559352 17:33854823-33854845 GGATTGTCCTTCCCTGTGGGTGG 0: 1
1: 0
2: 1
3: 14
4: 162
1146559340_1146559347 -1 Left 1146559340 17:33854779-33854801 CCAGCTCCCATTTGTCATCTGCC 0: 1
1: 1
2: 5
3: 65
4: 357
Right 1146559347 17:33854801-33854823 CCTGGGATGAACTTTCCTTGTGG 0: 1
1: 1
2: 0
3: 17
4: 152
1146559340_1146559350 17 Left 1146559340 17:33854779-33854801 CCAGCTCCCATTTGTCATCTGCC 0: 1
1: 1
2: 5
3: 65
4: 357
Right 1146559350 17:33854819-33854841 TGTGGGATTGTCCTTCCCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146559340 Original CRISPR GGCAGATGACAAATGGGAGC TGG (reversed) Intronic
901259734 1:7862583-7862605 GGCAGAAGGCAAGGGGGAGCTGG + Intergenic
902537918 1:17132080-17132102 GGCAGAAGGCGAATGGGAGCGGG - Intergenic
902689547 1:18101668-18101690 GGCAGATGAGTAATGGTAGGTGG - Intergenic
903919300 1:26788073-26788095 GGAAGCTGTCAAATGGAAGCCGG + Intronic
904336346 1:29800667-29800689 GCCAGATGAGAAAAGGCAGCTGG - Intergenic
904921841 1:34014064-34014086 GGCAGATTAGAAGTGGGTGCTGG - Intronic
904926925 1:34056846-34056868 GGCAGCTGAGAAAGGGGACCTGG + Intronic
905314377 1:37072302-37072324 GTGAGATGACACATGGGAGAGGG - Intergenic
905560452 1:38922727-38922749 GGCAGAAGATAAACGTGAGCGGG - Intronic
905900680 1:41580405-41580427 GGCAGATGAAAAACTTGAGCTGG - Exonic
906567305 1:46810540-46810562 GGCAGGTGCTAAATGGAAGCAGG + Intronic
906749615 1:48247299-48247321 GCCAGAAGACAAAGGAGAGCAGG - Intronic
907726275 1:57023656-57023678 GGCAGAGGACACATGAGACCTGG + Intronic
908948880 1:69535526-69535548 GGCAAAGGGCAAAGGGGAGCTGG + Intergenic
909020466 1:70425663-70425685 GGCAGAAGGCAAAGGGGAGCAGG + Intronic
910002122 1:82353818-82353840 GGCAGAAGGCTAATGGAAGCTGG + Intergenic
911173631 1:94796474-94796496 GGCAGGTGACTAAGAGGAGCTGG - Intergenic
911625535 1:100119753-100119775 GGCTGAAGGCAAAGGGGAGCAGG - Intronic
912685800 1:111763269-111763291 GGCACATGAAAAATGAGAGCTGG + Intronic
917947357 1:179988582-179988604 GCCAGAACACAAATGGGAACAGG - Intronic
918046144 1:180942074-180942096 GGCATAGGAGAAATGGGAGCGGG - Intronic
918157935 1:181868451-181868473 GGTGGAAGACAAAAGGGAGCTGG + Intergenic
918361186 1:183759676-183759698 GACAGTTGACAAACTGGAGCTGG - Intronic
919420690 1:197366643-197366665 GGAAGATGACAAATGAAAACAGG + Intronic
919794156 1:201311156-201311178 GGCAGATGACAACATGGAGGGGG - Intronic
922238295 1:223737591-223737613 GGCAGATGAGAGATGGGAGTGGG + Intronic
922331368 1:224579805-224579827 GGCAAATGGCAAACAGGAGCTGG - Intronic
922348323 1:224715645-224715667 GGCAGAAGGCAAATGGAAGCAGG + Intronic
922595703 1:226811112-226811134 GGTGGAAGGCAAATGGGAGCAGG - Intergenic
922987202 1:229874961-229874983 GGGAGAGGAAAAATGGGGGCAGG + Intergenic
923188703 1:231598908-231598930 GGCAGAAGGCGAAGGGGAGCAGG + Intronic
923213004 1:231822799-231822821 GGCAGAAGATGAAGGGGAGCTGG + Intronic
923370528 1:233307421-233307443 GACAGAAAGCAAATGGGAGCTGG - Intergenic
923618623 1:235558636-235558658 GGCAGATGTTTAATGGGATCTGG - Intronic
923742943 1:236672589-236672611 GGCAGAGGATAAGAGGGAGCTGG - Intergenic
1063078926 10:2746398-2746420 GGCAGAAGCCAAATGAGTGCTGG - Intergenic
1063479993 10:6367108-6367130 GGCAGAAGGCAAAGGGAAGCAGG + Intergenic
1064184278 10:13147222-13147244 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1065700787 10:28423604-28423626 GGCAGATGCCAGATTGGAGTGGG - Intergenic
1065867404 10:29925998-29926020 GGCAGAAGGCAGAGGGGAGCAGG + Intergenic
1066005593 10:31143714-31143736 GGCAGAAGAGAAAGGGGAGCTGG - Intergenic
1067012696 10:42729245-42729267 GGGAGATCACAAAACGGAGCAGG + Intergenic
1067739722 10:48886034-48886056 GGCAGATGATAAATGGGAGCAGG + Intronic
1069829130 10:71271929-71271951 TACCGATGACAAATGGGGGCTGG - Intronic
1070812263 10:79304407-79304429 GGCAGATGGCAGATGCCAGCTGG + Intronic
1071008308 10:80909409-80909431 GGCAGAAGGCAGAGGGGAGCTGG + Intergenic
1073626519 10:105103247-105103269 GGTAGATGATAAATGGTGGCTGG - Intronic
