ID: 1146565369

View in Genome Browser
Species Human (GRCh38)
Location 17:33908393-33908415
Sequence ATAGAGAAGCAGACAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 630}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146565362_1146565369 25 Left 1146565362 17:33908345-33908367 CCAGGGGTCAAGGACACCATATT 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG 0: 1
1: 0
2: 3
3: 60
4: 630
1146565364_1146565369 9 Left 1146565364 17:33908361-33908383 CCATATTGGACTATCTATTTTCT 0: 1
1: 0
2: 1
3: 19
4: 273
Right 1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG 0: 1
1: 0
2: 3
3: 60
4: 630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146565369 Original CRISPR ATAGAGAAGCAGACAGGGGA GGG Intronic
900210740 1:1454686-1454708 ACACCGAGGCAGACAGGGGAAGG - Intronic
900216617 1:1485356-1485378 ACACCGAGGCAGACAGGGGAAGG - Intronic
900223698 1:1523084-1523106 ACACCGAGGCAGACAGGGGAAGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900625691 1:3607573-3607595 ATGGAGAAGGTGGCAGGGGAAGG + Intronic
900646973 1:3713384-3713406 AAAGAGAGGCCCACAGGGGAGGG + Intronic
900811149 1:4802181-4802203 GGAGAGATGGAGACAGGGGAGGG - Intergenic
901669859 1:10849835-10849857 ATAGGGAAGTGGACAGTGGAAGG + Intergenic
901693770 1:10991403-10991425 ATCAAGAAGCTGACAGGGGCCGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902365986 1:15974869-15974891 ATAAAGAAGCAGACTGGGCCGGG - Intronic
902664177 1:17926006-17926028 ACAGAGACTCAGAGAGGGGAAGG + Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903802299 1:25978269-25978291 ATATAGAAAAAGACAGGGGTAGG - Intronic
903874638 1:26465068-26465090 ATAGAGAATCAGGCCAGGGAGGG + Intronic
904397101 1:30229300-30229322 AGAGTGAGGCAGACAGGGCATGG - Intergenic
904948954 1:34220524-34220546 ATACAAAAGCAGAAATGGGATGG + Intergenic
905245411 1:36609902-36609924 AGAGGGAAGGAGACAGGGCAAGG + Intergenic
906127412 1:43435733-43435755 ATAGGGAAAGAGCCAGGGGAGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906841775 1:49147013-49147035 ATAGAGAAGCAGAAAAGCCAAGG + Intronic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907552184 1:55313841-55313863 ATAGAGGCCCAGAGAGGGGAAGG + Intergenic
908248137 1:62244012-62244034 ATCTAGGAGCACACAGGGGATGG - Intronic
909309653 1:74130081-74130103 CCAGAGAAGCAGCCAAGGGAGGG - Intronic
910110588 1:83678513-83678535 AGAGAGAAACAGACAGGGAGAGG - Intergenic
911068268 1:93811526-93811548 ATAGAGAAGCATAAAGGAAAGGG - Intronic
911693481 1:100861884-100861906 ATAGAGAAGGAGAGAGGGCTGGG - Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
911736617 1:101343428-101343450 AGAGAGTACCAGAGAGGGGATGG - Intergenic
912812210 1:112803011-112803033 ACAAAGAAGCAGGCAGGGGCAGG - Intergenic
913572424 1:120134038-120134060 TTTGAGATTCAGACAGGGGAAGG - Intergenic
913685074 1:121223851-121223873 AAAGAAAAGCAGACAGGGGGTGG - Intronic
914036919 1:144011455-144011477 AAAGAAAAGCAGACAGGGGGTGG - Intergenic
914152535 1:145056476-145056498 AAAGAAAAGCAGACAGGGGGTGG + Intronic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
918975962 1:191486771-191486793 ATGGAGAAACAGACAGGTGGTGG + Intergenic
919174901 1:194007819-194007841 AAAGAGATTCAGAGAGGGGAAGG + Intergenic
920305502 1:205015767-205015789 ACAGACAAGCAGAGAGGTGAGGG + Intronic
920472391 1:206242408-206242430 AAAGAAAAGCAGACAGGGGGTGG - Intronic
920777010 1:208948711-208948733 AGAGAGAAGAGGAGAGGGGATGG + Intergenic
921011517 1:211146428-211146450 AGAGAGAAAGTGACAGGGGATGG - Intergenic
921399120 1:214700941-214700963 ATAGACAAGCAGAGAGGGAATGG + Intergenic
922182828 1:223248915-223248937 ACAGAGGAGCACACAGGTGAGGG + Intronic
922452107 1:225745790-225745812 ATATAAAAGCAGCCAGGTGAAGG - Intergenic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923110902 1:230889240-230889262 AAAGAGCAGAAGCCAGGGGAAGG + Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923790094 1:237104441-237104463 CTAGACAAGGAGACAGGGAAAGG - Intronic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1064142414 10:12801736-12801758 ATAGATATACAGACAGGTGATGG - Intronic
1064185615 10:13159364-13159386 AGAAGGAAGCAGAGAGGGGATGG - Intergenic
1064273486 10:13885894-13885916 AGAGAGAAGGAGAGATGGGAGGG - Intronic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1065771281 10:29081161-29081183 ATAGAGAAGGAGAGAGGGCTGGG + Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1067057479 10:43060703-43060725 CTAGAGAAGCAGAGTGGGGCAGG + Intergenic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068968786 10:62940536-62940558 AAAGATAAGCAGACAGGTGTTGG - Intergenic
1069920193 10:71811688-71811710 GGAGAGAAGCAGAGAGGGGCTGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070373480 10:75807321-75807343 ACAGAGAATCAGACAGGGCATGG + Intronic
1070688238 10:78505668-78505690 CTGGAGAAGGAGACAGGGCAGGG + Intergenic
1070852768 10:79581243-79581265 AAAGAGAAACAGAAAGGGAAAGG + Intergenic
1070927424 10:80234995-80235017 TTAGAGAAGCTGACAGGTGGAGG - Intergenic