1073766134 10:106684928-106684950 GGAAAATGACAAAGGGAAGCAGG - Intronic
1074289317 10:112126581-112126603 GGCACATGACAGAGGGGACCCGG - Intergenic
1074609901 10:115011619-115011641 GGTAGAAGGCAAAGGGGAGCAGG + Intergenic
1074620228 10:115111487-115111509 GGCAGAAGGCAAATGGGAGCTGG + Intronic
1075741955 10:124701455-124701477 GGCTGAAGACCAAAGGGAGCTGG - Intronic
1076189027 10:128469954-128469976 GGCAGAAAAGAAAGGGGAGCAGG - Intergenic
1076273891 10:129179983-129180005 GGCAAAAGAGAAATTGGAGCAGG + Intergenic
1076572377 10:131441168-131441190 GGTAGATGGCAACAGGGAGCAGG - Intergenic
1079358426 11:19749844-19749866 CGCAGATGACAAACGGCACCAGG - Intronic
1080441443 11:32298571-32298593 GGTAGATGGCAAAGGGTAGCAGG + Intergenic
1081686866 11:45049007-45049029 GGCAGATGGCCATTGGGACCAGG + Intergenic
1081918964 11:46754935-46754957 GGCAGATGAGAAATTGGAGAAGG - Exonic
1083312081 11:61789040-61789062 GGCAGATGAGAAATGGGAAAGGG + Exonic
1083730291 11:64649085-64649107 GGCAGATGGCAAAGTGGAGAAGG - Intronic
1083937746 11:65879225-65879247 GGCAGATGCCCAATGGGCACAGG + Intergenic
1083967386 11:66051127-66051149 GGCAGTTGGCAAAATGGAGCTGG + Intronic
1085531981 11:77197329-77197351 GGCTGCAGACAGATGGGAGCAGG + Intronic
1085712349 11:78841612-78841634 GGGAGATGACTAATGGAAGAAGG - Intronic
1086476093 11:87176306-87176328 GACAGAAGGCAAAGGGGAGCCGG - Intronic
1086580946 11:88397619-88397641 GGCAGAAGGCAAAGGAGAGCAGG - Intergenic
1087409319 11:97770724-97770746 GGCAGAAGGCTAAGGGGAGCTGG + Intergenic
1087448023 11:98279905-98279927 TGAAGATGAAGAATGGGAGCAGG - Intergenic
1088657415 11:112013909-112013931 GGCAGAAGGCAAATGGGAGTTGG + Intronic
1089679546 11:120111617-120111639 GGCAAATGGTAAATGGTAGCTGG + Exonic
1089782414 11:120882929-120882951 GCCAGGTGAGAAATGGGAGTGGG - Intronic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1090900595 11:131027327-131027349 GGGAGATGACAAGTGGGACTTGG - Intergenic
1091648133 12:2289214-2289236 GGCACATGCCAAAAAGGAGCAGG + Intronic
1091677274 12:2500522-2500544 GGCAGATGGCGAGTGGGAGTTGG - Intronic
1093306673 12:17528668-17528690 GGCAAAAGACAAAGGGGAGCTGG - Intergenic
1093502578 12:19828877-19828899 GCAAGACTACAAATGGGAGCAGG + Intergenic
1094001836 12:25703728-25703750 GGTAGAAGGCAAAAGGGAGCAGG + Intergenic
1094280383 12:28730745-28730767 TGCAGATGTAAAAAGGGAGCTGG + Intergenic
1094671571 12:32575337-32575359 GGCAGAAGATAAAGGGTAGCTGG + Intronic
1094775292 12:33719743-33719765 AGCCGAGGAGAAATGGGAGCTGG - Intergenic
1095159994 12:38905262-38905284 GTCAGGTGACACAGGGGAGCGGG - Intronic
1095313435 12:40728578-40728600 GGCAGATGAGAAGTGGGATTTGG + Intronic
1096022521 12:48333963-48333985 GGCAGAAGATAAACGTGAGCGGG + Intergenic
1097075100 12:56387180-56387202 GGTAGAAGGCAAAAGGGAGCAGG + Intergenic
1097354569 12:58586888-58586910 AGCAGAAGGCAAAAGGGAGCTGG - Intronic
1097735737 12:63179110-63179132 GGGAGATGACAAACGGTATCTGG + Intergenic
1098783919 12:74724561-74724583 GTCAGATGAAAAATGGTAGAAGG + Intergenic
1100067671 12:90669708-90669730 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1100122779 12:91388223-91388245 GGGAGATGACAACTGGAAGAAGG + Intergenic
1100216334 12:92452990-92453012 GGCAGATGAAAAATGATAACAGG + Intergenic
1101295960 12:103424176-103424198 GGCATGTGACAAATGGGAAGAGG - Intronic
1101306012 12:103528629-103528651 GGCAGAAGGCGAAGGGGAGCTGG - Intergenic
1101362765 12:104043344-104043366 TGCAGATGCCAAATGGCATCTGG - Intronic
1101635679 12:106539530-106539552 GGCATATCTCAAATGGCAGCAGG + Intronic
1102402040 12:112638204-112638226 GGTAGAAGGCAAAGGGGAGCTGG - Intronic
1104362206 12:128144538-128144560 CACACATGAGAAATGGGAGCCGG + Intergenic
1106062531 13:26308788-26308810 GGCAGAAGCCAAATTGGAGTGGG - Intronic
1106143913 13:27035109-27035131 GGCAGAATGCAAATGGCAGCGGG + Intergenic
1106353807 13:28959591-28959613 GGCAGAAGATGAAGGGGAGCTGG + Intronic