1070978479 10:80624969-80624991 GGAGAGAAGCACACAGGTGAGGG - Intronic
1071428029 10:85579395-85579417 ACAGAGAAAGAGAGAGGGGACGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG + Intergenic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073485532 10:103815957-103815979 ATATAGAAGCAGAGAAGAGAAGG + Intronic
1074263872 10:111881738-111881760 ATAGAGAAGTGGGCTGGGGACGG + Intergenic
1075851905 10:125595794-125595816 GCAGAGAAGTAAACAGGGGAAGG - Intronic
1076241341 10:128910400-128910422 TGGGAGAAGTAGACAGGGGATGG - Intergenic
1076356986 10:129860426-129860448 AAAATGTAGCAGACAGGGGACGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078876946 11:15408691-15408713 AGAGAGAGGCAGACACTGGAGGG + Intergenic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079130764 11:17745645-17745667 AGAGAGAAGCAGACAGCAGAGGG - Intronic
1079338223 11:19589850-19589872 GTAGAGAAGGAGAGAGGGAAGGG + Intronic
1079422633 11:20308312-20308334 ATAAAGAAACAGACAGAGAAAGG + Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082888877 11:58117340-58117362 ATACAGCAGTAGACAAGGGATGG - Intronic
1084433755 11:69126179-69126201 AAAGGGAGGCAGGCAGGGGAGGG + Intergenic
1084759196 11:71257702-71257724 AGAGAGAAGGAGAGAAGGGAAGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1086656236 11:89359731-89359753 ATAGAGAGGCAGTTAGGGAAGGG - Intronic
1087323177 11:96687385-96687407 ATAGATAAAGAGGCAGGGGAGGG - Intergenic
1087430533 11:98047762-98047784 ATAGAGATACAGAAATGGGAAGG - Intergenic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1087933132 11:104001336-104001358 ATAAAGAAGCACATAGGGTAAGG - Intronic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088691895 11:112335514-112335536 AGAGAGAAGCAGACAGGAGTGGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089113046 11:116072212-116072234 AATTAGAAGCAGACAGGGAAAGG - Intergenic
1089332954 11:117702457-117702479 AAAGAGGAGCAGTCAGGGAAAGG - Intronic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091174692 11:133547480-133547502 ATAGGGACTCAGAGAGGGGAGGG - Intergenic
1091283963 11:134397784-134397806 AGAGAGGAGCAGGCAGGGCATGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092216471 12:6687354-6687376 ATAGTGGAACAGACAGGGCAAGG - Intronic
1092657997 12:10707510-10707532 TTAGAGAAGCTGGCAGTGGAAGG - Intronic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1095631659 12:44384036-44384058 ATAGACAAGAACACAGGGGTTGG + Intronic
1096574730 12:52545561-52545583 TTACAGATGCTGACAGGGGAGGG + Exonic
1096613988 12:52821463-52821485 ATTGAGACACAGACAGGGAAGGG + Exonic
1096655856 12:53091746-53091768 ATAGGGATGAAGAGAGGGGATGG - Intergenic
1096695504 12:53345744-53345766 AAAGAGAAGCAGATAGGCAAGGG + Intergenic
1096845868 12:54406099-54406121 ATAGTGAAGCAGACATAGGGTGG - Intronic
1097579481 12:61436539-61436561 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098170878 12:67745917-67745939 AAAGAGAAACAGACAGAGAAGGG - Intergenic
1098236553 12:68423654-68423676 AGAGAAAACCAGACAGGGTAAGG + Intergenic
1098285389 12:68901879-68901901 AGAGAGAAGGGGAGAGGGGAGGG + Intronic
1099171740 12:79372802-79372824 AGAGATAAGAAGAGAGGGGAGGG - Intronic
1100565408 12:95790204-95790226 TTAGAGAAGCAGCGAGGGAAGGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101568823 12:105934644-105934666 CTTGAGAAGCAGGCAAGGGAGGG + Intergenic
1101693024 12:107098401-107098423 AGAGAGAAGGGGAGAGGGGAAGG + Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101885789 12:108660549-108660571 ATAGGGAAGAAGGCAGAGGAAGG - Intronic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102194730 12:111016931-111016953 AGAGAGAAGAAGAGAAGGGAGGG - Intergenic
1102402357 12:112640486-112640508 GTAGAGGAGAAGACAGGGAAAGG - Intronic
1102868604 12:116394334-116394356 AGACAGAAGCAGAGATGGGAGGG - Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103144796 12:118585888-118585910 ATTGTGATGCAGACAGGGCAAGG + Intergenic
1104177027 12:126342896-126342918 ACAGAGAAGCAGACCAGGGGAGG + Intergenic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1108077364 13:46695195-46695217 ATGGAGAGGCACACAGGGCAGGG - Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108417424 13:50212404-50212426 TTAGAAAAGCAGAGAGGGGAGGG + Intronic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1113340373 13:109417142-109417164 ATAGATAATTAGACAGAGGATGG - Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114642767 14:24235205-24235227 CTAGAGATGGAGACAGGGTAGGG + Intronic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117325435 14:54664602-54664624 AGAGAGAAGAAGAGAGGGGGTGG - Intronic
1117548773 14:56813255-56813277 AGAGAGAGGCAGACAAGGAAGGG + Intergenic
1117662321 14:58020494-58020516 ATAGAGAAAGAGACAAGGGGAGG - Intronic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1119442096 14:74635372-74635394 CTAGAGAAGCAGATGGGGGTGGG - Intergenic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121489818 14:94349766-94349788 ACAGAGAAGCTGAGAAGGGAAGG + Intergenic