1107744596 13:43491118-43491140 GGTGGAAGGCAAATGGGAGCAGG + Intronic
1108027712 13:46195865-46195887 GGCGGAAGGCAAAGGGGAGCTGG - Intronic
1108196956 13:48004439-48004461 GGCAGAGGGTGAATGGGAGCTGG - Intergenic
1108898012 13:55359515-55359537 GGCAGAAAGCAAAGGGGAGCTGG - Intergenic
1109008954 13:56914779-56914801 GGTAGAAGGCAAATGGGAGTTGG + Intergenic
1109529084 13:63616908-63616930 GGTAGTTGACAAATGAAAGCCGG + Intergenic
1110360713 13:74621604-74621626 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1110802035 13:79709372-79709394 GGCAGATGGCAAATTGGAAGAGG - Intergenic
1111217604 13:85164373-85164395 GGCAGAGAGCATATGGGAGCAGG + Intergenic
1111224039 13:85245795-85245817 TGCAGATAACAAATGGGTGGTGG + Intergenic
1111283916 13:86063815-86063837 GGCAGAAGGCAAAGAGGAGCAGG + Intergenic
1112317313 13:98374825-98374847 GGTAGAAGGCAAAGGGGAGCTGG + Intronic
1112553504 13:100445070-100445092 GGTAGAAGGCAAAGGGGAGCTGG + Intronic
1112976673 13:105328182-105328204 GGAAGTTGACAAAGGTGAGCTGG - Intergenic
1113779077 13:112965709-112965731 CGGAGGTGAGAAATGGGAGCTGG - Intronic
1114611436 14:24043907-24043929 AGCAGAAGGCAAAAGGGAGCAGG + Intergenic
1115472517 14:33783132-33783154 GGCAGATGACAAATGCATGGAGG - Intronic
1116154646 14:41187659-41187681 GGCACTTGACAAATGGGAACTGG + Intergenic
1116615869 14:47137555-47137577 GGCAAAAGGCAAAGGGGAGCTGG - Intronic
1119581210 14:75783231-75783253 AACAGATGACAAATGGGTGTTGG - Exonic
1120286034 14:82503181-82503203 TGAAGATGAAAAATGTGAGCAGG - Intergenic
1120658686 14:87227521-87227543 GACAGAAGGCAAAGGGGAGCTGG + Intergenic
1121843717 14:97155412-97155434 GGGAGGAGACAAATGGGAGAAGG - Intergenic
1122316445 14:100828350-100828372 GGGAGAGGAGAAATGGGAGGTGG - Intergenic
1123127906 14:105962526-105962548 GGCATGTGACACATGGCAGCAGG - Intergenic
1123161680 14:106284611-106284633 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123177413 14:106434065-106434087 GGCAGAAGACAAAGAGGAGCAGG - Intergenic
1123213957 14:106788780-106788802 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123400861 15:19984316-19984338 GGCAGAAGACAAAGGGGAGCAGG - Intergenic
1123408422 15:20038669-20038691 GGCATGTGACACATGGCAGCAGG - Intergenic
1123517746 15:21045310-21045332 GGCATGTGACACATGGCAGCAGG - Intergenic
1123727822 15:23122348-23122370 CGAAGATGACAAATGGAAGGGGG - Intergenic
1123730435 15:23139526-23139548 CGAAGATGACAAATGGAAGGGGG + Intergenic
1123748573 15:23336944-23336966 CGAAGATGACAAATGGAAGGGGG + Intergenic
1124165146 15:27319657-27319679 GGCAGAGCACAAATGGGATGGGG + Intronic
1126343545 15:47669499-47669521 AGCAGATGGCCAAGGGGAGCAGG - Intronic
1126511627 15:49481895-49481917 GGCAAATGACAAATATTAGCTGG + Intronic
1126715668 15:51514612-51514634 GGGAGGTGACAGATGGGAGATGG - Intronic
1126790997 15:52221026-52221048 GGCAGGTAACAAATGTGAGAAGG - Intronic
1127043299 15:55000872-55000894 GGCAGAAGTCAAGAGGGAGCAGG + Intergenic
1128046080 15:64618709-64618731 AGCACATGACAAATGCCAGCAGG - Intronic
1129071088 15:72952243-72952265 GGCAGATGCCAAGTGGGAGAAGG + Intergenic
1129669128 15:77597428-77597450 TGCAGATGACAGAGGGAAGCAGG + Intergenic
1130385502 15:83407640-83407662 GGAAGAGGAGAAAAGGGAGCAGG - Intergenic
1130509361 15:84575644-84575666 CGAAGAGGACAAATGGGAGGGGG + Intergenic
1130726694 15:86446277-86446299 AGCAGGTGAGGAATGGGAGCTGG + Intronic
1133805690 16:9124589-9124611 TGCAGGTGACATCTGGGAGCAGG - Intergenic
1135960171 16:26988411-26988433 GGCAGGTGAGAAATGGCAGGGGG + Intergenic
1136011402 16:27365684-27365706 AGCCAATGACAGATGGGAGCTGG - Intergenic
1136063946 16:27746434-27746456 GGCAGATGAGAAGTGGGGGAGGG + Intronic
1138204649 16:55115664-55115686 GGCAGATGAGAAAGGGAAGTGGG + Intergenic
1138530457 16:57631672-57631694 GGCAGATGGCAAATGGGGGGCGG + Intronic
1141224604 16:82102952-82102974 GGAAGATTACTAATGGGAACTGG + Intergenic
1141340433 16:83199068-83199090 GGCAGCTTACAAATGGGCCCGGG + Intronic
1142631882 17:1230498-1230520 GGAGGACGAGAAATGGGAGCTGG + Intergenic
1143096476 17:4481020-4481042 GGCAGATGCCAGCTTGGAGCAGG + Intronic
1144262490 17:13536129-13536151 GGGAGATGACAAATGAGAATGGG - Intronic
1145113814 17:20189488-20189510 TGGAGATGACTAATGGCAGCTGG + Intronic
1146559340 17:33854779-33854801 GGCAGATGACAAATGGGAGCTGG - Intronic
1147258242 17:39194768-39194790 GGCAGGTGACAAATGGCACAGGG + Intronic
1148977891 17:51545536-51545558 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1150104614 17:62453189-62453211 GGCAGAGAATAAAAGGGAGCAGG - Intergenic
1150305930 17:64085325-64085347 GGCAGAAGGCAAAGGGGAACCGG + Intronic
1153328898 18:3851906-3851928 GGAGGATGTCAAATGGGAACTGG + Intronic
1153951988 18:10065207-10065229 GGTGGAAGACAAAGGGGAGCTGG - Intergenic
1155092352 18:22524183-22524205 GGAAGATGAAAAATGGGCGGAGG + Intergenic
1155116510 18:22773603-22773625 GGCAGAAGACAAAGGGGAGTGGG - Intergenic
1155329965 18:24705106-24705128 GGCAGATGATGGAGGGGAGCAGG + Intergenic
1156011653 18:32503594-32503616 AGCAGATGCCAGATGGGAGTTGG - Intergenic
1157231484 18:45920561-45920583 GGCAGAAGGCCAACGGGAGCTGG + Intronic
1159734329 18:72075322-72075344 GGCAGCTGCCAAAAGGAAGCTGG + Intergenic
1160072665 18:75642302-75642324 GGCACATGGCAGGTGGGAGCTGG + Intergenic
1160596587 18:79979548-79979570 GGCAGAAGGCAAAGGGGAACAGG - Intronic
1161384074 19:3981819-3981841 GGCAGATGCGAGATGGGAGGAGG - Intronic
1162359673 19:10211155-10211177 GGCACATGACAACTGTCAGCTGG - Intronic
1164497970 19:28786011-28786033 GGCAGATGGCAAAAGGGAACAGG + Intergenic
1164530357 19:29043796-29043818 GGCAGAAGGCAGAGGGGAGCAGG + Intergenic
1164884550 19:31767402-31767424 GGCAGCTGGCAGCTGGGAGCTGG + Intergenic
1165216787 19:34280080-34280102 GGCAGAAGGCAAAGCGGAGCAGG + Intronic
1165817807 19:38653102-38653124 ATCAGATGACAGAGGGGAGCGGG + Intronic
1166748637 19:45154034-45154056 GGCAGAGGAGAGATGGGAGGAGG + Intronic
1167298027 19:48663291-48663313 GGCAGAAGACAAATGGGGAGGGG - Intronic
1168648044 19:58073888-58073910 GGCGGAAGGCAAAGGGGAGCTGG - Intronic
925485735 2:4328279-4328301 GGCAGAAGGTAAAGGGGAGCTGG + Intergenic
925774776 2:7324293-7324315 GGCAAATGGGAAATGGGAACCGG + Intergenic
925924081 2:8658199-8658221 GGCAGAGAACAGATGGGACCTGG + Intergenic
926050534 2:9741609-9741631 GGCAGAAGGCAAAGGGAAGCCGG - Intergenic
926162174 2:10496708-10496730 GGCAGATGACAAAGGTGGGTGGG - Intergenic
926589776 2:14728242-14728264 GGCAGAAGGTAAAGGGGAGCTGG - Intergenic
931684802 2:64784197-64784219 GTCAGATGACAAAAGGCAGTAGG + Intergenic
932880227 2:75494495-75494517 GGCAGCTCACACATGGCAGCTGG - Intronic
933078678 2:77961099-77961121 TGCAGATGGGAAATTGGAGCAGG - Intergenic
933646553 2:84817764-84817786 AGCAGAAGACAAAAGGGAGCTGG + Intronic
935471437 2:103465166-103465188 GGCAGAAGGCAAAGGTGAGCTGG - Intergenic
935873929 2:107485742-107485764 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
936415201 2:112301390-112301412 GTCAGATAACAAATGGGGGAAGG + Intronic
936521257 2:113213283-113213305 GGGAGAGGACAAAGGGGAGAGGG + Intergenic
936734095 2:115419375-115419397 GGCAGAAGGAAAAGGGGAGCAGG + Intronic
937093210 2:119220361-119220383 GCCAGCTGACAAAGGGGTGCTGG - Intergenic
938161679 2:128989900-128989922 GGCACATGTCATTTGGGAGCTGG + Intergenic
939164649 2:138627400-138627422 AGCCAATGACAGATGGGAGCTGG + Intergenic
941012819 2:160320674-160320696 GGCAGAAGGCAAAGGGGAGAAGG - Intronic
941788867 2:169528753-169528775 GAAAGATGACAAATGGGAAATGG - Intergenic
942254779 2:174085920-174085942 AGCAGATGACAAATGGGGACAGG - Intronic
942432241 2:175924806-175924828 GGCAGAAAGCAAAGGGGAGCTGG + Exonic
943705295 2:191027611-191027633 GGCAGAAGGCAAAGGGAAGCCGG - Intergenic
943769569 2:191701899-191701921 GGCAGAAAACAAAGGGGAGCTGG - Intergenic
946035933 2:216742227-216742249 GACAAATGTTAAATGGGAGCGGG - Intergenic
948051529 2:234982700-234982722 GGCAGTGGGCAAATGGGAGGAGG + Intronic