1121586230 14:95064810-95064832 AGAGAGAAGAAGGGAGGGGAGGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1121755472 14:96398902-96398924 AGAGAGTAGCAGGCAGGGTAAGG - Intronic
1122161948 14:99791450-99791472 ATAGAAAATCGGACAGGGGCTGG - Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124153338 15:27202076-27202098 AGATAGAAGCAGAGAGGAGATGG - Intronic
1125315892 15:38430695-38430717 AGAGAGAAAGAGACAGGGGGAGG - Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125718659 15:41834712-41834734 AGAAAGAAGAAGACAGGGGATGG - Intronic
1125955799 15:43790371-43790393 AGAGAGAGGCAGACAGGGAGAGG + Intronic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1127299635 15:57639986-57640008 AGAGAGAAACAGACAAGGAAAGG - Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1129661012 15:77552913-77552935 AAAGAGAAGCCAGCAGGGGAGGG + Intergenic
1129887002 15:79045553-79045575 AGAGAGAAGCAGGCAGGAGGAGG - Intronic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130285500 15:82551098-82551120 ATAAAGAAGCAGAGAAGGTAGGG + Intronic
1130336870 15:82963935-82963957 GTAGGGAAGCAGCCAGGGCATGG - Intronic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1132408632 15:101560515-101560537 AGTGAGAAGCAGACAGGAAATGG - Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132602304 16:778769-778791 AGAGAGGAGGAGACAGGGGCAGG + Intronic
1133027687 16:2995782-2995804 ATAGAGAGGCAGACCAGGGCGGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133368358 16:5228806-5228828 AGAGAGAAAGAGACAAGGGAGGG + Intergenic
1133384280 16:5356118-5356140 ATAGACAGGCACAGAGGGGAAGG + Intergenic
1133485579 16:6215312-6215334 AGAGAGAGACAGAGAGGGGAGGG + Intronic
1133517599 16:6524813-6524835 ACAGAGAAGGAGCCAGGTGATGG - Intronic
1133922416 16:10165664-10165686 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134802854 16:17101322-17101344 GTAGAGAGCCAGACAGGTGAAGG - Intergenic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1135424961 16:22327931-22327953 GGAGAGAAGGGGACAGGGGAGGG - Intronic
1135713249 16:24736525-24736547 AGAGAGAAGCAGAAAAGGGCAGG - Intronic
1135920808 16:26647364-26647386 CTAGCGAAGGAGAGAGGGGAGGG - Intergenic
1135978164 16:27124749-27124771 TTACAGAAGCAGAAAGGGGTGGG + Intergenic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1137031343 16:35527028-35527050 ATAGAGAGGCAGCCAGGGCCTGG - Intergenic
1137946244 16:52735572-52735594 ATAGAGAAGCCAAGAGGGGATGG - Intergenic
1138298589 16:55908104-55908126 ATAAAGAATCAGACAGGGCAGGG - Intronic
1138755275 16:59476502-59476524 AGAGAGAGACAGAGAGGGGAGGG - Intergenic
1140230276 16:73112214-73112236 ACAGAGAAGAAGAGAGGGGTGGG + Intergenic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141761311 16:86030416-86030438 GTAGAAAGGAAGACAGGGGACGG + Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143352476 17:6298835-6298857 ATACAGAAACACAGAGGGGAAGG - Intergenic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143731322 17:8884542-8884564 TGAGAGAAGCAGAGAAGGGAAGG - Intronic
1143767585 17:9147757-9147779 ACAGAGGATAAGACAGGGGATGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144707537 17:17379511-17379533 ATACAGAAACAGAAAGCGGATGG - Intergenic
1145842995 17:28011998-28012020 ATAGAGAAGGAGACAAGGAGAGG + Intergenic
1145901383 17:28492589-28492611 CTGGAGAAGTAGGCAGGGGAAGG + Intronic
1146401258 17:32501726-32501748 ATAAAGAGACAGACAGGGCAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146960656 17:36973778-36973800 ATAGCCAAGCAGGCTGGGGACGG + Intronic
1147055409 17:37830551-37830573 AAAGAGTAGCAGGCAGGGGCAGG + Intergenic
1147305671 17:39562485-39562507 ATAGAGAAGCAGCCAAGGAAAGG - Intronic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147597586 17:41726908-41726930 ATAGAGAAGCAATGAGTGGAGGG + Intronic
1148062729 17:44847845-44847867 ATAGGGATGCAGATGGGGGAAGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148862220 17:50610321-50610343 TGAGAGGAGCAGAGAGGGGAAGG + Intronic
1149633706 17:58148898-58148920 TGAGAGAAGCAGGCAGGAGAAGG - Intergenic
1150280422 17:63926961-63926983 ACAGAAAAACAGACCGGGGAGGG + Intergenic
1150368305 17:64611609-64611631 AGAGAGAAGTAGACAGATGAAGG - Intronic
1150827793 17:68491972-68491994 ATGGGCCAGCAGACAGGGGAAGG + Intergenic
1150854707 17:68740917-68740939 ACAGAGAAGCAGAGAAGAGAAGG + Intergenic
1151278109 17:73051215-73051237 ACAGACAAACAGACAGGTGAGGG - Intronic
1151377683 17:73702326-73702348 AGAGAGAGAGAGACAGGGGAAGG + Intergenic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1153200397 18:2641768-2641790 CTAGAGAAGCACTCAGAGGAGGG - Intergenic
1153528159 18:6016915-6016937 ATGGAGAAGCAGCCAGGCCAGGG + Intronic
1153950494 18:10054126-10054148 ATGGAGGAGCAGGTAGGGGAGGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1158186713 18:54779913-54779935 AGGGAGAAGCAGTCAGGAGACGG - Intronic
1158186740 18:54780015-54780037 ATGGGGAAGCAGTCAGGAGAAGG - Intronic