948175504 2:235939610-235939632 GGCTGATGACACATGGGAGAGGG - Intronic
948637508 2:239349024-239349046 GTCACATGACAAATGTGAGAGGG + Intronic
1169668239 20:8064191-8064213 GGCAGAGGGCAGAAGGGAGCTGG + Intergenic
1169885148 20:10390551-10390573 GGCAGAAGGCAAAGGGAAGCTGG + Intergenic
1170339437 20:15306959-15306981 GGCAGAAGGCAGAGGGGAGCAGG + Intronic
1170924562 20:20711825-20711847 GACAGATGACAAATCTGTGCTGG + Intronic
1170988413 20:21279775-21279797 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1171086212 20:22240329-22240351 GGCAGAGGGAGAATGGGAGCTGG - Intergenic
1173678627 20:44860245-44860267 GGCAGAGGGCAAAGGGGAGCTGG - Intergenic
1175019459 20:55828881-55828903 GTCACATGGCAAGTGGGAGCAGG + Intergenic
1175540830 20:59746631-59746653 GGCAGATGACAAACAGGCACTGG - Intronic
1175640118 20:60622038-60622060 GGAAGCTGAGAAATGGCAGCTGG + Intergenic
1176385458 21:6136789-6136811 GGCAGCTGAGAACTGGAAGCGGG - Intergenic
1177109026 21:17001289-17001311 GACACATGAAAAATGGGGGCAGG - Intergenic
1178179112 21:30139469-30139491 TGCAGATGGCAATTGTGAGCTGG + Intergenic
1179389082 21:40970889-40970911 GGCAGAAGGCAAAGGGCAGCTGG - Intergenic
1179738015 21:43401463-43401485 GGCAGCTGAGAACTGGAAGCGGG + Intergenic
1181076117 22:20378122-20378144 GGCAGAAGACAGCTGGCAGCTGG + Intronic
1181603490 22:23966297-23966319 GGCAGATGTCAATGGGGACCAGG + Intergenic
1181605023 22:23975010-23975032 GGCAGATGTCAATGGGGACCAGG - Intronic
1182206234 22:28630138-28630160 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1183377674 22:37474473-37474495 GGCAGGTGGCAAATGGGAAGGGG - Intronic
1183613946 22:38930520-38930542 GGTAGAAGGCAAAGGGGAGCAGG + Intergenic
1184147906 22:42622370-42622392 GGCAGAGGACTAATGGGAGCAGG - Intronic
1184548841 22:45192952-45192974 TGCAGATGACCCCTGGGAGCCGG - Intronic
949253714 3:2019721-2019743 GTCAGAAGGCAAAGGGGAGCTGG - Intergenic
949282758 3:2365652-2365674 GGCAGATGGCAACTTGGAGAAGG - Intronic
949768010 3:7548327-7548349 GGCAGAAGGCAAAGCGGAGCTGG - Intronic
950309155 3:11940802-11940824 AGCAAATGACAAATGAGAGAAGG + Intergenic
950702823 3:14761813-14761835 GGCAGGGGAGAGATGGGAGCAGG + Intronic
951229804 3:20165153-20165175 GGTAGAAGGCAAAGGGGAGCTGG + Intronic
951650744 3:24948830-24948852 GGCAGAAAGCAAAAGGGAGCAGG - Intergenic
953186776 3:40645101-40645123 GGAAGATGAGAAATTTGAGCAGG + Intergenic
953649052 3:44783303-44783325 GGCAGAAGACAAAGGGGAATGGG + Intronic
953693403 3:45138978-45139000 GGCAGAGGGCAAAGGGGATCTGG + Intronic
955032442 3:55233960-55233982 GGCTGTTGACAAATGGTAGCAGG + Intergenic
955136580 3:56224978-56225000 GGTATATGAGGAATGGGAGCAGG - Intronic
955385852 3:58479257-58479279 GGCAGAAGGCAAAAGGGAGCTGG + Intergenic
956233913 3:67045108-67045130 GGCAGAAGACGGAAGGGAGCAGG + Intergenic
956482779 3:69689527-69689549 GGCAGAAGGCAAAGGAGAGCTGG + Intergenic
957455482 3:80438137-80438159 GGCAGAATACAAGTGGGACCGGG - Intergenic
959279330 3:104317503-104317525 AGCAGATGACAAAAGTAAGCAGG - Intergenic
959624724 3:108436906-108436928 GGAAGATGACAAAAGGGAGAAGG + Intronic
959688918 3:109177464-109177486 GACAGGTGCCATATGGGAGCTGG + Intergenic
960184002 3:114616599-114616621 GAAAGATGACAAAAGGGAGAAGG - Intronic
961479342 3:127169805-127169827 GGCAGAAGGCGAAAGGGAGCCGG - Intergenic
962771196 3:138611801-138611823 GGCAGAAGGCAAAGGAGAGCTGG - Intronic
965218195 3:165892358-165892380 GGCAGAAGGTGAATGGGAGCAGG + Intergenic
965401766 3:168220857-168220879 GCCAGAAGACAAATGGGATGGGG - Intergenic
965930384 3:174035648-174035670 TGCAAATGATAAATGGTAGCAGG - Intronic
967329535 3:188276761-188276783 GGCAGAAGTCAAAAGGGAGCAGG - Intronic
968230405 3:197002294-197002316 GGAAGAGAAGAAATGGGAGCAGG - Exonic
970520626 4:16880319-16880341 GGCAGCTGACCAAGGGGAGAAGG + Intronic
971278273 4:25218418-25218440 TGCAGAGGACAAATGGAAGGTGG + Intronic
972911368 4:43821658-43821680 GGCAGAGGTAAAGTGGGAGCAGG + Intergenic