1158660867 18:59386356-59386378 ATAGAAAAGCATAAAGGAGAAGG + Intergenic
1158998521 18:62948467-62948489 AGAGAGAAGACAACAGGGGAAGG - Intronic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1160193292 18:76732868-76732890 CTAGAGAACCAGTCAGGAGAAGG + Intergenic
1161908409 19:7174751-7174773 AGAGAGAAAGAGAAAGGGGAGGG + Intronic
1162526666 19:11210331-11210353 ACAGATAAGGAGACAGGTGAAGG - Intronic
1162526906 19:11211516-11211538 ATAGGGGAGCAGACAGGTGAGGG - Intronic
1163846621 19:19641888-19641910 ATTCAGAAGCAAACAGGGCAGGG + Intronic
1165446385 19:35858941-35858963 GAAGAGAAGAAGACATGGGAGGG + Intronic
1166004001 19:39894720-39894742 AGAGAGACAGAGACAGGGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166761043 19:45224659-45224681 TTTGGGAAGCAGACAGGGGCGGG - Intronic
1166830581 19:45637207-45637229 AGAGAGAAGCAGACAAGGACCGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167239640 19:48335918-48335940 AAAGAGAAGAGGAGAGGGGAAGG + Intronic
1167413914 19:49360761-49360783 ACAGAGACCCAGAGAGGGGATGG + Intronic
1167486530 19:49766487-49766509 GTAGAGAAGGAAAGAGGGGAGGG - Intergenic
1167680224 19:50915340-50915362 AGAGAGAGACAGACAGGAGAGGG + Intergenic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1167987151 19:53328154-53328176 ATAGGGAATAAGGCAGGGGAGGG + Intergenic
1168125116 19:54278676-54278698 ACAGAGAGAGAGACAGGGGATGG - Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1168514629 19:57001271-57001293 AGAGAGAGCGAGACAGGGGAGGG + Intergenic
1168562169 19:57393664-57393686 ATAGAGGAGAGGAGAGGGGAGGG + Intronic
1168676897 19:58285106-58285128 AAAGAGAAGCACACAGGGCTGGG - Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
925607618 2:5674384-5674406 ACAGAGAAGCAGAAAAGGAATGG - Intergenic
926384946 2:12326866-12326888 CTAGAAGGGCAGACAGGGGAGGG + Intergenic
927119873 2:19948567-19948589 AAAGAGAAACAGACAGCAGAAGG + Intronic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927607640 2:24502067-24502089 ATATAAAAGCAGCCAAGGGATGG - Intronic
928059302 2:28094695-28094717 ATAGAGAACCGGAAAGGGAATGG - Intronic
928218472 2:29382280-29382302 ATAGAAAAGCAGACAGGAACGGG + Intronic
928666660 2:33556751-33556773 ATAGAGAAGCACTAATGGGAAGG - Intronic
928948115 2:36790291-36790313 GTAGAGATGCAGGCAGAGGAGGG - Intronic
929055561 2:37873422-37873444 AGAGACAAGCAGACAGGGTCAGG - Intergenic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
931096247 2:58943844-58943866 AGAGAGAAGTAGAGAGGGAAGGG - Intergenic
931529973 2:63202849-63202871 ATAGATACACAGACAAGGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933091632 2:78126540-78126562 ATAGAGAAGGCCACAAGGGAAGG - Intergenic
933409775 2:81910375-81910397 ATAGAGAATGAGAGAAGGGAAGG - Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933900427 2:86845977-86845999 ATAGATGCGCAGAGAGGGGAAGG + Intronic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934164060 2:89278264-89278286 TCAGAGCAGCACACAGGGGAAGG - Intergenic
934203214 2:89904260-89904282 TCAGAGCAGCACACAGGGGAAGG + Intergenic
935780121 2:106503248-106503270 ATAGATGCGCAGAGAGGGGAAGG - Intergenic
936060070 2:109289156-109289178 AGAGAGAGAGAGACAGGGGATGG - Intronic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938199350 2:129360480-129360502 CTAGAGAAGCAGTGTGGGGAGGG - Intergenic
939026052 2:137014911-137014933 GTAGGGAAGGACACAGGGGAGGG - Intronic
941270591 2:163422532-163422554 ATAAAGAAGAAGACATAGGAAGG + Intergenic
941428111 2:165375525-165375547 ATATAGAAGTAGTCAGGGAAGGG + Intronic
941536752 2:166732199-166732221 ATAGTCAAGCAGGCAGGGGGTGG - Intergenic
942578345 2:177390233-177390255 ATAGGGAAGCATAAAAGGGAGGG + Intronic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
942887660 2:180947279-180947301 ATAGAGAAGCTCATATGGGAAGG - Intergenic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
944046391 2:195416089-195416111 ATAGTAAAGCAGGCAGGGCATGG - Intergenic
944483636 2:200181338-200181360 AAATAGAAGCAGGCAGGGAAGGG - Intergenic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
944976732 2:205062026-205062048 TTAGAGAAGCGTACAAGGGAAGG - Intronic
945499824 2:210557980-210558002 AGAGAGATGGAGACAGGGGGAGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946589804 2:221232851-221232873 AGAGACAAGAAGAGAGGGGAGGG + Intergenic
946901166 2:224373256-224373278 AGAAAGAAGGAGAAAGGGGAAGG - Intergenic
947865516 2:233395611-233395633 AGAGAGAAGCGGGGAGGGGAGGG - Intronic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948245956 2:236486108-236486130 ATGGAGAAGCACACATGGCATGG + Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169219886 20:3815949-3815971 ATCCAGCGGCAGACAGGGGAAGG - Intergenic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170728863 20:18955010-18955032 ATAGAGAAGCAGGGAAGGGCAGG - Intergenic
1170830677 20:19837822-19837844 AAAGGAAAGGAGACAGGGGAGGG - Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1173067814 20:39729756-39729778 AGAGAGAGAGAGACAGGGGAGGG - Intergenic
1173544031 20:43878698-43878720 ATAGAGAAAGACAAAGGGGAAGG - Intergenic
1174112456 20:48205862-48205884 ACAGAGGAGGAGACAAGGGAAGG - Intergenic
1174818622 20:53708734-53708756 AAAGAAAAGAAGACAGGGGAGGG - Intergenic
1174970642 20:55271436-55271458 TGGGAGAAGCAGACCGGGGAAGG - Intergenic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175912681 20:62412304-62412326 TGAGAGAAGGAGCCAGGGGATGG - Intronic
1176571395 21:8415575-8415597 AGAGAGAAACAGACAGGGAGGGG - Intergenic
1176579309 21:8460137-8460159 AGAGAGAAACAGACAGGGAGGGG - Intergenic
1176675710 21:9775424-9775446 GTAGAGATGCGGGCAGGGGATGG - Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1177836382 21:26190095-26190117 AAAGAGAAGCAAGCAGAGGAGGG + Intergenic
1178133960 21:29605210-29605232 TCAGAGATGCGGACAGGGGAGGG - Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1179081959 21:38179571-38179593 ACAGGGAAGCTGACAAGGGAAGG + Intronic
1180958996 22:19754282-19754304 TGAGAGAGGCAGACATGGGATGG - Intergenic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181685156 22:24523087-24523109 ATAGAGATGCAGAAAGGGCAGGG + Intronic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1183765083 22:39865893-39865915 CTAGAGAAGCAGAGATGGCAGGG - Intronic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
1185380598 22:50505990-50506012 AGAGAGAGGCAGACAGGGCTCGG - Intronic
1203257109 22_KI270733v1_random:145515-145537 AGAGAGAAACAGACAGGGAGAGG - Intergenic
1203257481 22_KI270733v1_random:149728-149750 AGAGAGAAACAGACAGGGAGGGG - Intergenic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949415911 3:3814005-3814027 CTAGATGTGCAGACAGGGGAGGG - Intronic
949865755 3:8545838-8545860 ATAGAAAAGCAAACAGGGTCAGG + Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950638105 3:14330338-14330360 AGAAGGAAGCAGCCAGGGGAGGG - Intergenic
950850280 3:16055640-16055662 AAAGAGAAGCAGAAAGTGAAAGG - Intergenic
950856845 3:16113741-16113763 ATTCAGAAGGAGACAGGGTATGG - Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
954310149 3:49760321-49760343 TTAGAAAAGCAGACAGGTGGAGG + Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
954672651 3:52299030-52299052 AGAGAGAAGAGGAGAGGGGAGGG + Intergenic
955748887 3:62167944-62167966 ACAGAGGACCAGAGAGGGGAGGG - Intronic
955964713 3:64377116-64377138 AGAGGGAAGCAGACAGAGAAAGG + Intronic
956732487 3:72209511-72209533 AGAGAGAATGAGAGAGGGGATGG + Intergenic
957383636 3:79467503-79467525 ATAGAGAAGGAGAGAAGAGAAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957711221 3:83861348-83861370 AAAGAGAAGCTGATAAGGGATGG - Intergenic
957875738 3:86144024-86144046 AGAGAGAGGCAGAGAAGGGATGG - Intergenic
957949735 3:87109011-87109033 ATAGAGTAGCAAAAAGGGCATGG + Intergenic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
958847548 3:99283073-99283095 ATAGAGAACCAGAGGCGGGAGGG + Intergenic
959080337 3:101794219-101794241 ATAGAGAAGCTGAAGGGGGGAGG + Intronic
959208347 3:103342512-103342534 AGAGAGAAGGAAAAAGGGGAGGG - Intergenic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961126706 3:124425117-124425139 ATAGAGAAGGGTAGAGGGGAGGG + Intronic
961172695 3:124809442-124809464 CTGGAGAAGCAAGCAGGGGATGG - Intronic
961438283 3:126934522-126934544 AAAAAAAAGCAGAGAGGGGAGGG - Intronic
961460301 3:127045724-127045746 GTAGAGAGGAAGAGAGGGGAAGG + Intergenic
961471163 3:127113882-127113904 ATCTGGAAGCAGCCAGGGGAGGG + Intergenic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
961721769 3:128901874-128901896 AAAGAGTAGCAGCCAAGGGATGG - Intronic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
962436388 3:135370953-135370975 ATAGAGTGGCAGAGAGTGGAAGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962856994 3:139355954-139355976 CAATAGAAACAGACAGGGGAGGG + Intronic
964129678 3:153272821-153272843 CCTGAGAAGCATACAGGGGAAGG + Intergenic
964188732 3:153978115-153978137 AGAGACAAGAAGACAGGAGAAGG + Intergenic
965185637 3:165459353-165459375 ATACAGCAGAAGACAGGAGATGG + Intergenic
965406446 3:168275096-168275118 ATAGAGCAGCAGACAGGAGCTGG + Intergenic
965431969 3:168599962-168599984 AAAAAAAAGCAGACAGGGGATGG + Intergenic
965602788 3:170471387-170471409 GTAGAGAAGGGGTCAGGGGAGGG - Intronic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
967018829 3:185504836-185504858 ATGGAAAAGCAAACAAGGGAGGG + Intergenic
967658516 3:192077010-192077032 ATAGAAAAGAAGACATGGTATGG - Intergenic
967775064 3:193377785-193377807 AGACAGAGACAGACAGGGGAAGG - Intronic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
968607188 4:1541101-1541123 AGAGAGCAGCAGACAGAGCAGGG + Intergenic
969659875 4:8520302-8520324 AGAGAGAAGCAGACAGTGTGGGG + Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
969973239 4:11070124-11070146 ATAGTGAAGCAGACAGTGAATGG - Intergenic
970318671 4:14854378-14854400 AGAGGGAAGCACTCAGGGGAGGG - Intergenic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971888957 4:32492470-32492492 ATAAAGCAGCAAACAAGGGAGGG + Intergenic