972978156 4:44662857-44662879 GGCAGAAGGCAAAAGGGAACTGG - Intronic
973694324 4:53475109-53475131 GGCAAATGACAAAAGGTAGAGGG + Intronic
974021050 4:56692796-56692818 AGCAGATGCCCACTGGGAGCAGG + Intergenic
975842890 4:78494436-78494458 GGCAGAAGAGGAAGGGGAGCAGG + Intronic
976796222 4:88936374-88936396 GGCAGAAGAAGAAGGGGAGCAGG + Intronic
977604147 4:98965037-98965059 GGCAGAAGGCAAAGGGAAGCTGG - Intergenic
978176470 4:105738025-105738047 GGCAGAAGGCAAAAGGGAGCAGG - Intronic
979295425 4:119027247-119027269 GGCAGAAGACAGAAGGGTGCAGG + Exonic
980904683 4:138936859-138936881 AGCGGAGGACAAAGGGGAGCTGG + Intergenic
981612879 4:146614288-146614310 GGCAGAAGGCAAAGGGAAGCTGG - Intergenic
981635150 4:146868995-146869017 GGCAGAAGGCGAAGGGGAGCAGG - Intronic
982101411 4:151971848-151971870 GGTGGAAGACAAAGGGGAGCAGG - Intergenic
983863878 4:172740052-172740074 GTCAGAGAATAAATGGGAGCTGG - Intronic
984621314 4:181955646-181955668 CACAGATGACAAAGGGGCGCAGG + Intergenic
985643359 5:1073944-1073966 GGCAGGTGACAGATGGGATGGGG + Intronic
985895783 5:2749373-2749395 GGCAGAGGACGAAGGTGAGCGGG - Exonic
986190335 5:5491185-5491207 TGCAGATGACAAAGGGCAGATGG + Intergenic
987195803 5:15524934-15524956 GGCGGATGATGAATGGGAACAGG - Intronic
987278602 5:16389128-16389150 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
987975744 5:25012771-25012793 GGCAGAAGGCAAACAGGAGCTGG + Intergenic
988671459 5:33386176-33386198 GGCAGAAGGCAAAGGGCAGCAGG + Intergenic
989005019 5:36800634-36800656 GGCAGAAGGCAAAGGAGAGCCGG - Intergenic
989285134 5:39690697-39690719 GGCAGATGAGAAGTGGGACCAGG + Intergenic
990384390 5:55245478-55245500 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
990909362 5:60838286-60838308 GGCAGCTGAGAAATGGGACGAGG - Intronic
992015536 5:72572002-72572024 AGCAGATGGCAGATGGCAGCAGG - Intergenic
992494466 5:77279403-77279425 CACAGATGACAACTGGAAGCTGG - Intronic
994843601 5:104957027-104957049 GGGAGAGGACATGTGGGAGCAGG - Intergenic
998268294 5:140683392-140683414 GGCAGATAGCAAATGGGTGTGGG - Intronic
998398349 5:141834270-141834292 GGCTGATAATAAATGGTAGCCGG + Intergenic
998948839 5:147371073-147371095 CGCAGATGACAAATGAGTCCTGG - Intronic
999216293 5:149938345-149938367 GGCAGATAACAAATGTGAGAGGG + Intronic
1000353493 5:160371258-160371280 GGGAGAAGAGAAATGAGAGCTGG - Intergenic
1000882448 5:166713874-166713896 GGCAGAAGGTAAAGGGGAGCTGG + Intergenic
1001578883 5:172784788-172784810 GGCAGAAGGCAAGGGGGAGCAGG - Intergenic
1002840303 6:899701-899723 GGCAGAGGGAAAAGGGGAGCAGG - Intergenic
1004035515 6:11919140-11919162 GGCAGATGACACAGTGGGGCTGG + Intergenic
1004294747 6:14400341-14400363 TGCAGATGACAAGGGGGAGGTGG + Intergenic
1005097497 6:22133294-22133316 GGGAGAGGACAACTGGAAGCTGG - Intergenic
1005849068 6:29805390-29805412 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1005860891 6:29899306-29899328 GGCAGAAGACAAAGGTGAGCTGG - Intergenic
1005869147 6:29960604-29960626 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1006578712 6:35064268-35064290 GGCAGTGGACAAATGGAAGATGG + Intronic
1006685492 6:35829671-35829693 GACAGATGACAAAAGTGAGATGG - Intronic
1007093276 6:39197727-39197749 GGTAGATGCCAAAGGAGAGCTGG - Intronic
1007255629 6:40526401-40526423 GGCAGATCAGAACTGGGAGGAGG - Intronic
1008418572 6:51271391-51271413 AGCAGAAGACGAATGGGAGCAGG - Intergenic
1009036379 6:58121491-58121513 GGCAGATCACAAAGGGTAGGTGG - Intergenic
1009212189 6:60875102-60875124 GGCAGATCACAAAGGGTAGGTGG - Intergenic
1010026193 6:71220083-71220105 GTCAAATGACAAATGGTAGATGG + Intergenic
1012313598 6:97757905-97757927 GGCAGATGACAAATGTTATTTGG - Intergenic
1012492131 6:99793681-99793703 GGCAGATGACAGATGGAGGATGG + Intergenic
1013827469 6:114231333-114231355 GGCAGAAGGCAAAGGGGAGCAGG - Intronic
1015256766 6:131186285-131186307 GGCAGAAGGCACAGGGGAGCGGG - Intronic
1015374547 6:132494696-132494718 GGTAGTTGACAAGTGGGGGCAGG + Intronic
1015821358 6:137264424-137264446 GGCAGGTGACAAATGAGACAGGG - Intergenic
1016861393 6:148722014-148722036 GGAAGAAGACAGATGGGAGAGGG - Intergenic
1017184014 6:151582705-151582727 GGCAGAAGATGAAGGGGAGCAGG + Intronic
1017694591 6:157001807-157001829 GGCAGGTGGCAAAGGGGAGATGG + Intronic
1018464130 6:164027853-164027875 GGGAGACGACAAATGGGAAAAGG - Intergenic
1018766377 6:166936528-166936550 GGCAGAAGGCAAAGGGGAGCTGG + Intronic
1019171006 6:170133218-170133240 GGTAGATGAGAAGTGGGGGCTGG - Intergenic
1019171029 6:170133332-170133354 GGCAGGTGAGAATTGGGGGCTGG - Intergenic
1019171060 6:170133447-170133469 GGCAGATGAGAAGTGGGGGCTGG - Intergenic
1019171088 6:170133562-170133584 GGCAGATGAGAAGTGGGGGCTGG - Intergenic
1019171104 6:170133619-170133641 GGCAGATGAGAAGTGGGGGCTGG - Intergenic
1019171118 6:170133676-170133698 GGTAGATGAGAAGTGGGGGCTGG - Intergenic
1019171131 6:170133733-170133755 GGTAGATGAGAAGTGGGGGCTGG - Intergenic
1019865631 7:3708101-3708123 GGCAGAAGGCAAAGAGGAGCAGG + Intronic
1020616101 7:10464564-10464586 GGCGGAAGGCAAAGGGGAGCAGG - Intergenic
1022127465 7:27372251-27372273 GGCGGAAGGCAAAAGGGAGCAGG + Intergenic
1022518843 7:30992838-30992860 GGCACTTGCCAAATGGAAGCTGG - Intronic
1024551930 7:50569723-50569745 GGCATATGAGAAACGGAAGCAGG - Intergenic
1024766269 7:52664521-52664543 AGCAGATGACAAAGGGAAGCAGG - Intergenic
1024813975 7:53245906-53245928 GGCAGAAGGCGAAGGGGAGCTGG - Intergenic
1024977088 7:55123609-55123631 GGCATATGATAAATGTGAGATGG - Intronic
1026933581 7:74238770-74238792 GGGAGAGGACAGACGGGAGCAGG + Intronic
1028381581 7:90205952-90205974 GGCAGAAGACGAAGGGGAGCAGG - Intronic
1028822090 7:95224093-95224115 GGTAGCTGAAGAATGGGAGCTGG - Intronic
1029898419 7:104011632-104011654 GGCAGAGGCAAAGTGGGAGCAGG - Intergenic
1030866977 7:114711846-114711868 GGCAGATGCCAACTGTGAACGGG - Intergenic
1031193472 7:118585104-118585126 GGCAGAAGATGAAGGGGAGCAGG + Intergenic
1031462679 7:122070829-122070851 GGTAGAAGTCAAATGGGAGCTGG - Intergenic
1031549525 7:123091198-123091220 GGCAGAAGGCAGAGGGGAGCTGG - Intergenic
1033503766 7:141979479-141979501 GGGAGAGAAGAAATGGGAGCGGG + Intronic
1034032590 7:147784784-147784806 GGTAGAAGACAGCTGGGAGCTGG + Intronic
1035404867 7:158590139-158590161 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1037739244 8:21592207-21592229 GGGAGAAGAAACATGGGAGCTGG + Intergenic
1037740268 8:21603239-21603261 GGCTGGTGACAAATGGGATGGGG + Intergenic
1038489684 8:27961372-27961394 GGCAGAAGACAATGGGGAGTAGG - Intronic
1039376352 8:37038142-37038164 AGCACATGACTAATGTGAGCTGG + Intergenic
1039830479 8:41209778-41209800 GGCAGAAGGCAAAGGGGAGCTGG - Intergenic
1041324581 8:56651315-56651337 GGCAGAAAACAAAGGGGAGCTGG + Intergenic
1041456246 8:58063998-58064020 GGCAGAAGGCAAAGGGAAGCAGG + Intronic
1041542438 8:59001276-59001298 GACAGATGACAATTGTGAGGTGG - Intronic
1042008474 8:64210023-64210045 GGCAGATGACACATGGTAGGCGG + Intergenic
1043958075 8:86385549-86385571 GGCAGATTACAATATGGAGCAGG + Intronic
1044684181 8:94811343-94811365 GGCAAAAGGCAAAGGGGAGCAGG + Intergenic
1044708375 8:95030888-95030910 GGCAGAAGACGAAGGGGAGCAGG + Intronic
1045417197 8:101979148-101979170 GGCAGATGACCACTGGCAGGGGG + Intronic
1045921811 8:107538961-107538983 GGCAGATGGCAGCTGGGTGCTGG - Intergenic
1046121579 8:109854288-109854310 GGCAGAAGGCAAAGGGGAGCAGG - Intergenic
1046913841 8:119658911-119658933 GGCAGAGGAGAAAAGGGATCAGG + Intronic
1047027152 8:120836424-120836446 GGCAGATGCCAAATGGGATGGGG - Intergenic
1047078570 8:121433863-121433885 AGCTAATGAGAAATGGGAGCAGG - Intergenic
1047760446 8:127950347-127950369 GGCAGATGGCATACAGGAGCTGG - Intergenic
1048279607 8:133095316-133095338 GGCTGATGACCAACTGGAGCTGG + Intronic
1048337867 8:133516282-133516304 GGCAGAAGAAGAAGGGGAGCTGG - Intronic
1048528333 8:135225071-135225093 CCCAGGTGACAAATGGGAGTTGG - Intergenic
1048753420 8:137705102-137705124 GGCAGAAGACAAAGGGGACCAGG + Intergenic
1049997832 9:1048080-1048102 GGCTGAGGCCAAATGGGAGATGG - Intergenic
1050194775 9:3070221-3070243 GGCAGAAGGCTAAGGGGAGCTGG + Intergenic
1051233914 9:14978833-14978855 GGCATATGACATATTGAAGCAGG + Intergenic
1051347504 9:16165546-16165568 GGTAGAAGGCAAAGGGGAGCTGG + Intergenic
1051700408 9:19816672-19816694 GGCAGAAGATGAAGGGGAGCAGG + Intergenic
1051956715 9:22703905-22703927 GGCAGTTGACAATGGGGAACTGG + Intergenic
1053177299 9:35937025-35937047 GGCAGAAGACAAAGGGGGACAGG - Intergenic
1053581205 9:39406292-39406314 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1053845690 9:42234356-42234378 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1054102792 9:60965096-60965118 GGCAGAAGATGAAGGGGAGCTGG - Intergenic
1054837438 9:69692687-69692709 GGCAGAAGGCAAAGGGAAGCAGG + Intergenic
1054934282 9:70670051-70670073 GGGAGGTGACTAATGGGAGAAGG + Intronic
1055525636 9:77130399-77130421 GGCAGAAGGCAAAGGGGAGCAGG + Intergenic
1055595913 9:77864096-77864118 GGCAGAAGGCAAAGGGAAGCAGG + Intronic
1055663527 9:78531035-78531057 GGCAGAAGGCAAAGCGGAGCAGG - Intergenic
1055800594 9:80031989-80032011 TGCAGAGGGCAAAGGGGAGCAGG + Intergenic
1056165494 9:83937049-83937071 GGCAGAAGAGAAAAGGCAGCTGG + Intergenic
1056735634 9:89207287-89207309 GGCAGATGGCCAGTGGGTGCTGG - Intergenic
1056835583 9:89952812-89952834 GGCAGATGGGAAAAGAGAGCAGG + Intergenic
1057026788 9:91740163-91740185 GGAAGATGACAAGGGGGTGCTGG + Intronic
1057595085 9:96409122-96409144 GGCAGAAGGCGAAGGGGAGCAGG - Intronic
1057954405 9:99396237-99396259 AGCAGAGGACAGGTGGGAGCTGG + Intergenic
1059338385 9:113583464-113583486 GGCAGATGAGAAGAGGGAGATGG + Exonic
1059462495 9:114442723-114442745 GGCAGAAGGCAAAGGAGAGCAGG - Intronic
1061118387 9:128628610-128628632 GGCAGATTACAAAGGTGACCCGG - Intronic
1061266413 9:129507850-129507872 GGCTGATGACAAGGGGGACCTGG + Intergenic
1062571078 9:137185673-137185695 GACAGGTGACACATGGGAACAGG + Intronic
1186529651 X:10282359-10282381 GGCAGAAGAGGAAGGGGAGCAGG + Intergenic
1186924992 X:14323795-14323817 GGAAGATAAAAATTGGGAGCTGG - Intergenic
1187176098 X:16897680-16897702 GGAAGATGACAATGGGGAGGAGG - Intergenic
1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG + Intronic
1187607754 X:20905279-20905301 GGCAGAGTACCAGTGGGAGCAGG + Intergenic
1188103839 X:26124437-26124459 GGCAGAAGGCAAAGAGGAGCCGG - Intergenic
1188558802 X:31444111-31444133 GGCAGAAGGCAAAGGGGAGCTGG - Intronic
1188690156 X:33119560-33119582 GGCATTTGAGAAATGGCAGCAGG + Intronic
1189180506 X:39000171-39000193 GAAAAATGACAACTGGGAGCAGG + Intergenic
1189216824 X:39332404-39332426 GGCAGAAGGCAAAGGGGAGCTGG + Intergenic
1190001038 X:46687083-46687105 GGCACCAGACCAATGGGAGCTGG - Intronic
1190793868 X:53723576-53723598 GGCAGATGGCAAAGAGGAGCAGG - Intergenic
1192005504 X:67207942-67207964 GGCAGAAGACAAATGAGAGTTGG - Intergenic
1192903546 X:75524836-75524858 GGAAGATAAGAGATGGGAGCAGG + Intergenic
1193489145 X:82126720-82126742 GGCAGAAGGCAAAAGGGATCAGG + Intergenic
1193828872 X:86262536-86262558 AGCAGATGACTATAGGGAGCAGG + Intronic
1193960525 X:87919702-87919724 GGCAGAAGGGCAATGGGAGCTGG + Intergenic
1194313871 X:92349567-92349589 GGGAGGGGACAAATGGTAGCGGG - Intronic
1196343525 X:114625156-114625178 GGCAGAATACTAAGGGGAGCTGG - Intronic
1197059846 X:122164525-122164547 GGCAGAAGGCAAACGGGAGCAGG + Intergenic
1197628798 X:128833989-128834011 TGCAGAGGACATATGGGAGGAGG - Intergenic
1197689792 X:129485842-129485864 GGCAGAAGGCAAAGGAGAGCTGG - Intronic
1198984329 X:142431881-142431903 GGTAGAAGGCAAAGGGGAGCAGG - Intergenic
1199886028 X:152022737-152022759 AGCAAATGGCTAATGGGAGCAGG - Intergenic
1200622139 Y:5463667-5463689 GGGAGGGGACAAATGGTAGCGGG - Intronic
1201351645 Y:13050017-13050039 GGCAGAAGGTAAATGGGAGCTGG - Intergenic
1201731183 Y:17205046-17205068 GTTAGATTGCAAATGGGAGCAGG - Intergenic