971918032 4:32899547-32899569 ATAGAGAAAGAGGCAGGAGATGG - Intergenic
972244088 4:37226178-37226200 AGAGAAAAGCAGACAGGGCCAGG + Intergenic
972418182 4:38862973-38862995 ATAGAGGAGCAAGGAGGGGAAGG - Intergenic
972509813 4:39758209-39758231 ATAGATCTGCAGACAGGGCATGG - Intronic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
973193142 4:47409491-47409513 ATAGAGAAGGAGAGAAGAGAAGG - Intronic
973842150 4:54873322-54873344 TCACAGAAGCAGACTGGGGAGGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975171204 4:71233765-71233787 ATATTGAAGGAGCCAGGGGAAGG - Intronic
977275076 4:94967462-94967484 AAAGAGAAGGAGAGAGGAGAGGG - Intronic
977615948 4:99088008-99088030 ATAGAGGAGCAGACCTGGGTCGG + Intronic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
979194211 4:117900576-117900598 ATACAGAAGCAGACACAGAAGGG - Intergenic
979864748 4:125739817-125739839 ATATGGAGGCAGGCAGGGGAAGG - Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
980816836 4:137958783-137958805 GGAGAGAAGGAGACAGGTGATGG - Intergenic
981375988 4:144016434-144016456 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981386514 4:144137793-144137815 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981574543 4:146190905-146190927 ATCGAGAAGGAGAGAGGGAAGGG + Intronic
981786595 4:148486603-148486625 AAAGAGAAGGAGACAGGGAGAGG - Intergenic
982138437 4:152295015-152295037 ACAGCAAAGCAGATAGGGGAGGG - Intergenic
982163768 4:152595915-152595937 GAAGGGAAGCAGCCAGGGGAAGG - Intergenic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
982786457 4:159542933-159542955 ATAGAGAAAAAGAAAGGTGAGGG + Intergenic
983889147 4:173013105-173013127 TTATAGAAACAGACAGAGGAAGG - Intronic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984640414 4:182158681-182158703 AGAGATAAGCAGACAGGGATGGG - Intronic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985816747 5:2133066-2133088 GTAGGGAAGCAGACACTGGAAGG - Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986065668 5:4231377-4231399 ACAGAGAAGCAGCCAGGGCGAGG - Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
986149298 5:5112237-5112259 AAATAGAAGCAGACAGTGAATGG + Intergenic
986297319 5:6449756-6449778 ATTGAGGAGCAGACAAGAGAGGG - Intronic
986423746 5:7610025-7610047 GTGGAGATGCAGACAGGGGTGGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988214408 5:28252651-28252673 ATAGATAATTAGACAGGGCAGGG - Intergenic
988832748 5:35003478-35003500 AGATAGAGGCAGACAGAGGATGG - Intronic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989151067 5:38300344-38300366 ATAGAGAAGAAGAGAAGAGAAGG - Intronic
989800719 5:45535305-45535327 ATAGAGAAGCAGGCTGGGCATGG + Intronic
990867421 5:60395803-60395825 AGAGAGATGCAGAGCGGGGAGGG - Intronic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
991901550 5:71465551-71465573 AAAGAGAAACAGACAGGACATGG - Intronic
992850154 5:80798804-80798826 AGAGATAAGAAGAGAGGGGAGGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993053474 5:82952711-82952733 TTAGAGAAACAGGCAGGGGCTGG - Intergenic
993069413 5:83140747-83140769 ATTGAGAAACAGAAAGGGGTGGG - Intronic
993564663 5:89458310-89458332 ATATAAAAGCAGACTGGGCAAGG - Intergenic
994403569 5:99315011-99315033 AGAGAGAAGAACACAGGGAAGGG + Intergenic
995455600 5:112348569-112348591 ATAGGGAAGCAGGTGGGGGAGGG + Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996925924 5:128826555-128826577 ATAGTTAAGAAGACAGGGGAAGG + Intronic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997815480 5:137013068-137013090 ACAGAGAGAGAGACAGGGGAAGG + Intronic
998729333 5:145056244-145056266 ATAGCGAAGCAGAGGAGGGAGGG - Intergenic
998750768 5:145319040-145319062 ACAGAGAAGCAGAGAAGAGAAGG - Intergenic
998809356 5:145950526-145950548 ATAGAGAGGGAAACAGGAGAAGG + Intronic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
999644896 5:153707896-153707918 AGAGAGAACCAAGCAGGGGAAGG + Intronic
999674045 5:153981367-153981389 AAAGAGAAGAAGACAGGGTCTGG - Intergenic
999835728 5:155368833-155368855 AGAGAGTAACAGAAAGGGGAGGG - Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000113882 5:158135247-158135269 ATAGGGAAGGAAAGAGGGGATGG + Intergenic
1000367734 5:160506561-160506583 AGAGAGAATCAGGTAGGGGAGGG + Intergenic
1000990682 5:167908469-167908491 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1000990699 5:167908516-167908538 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1002103869 5:176870340-176870362 AGAGACAAGCAGAGAGGAGACGG - Intronic
1003160416 6:3629690-3629712 AGAGAGAAGCACAAAGGAGAGGG - Intergenic
1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG + Intergenic
1003746437 6:9007548-9007570 AGGGAGCAGCATACAGGGGAGGG - Intergenic
1003843741 6:10150421-10150443 AGAGAGAAGCACACACGGGGAGG + Intronic
1003895455 6:10603477-10603499 GTCCAGATGCAGACAGGGGAGGG + Intronic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1004278479 6:14258827-14258849 ACAGGGAGGCAGAGAGGGGAGGG + Intergenic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1004700215 6:18071739-18071761 TTATAGAAGCAGACTGGGGTGGG - Intergenic
1005621310 6:27623052-27623074 ATAAAGAAGCAGACAGTACAAGG + Intergenic
1006112903 6:31759555-31759577 AAAAAGCAGCAGCCAGGGGAAGG + Intronic
1006113104 6:31760663-31760685 ATAGGGAAGGAGACAGGGCCTGG - Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1007125263 6:39420965-39420987 CTAGAGAAGCAGACAGGACATGG + Intronic
1007187971 6:39988541-39988563 ATACTGAAGCAGGCAGGGCAAGG - Intergenic
1007546260 6:42697158-42697180 AAAGAGAAGCTTTCAGGGGAAGG - Exonic
1008000801 6:46357831-46357853 ATAAAGAAGCAGCTAGGGCAAGG + Intronic
1008803686 6:55401953-55401975 AAAAAGAAACAGAGAGGGGAGGG - Exonic
1008912208 6:56746946-56746968 AAAGGGGAGAAGACAGGGGAGGG + Intronic
1009650998 6:66478469-66478491 ATAGAGAAGCAGGACTGGGAAGG - Intergenic
1010777823 6:79907078-79907100 ATAAAGAAACAAACAAGGGATGG + Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011441221 6:87389587-87389609 ATACAGAAACAGGCAGGGGCTGG + Intronic
1011548324 6:88504594-88504616 AAAGAGAAGCTGACAGAGCAGGG - Intergenic
1012011029 6:93785707-93785729 AAAGGGAAGGAGAGAGGGGATGG - Intergenic
1012316922 6:97791872-97791894 ATTCGTAAGCAGACAGGGGAGGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1013716087 6:112963650-112963672 AGAGAGAAGGAGAGAGGGAAAGG + Intergenic
1014615478 6:123592842-123592864 AGATAGAAGCAGACAGTGAATGG - Intronic
1014986002 6:128010468-128010490 ATAGAGAAGCCAAGAGGAGAAGG - Intronic
1015843586 6:137496540-137496562 AGAGAGAGGCGGACGGGGGAGGG + Intergenic
1015977172 6:138802120-138802142 ATAGAGAGGCCCACATGGGAGGG + Intronic
1016023443 6:139259648-139259670 ATAGACAAGCAAACAGGGAAGGG - Intronic
1016518048 6:144918790-144918812 ATAGACAGGGAGGCAGGGGATGG - Intergenic
1017390530 6:153934205-153934227 ATTGAGTATTAGACAGGGGAAGG - Intergenic
1017600598 6:156076623-156076645 AAAGACAAGCATGCAGGGGAGGG + Intergenic
1018318813 6:162584890-162584912 AAAGAGAAGAGGAGAGGGGAGGG - Intronic
1019049237 6:169170399-169170421 ATGGTGAACCAGACAGGGCAGGG - Intergenic
1020438013 7:8186547-8186569 ATACAAATGGAGACAGGGGATGG + Intronic
1021658303 7:22893726-22893748 AGACAGAAGCAGGCAAGGGATGG - Intergenic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022041715 7:26587922-26587944 AAAGAGAAGCAAATAGGGGGAGG + Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023615171 7:42012381-42012403 AGAGAGAAGAAGAAAAGGGAGGG - Intronic
1023909958 7:44546832-44546854 ATAGAAAAGCAGGCTGGGCATGG + Intergenic
1024130888 7:46352149-46352171 AGAGAGAAAGAGAAAGGGGAGGG + Intergenic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024584788 7:50832697-50832719 ACTCAGAAGCAGACAGGGCATGG + Intergenic
1027232562 7:76281411-76281433 GGAGAGAGGCAGACAGGGCACGG - Intronic
1027440779 7:78217003-78217025 ACAGACATGCACACAGGGGATGG + Intronic
1027480114 7:78685142-78685164 AAAGAAAATCAGACAGGAGAAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028139041 7:87252138-87252160 AGGGAGAAGCAGACATGGAAAGG + Intergenic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029449412 7:100632528-100632550 AGAGAGAAACAGAGAAGGGAGGG - Intronic
1029522473 7:101072206-101072228 AAAGAAAAGAAGAGAGGGGAAGG + Intergenic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1030977294 7:116142710-116142732 GCAGAGATGCAGACAGAGGAAGG + Intronic
1032090047 7:128907051-128907073 GGAGAGAGGCAGACAGGTGAGGG + Intronic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033621311 7:143064207-143064229 CTAGAGAAGGAGACAGACGAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034169140 7:149049359-149049381 TTTGTGAAGCAAACAGGGGATGG - Intergenic
1036164782 8:6422561-6422583 ATAGAGAATGAGTCAGGGGCTGG - Intronic
1037204781 8:16303506-16303528 AAAGGAAAGCAGAGAGGGGAAGG - Intronic
1037588246 8:20292872-20292894 ATAGAGGCCCAGAGAGGGGAAGG - Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1039129176 8:34242208-34242230 AGAGAGAAGGAGAGATGGGAAGG + Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039560390 8:38507939-38507961 AGAGAGGAGAAGAGAGGGGAAGG - Intergenic
1040031769 8:42831515-42831537 ATAAAGGAGCAGACAGGGCCAGG - Intergenic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041909451 8:63072858-63072880 AGAGAGAAGAGGAGAGGGGAGGG + Intronic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1045048339 8:98300569-98300591 ATAGAGAGGCTGACAGGGCCAGG + Intergenic
1045714843 8:105029618-105029640 TTAATGAAGCAGACAGTGGAGGG - Intronic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1047814444 8:128447655-128447677 AAAGAGGTGCAGACAGGGTAAGG + Intergenic
1047857752 8:128930946-128930968 TTCCAGAAGCAGACAGGGAAAGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049447849 8:142639651-142639673 GTGGAGCAGCAGACTGGGGATGG + Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049633473 8:143672564-143672586 AGAGAGAAAGAGAGAGGGGAGGG - Intergenic
1050729814 9:8696185-8696207 AGAGAGAAGAGGACACGGGATGG + Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1052520463 9:29541490-29541512 AGAGAGAAGGAGAAAAGGGAGGG - Intergenic
1052876939 9:33574557-33574579 CTAGGGATGCAGACAGAGGAGGG - Intergenic
1055514025 9:77019498-77019520 AGAGAGAAGCAGAGAGGGCCTGG + Intergenic
1055737482 9:79347227-79347249 ATTGAGGAGGAGAGAGGGGATGG - Intergenic
1055856523 9:80694534-80694556 AAAGAGAAGGAGACAGGAGTAGG + Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056112283 9:83407917-83407939 AAAGAGAAAGAGAAAGGGGAGGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056266485 9:84901760-84901782 ATGGAGAAGAAGCCAGGGGAGGG - Intronic
1056939912 9:90946182-90946204 ATTGAGAAGAGGGCAGGGGAAGG + Intergenic
1057055813 9:91959858-91959880 AGAGAGAAGCAGGCTGGGCACGG - Intergenic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057810486 9:98253444-98253466 ATAGAGAAGAAACTAGGGGAAGG - Intronic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058026895 9:100150917-100150939 TAAGAGAACCAGAGAGGGGATGG + Intronic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058782442 9:108351889-108351911 ATACAGAAGGAGATAGGTGAGGG - Intergenic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1060066446 9:120505379-120505401 AGAGGGAAGGAGACAGGGAATGG - Intronic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1203473670 Un_GL000220v1:131595-131617 AGAGAGAAACAGACAGGGAGGGG - Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185604604 X:1360868-1360890 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604609 X:1360892-1360914 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604614 X:1360916-1360938 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604624 X:1360962-1360984 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604629 X:1360986-1361008 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604639 X:1361032-1361054 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604644 X:1361056-1361078 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604649 X:1361080-1361102 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604654 X:1361104-1361126 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185604659 X:1361128-1361150 AGAGAGAGACAGAGAGGGGAAGG - Intronic
1185807709 X:3075706-3075728 AGAGACAAGCAGACAGAGAAAGG - Intronic
1187172238 X:16863374-16863396 ATAGAGCAGCACTCCGGGGAAGG + Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189819971 X:44860865-44860887 AATGAGAAACAGACAGGGTAAGG - Intergenic
1189846725 X:45145345-45145367 AAAGAGAGGCAGACATGGGCGGG + Intergenic
1190049768 X:47141034-47141056 AGAGAGAAGCAGAGAGGACAGGG + Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190561171 X:51686805-51686827 ATAGAGTTGCAGACATGGGTAGG - Intergenic
1190563120 X:51706512-51706534 ATAGAGTTGCAGACATGGGTAGG + Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190842190 X:54155536-54155558 ATTGAAAAGCAAACAGGGGAAGG + Intronic
1190980132 X:55450040-55450062 ATAGAGGAGCACAGTGGGGAAGG + Intergenic
1191688968 X:63920697-63920719 AAACAGGATCAGACAGGGGATGG - Intergenic
1191979293 X:66908300-66908322 ATAGAGAAGCCCACATGGCAAGG - Intergenic
1192093153 X:68182388-68182410 AGAGAGAAAGAGAGAGGGGAAGG + Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1193979893 X:88169144-88169166 CTGGAGAAGCAGTTAGGGGAGGG + Intergenic
1194530372 X:95040482-95040504 ATATAGAAGAAGATATGGGAAGG - Intergenic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1195002055 X:100651340-100651362 TTTGAGAACCAGAAAGGGGAGGG + Intronic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1195626478 X:107009504-107009526 ATAGTGAAGGGGACAAGGGACGG + Intergenic
1195655297 X:107326811-107326833 ATAGTGAAGGGGACAAGGGACGG + Intergenic
1196099670 X:111834454-111834476 AGAGAGAGACAGAGAGGGGAGGG - Intronic
1196346992 X:114674489-114674511 GTAGAGAAGCAGATAGGAAAAGG - Intronic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1196872140 X:120122750-120122772 AGAGAGAAGCAAGCAGGGTAGGG + Intergenic
1197521835 X:127508533-127508555 AGAGAGAAGCAGACAGAATATGG - Intergenic
1197730329 X:129804303-129804325 AAAAAGAAGCAGACAGGAGAGGG + Exonic
1197854041 X:130895697-130895719 ACAGAGCACCAGAAAGGGGAGGG + Intronic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1198323423 X:135542528-135542550 AGAGAGAAGGAGAGAAGGGAGGG + Intronic
1198859340 X:141052917-141052939 AGAGAGATTCAGAGAGGGGATGG - Intergenic
1198903355 X:141534475-141534497 AGAGAGATTCAGAGAGGGGATGG + Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199598811 X:149528444-149528466 AAAGAGAAAAAGAGAGGGGAAGG - Intronic
1199879743 X:151964495-151964517 ATCTAGAAACAGACAGGCGATGG + Intronic
1200627093 Y:5532792-5532814 AGAGAGAAACAGAAAAGGGAAGG - Intronic
1201075399 Y:10183183-10183205 AGAGAGAAACAGACAGGGAGGGG - Intergenic
1201271134 Y:12255060-12255082 ATAGACAAGCAGACAGAGAGGGG + Intergenic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic