ID: 1146567862

View in Genome Browser
Species Human (GRCh38)
Location 17:33928767-33928789
Sequence GCAGATCCACAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146567852_1146567862 23 Left 1146567852 17:33928721-33928743 CCATGTGGGAGTCCAGGGAGTCA 0: 1
1: 1
2: 1
3: 19
4: 181
Right 1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 292
1146567855_1146567862 11 Left 1146567855 17:33928733-33928755 CCAGGGAGTCAGCGGGTGCCAGC 0: 1
1: 1
2: 0
3: 17
4: 263
Right 1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 292
1146567858_1146567862 -7 Left 1146567858 17:33928751-33928773 CCAGCAGGAAAATGGAGCAGATC 0: 1
1: 1
2: 0
3: 24
4: 202
Right 1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG 0: 1
1: 0
2: 0
3: 27
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146567862 Original CRISPR GCAGATCCACAGATGGAGGA GGG Intronic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900930743 1:5735403-5735425 GCAGATTTACAAATGGTGGAGGG - Intergenic
901131020 1:6962635-6962657 GCAGGTCCACAGAGGAAAGAGGG - Intronic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
905046836 1:35010885-35010907 GCAGAGCCACGGATGGAGCTGGG + Exonic
905086804 1:35387129-35387151 GCAGAGCTACTGATGGAGGTGGG - Exonic
908020620 1:59894367-59894389 GAAGAACCACTGAAGGAGGAAGG - Intronic
908119397 1:60971476-60971498 ACAGATAGACAGATGGATGATGG + Intronic
909118857 1:71575117-71575139 GCTGATCTACAGAGAGAGGAAGG + Intronic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
916451590 1:164926294-164926316 TCAGATGCACAGATGGGGGTAGG + Intergenic
916608940 1:166371220-166371242 GCAGATGAAGAGATGAAGGAGGG + Intergenic
916719964 1:167477391-167477413 ACAGACCCAGAGATGGAAGATGG + Intronic
917514080 1:175692473-175692495 GCAGATGGAAAGATGGATGAAGG - Intronic
918303821 1:183228105-183228127 GCAGCTCCACAGAAGTAGTAAGG - Intronic
919155778 1:193764428-193764450 GCTGATCCACAAATGAAGGATGG - Intergenic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
921304747 1:213784676-213784698 GTAGATCCACAGATGAAAGCTGG + Intergenic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921463830 1:215461658-215461680 ACATATCCCCTGATGGAGGAGGG - Intergenic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922766919 1:228160748-228160770 ACAGAACCAAAGGTGGAGGAAGG - Intergenic
922798494 1:228353233-228353255 GGAGAGCCACAGATGGTAGACGG + Intronic
924110292 1:240692153-240692175 ACAGAACAAGAGATGGAGGACGG + Intergenic
1063521699 10:6747369-6747391 GCAGCTCAGCAGATGGTGGAAGG - Intergenic
1064667058 10:17664855-17664877 ACAGATTCAGAGATGGTGGAAGG + Intronic
1066666905 10:37792045-37792067 GCAGATCTACCCATGGAGGAGGG + Intronic
1067237584 10:44464266-44464288 TCAAATTCACAGATGCAGGAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1068417351 10:56741161-56741183 GCATAACCACATATGGAGAAGGG - Intergenic
1070416708 10:76197306-76197328 GCAGAAGGTCAGATGGAGGAAGG - Intronic
1070753540 10:78977673-78977695 GAAGACCCACAGAGGGAAGAAGG - Intergenic
1075064512 10:119280454-119280476 TCAGAACCACCTATGGAGGATGG - Intronic
1076900644 10:133335900-133335922 GCAGATGGACAGATGGATGGCGG + Intronic
1076992834 11:284631-284653 GCAGACCCTCAGGTGGAGGCAGG + Exonic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077590710 11:3488901-3488923 GCAGCCCCACAGATGGAGTTGGG + Intergenic
1083325501 11:61871054-61871076 GGAGACCTACAGATGGAGAAGGG + Intergenic
1083387076 11:62319085-62319107 GAAGATCCAGAGAAGGAGGGAGG + Intergenic
1083714272 11:64566960-64566982 GCAGACCCTGAGATGGAGAAGGG + Intronic
1084342566 11:68515982-68516004 GCAGAACAGGAGATGGAGGACGG - Intronic
1084398717 11:68931492-68931514 GCAGATCCACAGCTGCAGTTTGG + Intronic
1085703003 11:78761837-78761859 GCACATCCACAGTGGGAGGTTGG - Intronic
1088650672 11:111955401-111955423 GCTGATCCAGAGCTGGAGCAGGG + Intronic
1090083326 11:123629081-123629103 GCATATCCACAGATTGGGTATGG + Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090425186 11:126602669-126602691 GCGGATCCACAGCTGGGGCAGGG - Intronic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1091760714 12:3085414-3085436 GCAGATGCACAGAGGAAAGACGG - Intronic
1091833417 12:3567117-3567139 GTTGATCCACAGATGGAGAGGGG - Intronic
1092416993 12:8297808-8297830 GCAGCCCCACAGATGGAGTTGGG + Intergenic
1092510976 12:9156359-9156381 CAAGATCCAGAGATGGAGGAAGG - Intronic
1093000524 12:13990863-13990885 ACAGATACACAGAAGGATGAGGG + Intergenic
1095951193 12:47782956-47782978 GAAGATACAGACATGGAGGAGGG - Exonic
1095969979 12:47894877-47894899 GTGGATCCACAGGTGGAGGCAGG - Intronic
1098603846 12:72365976-72365998 GAAGATGCAAAGATGGAGAAAGG - Intronic
1100930942 12:99608853-99608875 GCTGACCAACAAATGGAGGAGGG + Intronic
1102552470 12:113701860-113701882 GCACAGCCACAGAGGCAGGAGGG - Intergenic
1102652773 12:114454512-114454534 GCAGGACCACAGTGGGAGGAGGG + Intergenic
1103208327 12:119148038-119148060 GCAGATGCACAGTTGCGGGATGG + Intronic
1103273384 12:119691467-119691489 GCAGATGCTCAGAAGGTGGATGG + Intronic
1104240893 12:126988297-126988319 GCAAACCCACAGAGGGAAGAGGG + Intergenic
1104956352 12:132468148-132468170 GCAGATCCACAGAGAGATGCAGG + Intergenic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1108522931 13:51261213-51261235 GGAGATCCACATGTGGGGGAAGG + Intronic
1109663236 13:65493322-65493344 GCAGAAACACAGATGGAGTTGGG + Intergenic
1109852135 13:68079309-68079331 GCAGAACCACAAAGGGAGGATGG - Intergenic
1110154483 13:72297916-72297938 GTAGAGCCATAGATGGAGAAGGG - Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1111959155 13:94790670-94790692 GCAGATCCACAGATGGCATAAGG + Intergenic
1113681850 13:112250052-112250074 GCAGACCCTCGGATGGAGGTGGG - Intergenic
1113943624 13:114031918-114031940 GCAGAACCTCGGATGGAGCAGGG + Intronic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1114430245 14:22654599-22654621 GCAGATCCCCAGAAGCAGCAGGG + Intergenic
1114453118 14:22839100-22839122 GCAGAACGACAGAAGGAAGATGG - Intronic
1114629386 14:24149420-24149442 GCAGAACCACAGAGGAAGCAGGG - Exonic
1115718827 14:36137143-36137165 GCAGAAACACAAAGGGAGGAAGG + Intergenic
1115995434 14:39190842-39190864 CAAGATCCACAGATGTAAGAAGG - Intergenic
1116977187 14:51129408-51129430 TCAGATCTACAGATGCAAGAAGG + Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1121779713 14:96614496-96614518 ACTGATCCACAGATGACGGATGG + Intergenic
1123998925 15:25738374-25738396 GCAGTTCTACAGATGGATGGTGG + Intronic
1124831545 15:33154081-33154103 GCAGCTCCACAGAGGCAGGAGGG - Exonic
1126837568 15:52682313-52682335 TCACATTCACAGATGGGGGATGG - Intronic
1127284426 15:57520000-57520022 AGAGATCCACAGATGGGGGTGGG - Intronic
1127862663 15:63007273-63007295 GGAGACACACAGAGGGAGGAAGG + Intergenic
1131074649 15:89487339-89487361 GCAGAGCCACCCAGGGAGGAGGG - Intronic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1134205451 16:12233796-12233818 GCACATCCACAGAGACAGGAAGG - Intronic
1134233744 16:12449606-12449628 GGAGATGCACAGCTGGAGCACGG - Intronic
1134901083 16:17938639-17938661 GCAATTCCACAGATTAAGGAGGG - Intergenic
1135420206 16:22300717-22300739 ACAGTCCCAGAGATGGAGGATGG - Intronic
1139515817 16:67451803-67451825 GCACAACCACAGCTGGAGGTTGG - Intronic
1139637681 16:68268015-68268037 GCAGAGCCACATATGGGGGAAGG - Intronic
1140860325 16:79012574-79012596 GAAGATCCACATATGGCTGAGGG + Intronic
1141462635 16:84186829-84186851 GCGGACCCGCAGATGTAGGAGGG - Intronic
1203143106 16_KI270728v1_random:1781825-1781847 GTGGATCCCCAGATGGAGGATGG + Intergenic
1203143147 16_KI270728v1_random:1782105-1782127 GTGGATCCCCAGATGGAAGATGG + Intergenic
1203143170 16_KI270728v1_random:1782250-1782272 GTGGATCCCCAGATGGAGTATGG + Intergenic
1142468003 17:147033-147055 GCAGACAGACAGGTGGAGGATGG - Exonic
1142680140 17:1542675-1542697 ACAGATGCACAGATGGGGAAGGG + Intronic
1143203304 17:5126955-5126977 GCAGATCCCAAGATGGAAGCTGG - Intronic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1148817358 17:50339366-50339388 GCAGACCCAGAGTTAGAGGATGG + Intergenic
1149435814 17:56632320-56632342 GCAGATCCACAGTTCCAGAAAGG + Intergenic
1149848688 17:60022195-60022217 GCAGATCCCAAGATGGAAGCCGG + Intergenic
1149853028 17:60052759-60052781 CCAGTTCCAAAGATGGATGAAGG - Intronic
1149861481 17:60124329-60124351 GCAGATCCCAAGATGGAAGCCGG - Intergenic
1150541820 17:66109080-66109102 GCAGATCGACAGTAGGATGATGG + Intronic
1151326632 17:73383742-73383764 GGAGAGGCACACATGGAGGAGGG + Intronic
1151444094 17:74152089-74152111 GCAGGGCTACAGATGGAGCAAGG - Intergenic
1152005124 17:77675821-77675843 GCAGAATCTCAGATGGAGGAGGG - Intergenic
1152024948 17:77802891-77802913 GCAGCTTCAGAGATGGGGGAGGG - Intergenic
1154074588 18:11187791-11187813 CCAGCTCGGCAGATGGAGGAGGG + Intergenic
1155505455 18:26528549-26528571 GCAGAGCAGCAGCTGGAGGAAGG - Intronic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1157201505 18:45663811-45663833 GCAGGCCCAAAGGTGGAGGAGGG + Exonic
1157432869 18:47644049-47644071 GCAGATGCACTCATGGTGGAAGG + Intergenic
1158323286 18:56287171-56287193 GAAGATCTGCTGATGGAGGAGGG - Intergenic
1159274225 18:66194278-66194300 GCAGATCTACAGAAGGAGGGTGG - Intergenic
1160483156 18:79261500-79261522 GCAGATCCAGAGCTGGAGAGAGG + Intronic
1160688209 19:447257-447279 GCCGATCCACAGAGGCAGGAAGG + Intronic
1160726662 19:620652-620674 CCATAGCCACGGATGGAGGATGG + Intronic
1160730064 19:637832-637854 GCCCATCCACAGAGGCAGGAAGG + Intergenic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1160881189 19:1321397-1321419 GCAGATCCACAGAGACAGGGAGG - Intergenic
1161140503 19:2644662-2644684 GCCGATCCACAGAGGCAGGGAGG - Intronic
1161219410 19:3111358-3111380 ACCGATCCACAGAGGCAGGAAGG - Intronic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161736799 19:5996501-5996523 GCCGATCCACAGAGGCAGGAGGG + Intronic
1162015451 19:7844444-7844466 TCAGAACCACAGATGGAGTTGGG - Intronic
1162582853 19:11540919-11540941 CCAGATCCATAGTTGGGGGATGG - Intronic
1162764331 19:12909145-12909167 GAAGATACAAAGATGAAGGATGG - Intronic
1162880115 19:13652520-13652542 GTAGAACAAAAGATGGAGGAAGG - Intergenic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1163220336 19:15914101-15914123 TCAGATAAACAGATGAAGGAGGG + Intronic
1163230592 19:15999017-15999039 GCAGGTCCCCACATGAAGGAGGG - Intergenic
1163374439 19:16921737-16921759 CCAGCTCCAGAGATGGAGGTTGG - Intronic
1164562741 19:29304049-29304071 GGAAATCCAGAGGTGGAGGAAGG + Intergenic
1164718170 19:30408850-30408872 GAAGATCGATGGATGGAGGATGG - Intronic
1165167889 19:33870173-33870195 CCAGCTCCACCAATGGAGGAAGG + Intergenic
1166316035 19:41990906-41990928 GCAGAGACAGAGATAGAGGAAGG - Intronic
1166811524 19:45517359-45517381 ACAGATGAACAGATGGGGGAGGG - Intronic
1167529431 19:50005817-50005839 GCAAATCCACGGAGGGAGAAAGG + Intronic
1168241015 19:55088896-55088918 GGAGATCCAAAGAGGAAGGAAGG - Intergenic
1168249131 19:55131493-55131515 GCAAATCCACAGAAGTAGGAAGG - Intergenic
925558020 2:5153510-5153532 GGAGATCCACAGGAGGAGGCAGG - Intergenic
925909980 2:8567445-8567467 GCAGATCCACAGCGTGTGGAGGG - Intergenic
926963463 2:18385115-18385137 GCTGATTCACAGATGGATGAAGG + Intergenic
927422585 2:22948749-22948771 ACAGGTCCACAGATGGAATAAGG + Intergenic
928212022 2:29330393-29330415 GCAGCTCCCCAAATGGAGGTGGG - Intronic
928751832 2:34479620-34479642 GGAGATCCTCTGTTGGAGGATGG - Intergenic
932809688 2:74814167-74814189 TCAGATCCACAGAGGGATGTTGG + Intergenic
935223170 2:101032233-101032255 CCAGATACACAGGAGGAGGAAGG + Intronic
935861090 2:107330450-107330472 GAAGACCAACAGATGGGGGAAGG - Intergenic
937851399 2:126639446-126639468 GCAGAAGCACAGAGGGAGGTTGG - Intergenic
938802230 2:134774004-134774026 ACTGATTCACAAATGGAGGAGGG + Intergenic
938926525 2:136048167-136048189 GCAGATTCACAGATGGAATTTGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940789730 2:158019353-158019375 ACAGATCCATTGCTGGAGGACGG + Intronic
940913391 2:159228676-159228698 GCACAGCCAGAGAGGGAGGAAGG - Intronic
942833237 2:180262134-180262156 GCGGAGCCACAGATAGATGAAGG - Intergenic
943753622 2:191536063-191536085 GCAGACACACAGATGGAGTTAGG + Intergenic
945163535 2:206918518-206918540 GCAGATGCACAGATGCATAAGGG - Intergenic
946314142 2:218898284-218898306 GCAGACCCGCAGGCGGAGGAGGG - Intronic
947895914 2:233671961-233671983 GCAGACACACACATAGAGGAAGG - Exonic
948069341 2:235107020-235107042 GCAGCCCCACAGATGGGGGTCGG - Intergenic
948584227 2:239009014-239009036 GGAAAATCACAGATGGAGGAAGG - Intergenic
1169404941 20:5315262-5315284 GCAGATCCAAAGTTGGAGTAGGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1170363679 20:15576397-15576419 GGAGATGCAGAGATAGAGGAAGG - Intronic
1171194378 20:23186114-23186136 GCAGGGCCACAGAAGGAGAAGGG - Intergenic
1174442242 20:50565353-50565375 GCAGAGCCATGGCTGGAGGAGGG + Intronic
1174994147 20:55546505-55546527 TCAGATCCAAAGATGGATAAAGG + Intergenic
1175275037 20:57762586-57762608 GCAAATCTCCAGAGGGAGGAAGG - Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175863839 20:62164084-62164106 GCAGGTCCTCTGAGGGAGGAGGG + Intronic
1177316189 21:19464223-19464245 GCAGAGCAAAACATGGAGGAAGG - Intergenic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1177820476 21:26025684-26025706 GCAGATGCAGGGATGGATGATGG - Intronic
1177938882 21:27384791-27384813 GCAGATTGTCAGATGGAGAAAGG - Intergenic
1178890864 21:36520183-36520205 ACAGACCCACAGAGGGAAGACGG - Intronic
1179469188 21:41599181-41599203 ACAGATCCCCAGATGGGGAAAGG + Intergenic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1180148754 21:45936867-45936889 GAAGATCCCCAGGAGGAGGATGG - Intronic
1181479124 22:23186577-23186599 TCAGAGACACAGATGGAGAATGG - Intronic
1181575223 22:23789899-23789921 ACAGCTCCACAGATGGCGCATGG - Intronic
1182524507 22:30907008-30907030 TCCCATCCACAGATGCAGGAGGG + Exonic
1182578900 22:31291939-31291961 GGAGAACCACAGAAGGAGGCTGG + Intronic
1183167792 22:36160728-36160750 GCAGATGCACGGCTGGAGGTGGG - Exonic
1185135579 22:49070005-49070027 GCAGATCTACAGATAGAGGGTGG - Intergenic
1185290143 22:50020349-50020371 GCACGTCATCAGATGGAGGAGGG - Intronic
949501977 3:4688641-4688663 GCAAATCTATAGAGGGAGGAGGG + Intronic
950046059 3:9949263-9949285 GCAGCTCCTCAGCAGGAGGAAGG + Exonic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
950689981 3:14647839-14647861 TCAGATCCAGCGAGGGAGGAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953578691 3:44134209-44134231 GGAAATCAAGAGATGGAGGAAGG - Intergenic
954107799 3:48418681-48418703 GCAGAGCCAGAAATGGAGTATGG + Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954621545 3:51998989-51999011 GCAGATTCAGAGATGGACGATGG + Intergenic
955864119 3:63364002-63364024 GCAGATCCCCTGATGTAGAAGGG + Intronic
955945143 3:64186738-64186760 GCAGATAAATAGATTGAGGAAGG + Intronic
957050124 3:75405209-75405231 GCTTATCCACAGATGCGGGACGG + Intergenic
957060732 3:75479424-75479446 GCAGCCCCACAGATGGAGTTGGG + Intergenic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
960458936 3:117909147-117909169 GCAGATCAGCTGTTGGAGGATGG + Intergenic
960673321 3:120172313-120172335 GCATGTCTACAGATGGAGAAGGG - Intronic
961086048 3:124068242-124068264 TGAGTTCCACAGATGGAGGTGGG - Intergenic
961292643 3:125859977-125859999 GCAGCCCCACAGATGGAGTTGGG - Intergenic
961791864 3:129382086-129382108 CTAGAACCTCAGATGGAGGAAGG + Intergenic
961805887 3:129489045-129489067 CTAGAACCTCAGATGGAGGAAGG + Intronic
961882441 3:130071646-130071668 GCTTATCCACAGATGCAGGACGG + Intergenic
962432033 3:135328840-135328862 GCAGATGCACAGAAGGAGCCTGG + Intergenic
962637141 3:137342826-137342848 GCTGATCCTCAGATGGAAGCAGG + Intergenic
963062549 3:141236116-141236138 GGAGCTCCACTGATGGAGGGAGG - Intronic
966270662 3:178101011-178101033 ACAGATTAACAGCTGGAGGAGGG - Intergenic
967661738 3:192119716-192119738 GCAGATTCAAAGCTGGAAGATGG - Intergenic
968659359 4:1792863-1792885 GCAATTCCTCAGGTGGAGGAGGG - Intergenic
968985547 4:3872563-3872585 GCAGAGAGACAGAGGGAGGATGG + Intergenic
969364894 4:6688703-6688725 GCAGGGCCACAGGCGGAGGAAGG + Intergenic
969748232 4:9090660-9090682 GCAGCCCCACAGATGGAGTTGGG - Intergenic
969809260 4:9635219-9635241 GCAGCCCCACAGATGGAGTAGGG - Intergenic
970271030 4:14347814-14347836 GTAGAAGCACAGATGTAGGAAGG - Intergenic
971380891 4:26096619-26096641 TCAGATCCACATTAGGAGGAAGG - Intergenic
972842565 4:42948791-42948813 TCAGAATCAGAGATGGAGGAAGG + Intronic
975655853 4:76640691-76640713 GCCGTTCTACAGATGGAGAATGG + Intronic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977312504 4:95404831-95404853 GCAGATCAGCAGATGGATGGTGG + Intronic
977486009 4:97647580-97647602 GCAGATAGACAGATAGAGAATGG - Intronic
977752385 4:100624871-100624893 GCAGATGATCAGATGCAGGAGGG + Intronic
980352861 4:131703517-131703539 GCAGATAAAAAGATGGGGGAGGG - Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
982411224 4:155079810-155079832 GCAGGTCAAGAGATGGAGGCAGG + Intergenic
984294134 4:177832107-177832129 ACAGGTCCACAGAAGGTGGACGG - Intronic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
987349512 5:17009372-17009394 ACAGATACACAGATGATGGATGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992770432 5:80042321-80042343 GCTGATCCACAGATGAAGAACGG - Intronic
993528845 5:89000817-89000839 GCATATCTACAGATGGACTATGG - Intergenic
995061645 5:107817184-107817206 GGAGCTCCAGAGATGGAGGTGGG + Intergenic
997626403 5:135334094-135334116 CCCGTTCCACAGATGAAGGAGGG - Exonic
998819398 5:146044653-146044675 GCAGAGGGACAGAGGGAGGAAGG - Intronic
999379413 5:151109849-151109871 GCAGAGCCCCAGTTGGAGCAAGG + Intronic
1000004938 5:157174946-157174968 ACCCATCCACAGATGGGGGAGGG - Intronic
1000396254 5:160777442-160777464 GGAAATCCAAAGATGGAAGATGG + Intronic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1001967046 5:175917663-175917685 GCAGAACCACAGATGGTGGGAGG - Intergenic
1002249889 5:177921549-177921571 GCAGAACCACAGATGGTGGGAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1003955175 6:11156556-11156578 GGAAATCCAGAGATGTAGGAAGG + Intergenic
1004015505 6:11728342-11728364 GCAGATCTCCAGATGGAAGCGGG - Intronic
1006078140 6:31547551-31547573 GCAGAGACGCAGGTGGAGGACGG - Intronic
1009034064 6:58095068-58095090 TCATACCCACAGATGAAGGATGG - Intergenic
1009059710 6:58384351-58384373 GCAGAGCTAAAGATGGAAGAGGG - Intergenic
1009469157 6:64010339-64010361 GCAAATGCACACATGGAGGCTGG - Intronic
1011487632 6:87859335-87859357 GCAGAACCACAGAAGTTGGAGGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1012715319 6:102661220-102661242 GCAGATCCAGAGATGGTGTCTGG - Intergenic
1013052879 6:106554315-106554337 TCAAATACACAGATGGAGGCCGG + Intronic
1013176293 6:107680112-107680134 GCAGATCCTGAGCTGGAGCAAGG + Intergenic
1016029839 6:139325916-139325938 GCCGTTCCACAGAGGAAGGAGGG - Intergenic
1017718306 6:157227515-157227537 GCACATCCACACATGGAGACTGG + Intergenic
1019167343 6:170107386-170107408 GGAAAGCCACAGATGGAAGAGGG - Intergenic
1021210525 7:17846837-17846859 GCGGCTCCACAGATACAGGATGG + Intronic
1023832407 7:44047268-44047290 GCAGATGCTTAGATGAAGGATGG + Intronic
1024535405 7:50426880-50426902 CCAGGTCCACAGATCAAGGAAGG - Intergenic
1026092048 7:67308412-67308434 GCAGATACACAGTTGGATGTTGG + Intergenic
1027552131 7:79612282-79612304 ACTGATCCACAGATGCAAGAGGG + Intergenic
1028147004 7:87329725-87329747 GCAGCTCCCAAGATGGAGGGGGG + Intergenic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1031205486 7:118751819-118751841 GCAGAGGAACAGATGCAGGAGGG - Intergenic
1032421767 7:131786102-131786124 GCTGCTCCACAGACAGAGGAGGG + Intergenic
1033429352 7:141274786-141274808 GCAAAGGCACAGCTGGAGGAGGG + Intronic
1034292494 7:149944157-149944179 CCTGATCCACAGCTAGAGGATGG - Intergenic
1034470655 7:151252658-151252680 CCAGCTCCAGAGAGGGAGGAGGG + Intronic
1034532586 7:151705914-151705936 GCAGGTGCACAGATGGGGGGCGG - Intronic
1034813573 7:154152735-154152757 CCTGATCCACAGCTAGAGGATGG + Intronic
1034923651 7:155103605-155103627 GCAGAGCCACAGACAGAGGCAGG + Intergenic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1036208328 8:6821652-6821674 GCAGGGCCACAGCTGGAGGTTGG + Intronic
1038412713 8:27370587-27370609 GCAGATCAGCAGATAGAGGATGG - Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1038629238 8:29225190-29225212 GCAGGGCCACATGTGGAGGACGG + Intronic
1039883809 8:41644314-41644336 GCATCTTCACAGATGGAGGGTGG + Intergenic
1039909070 8:41809980-41810002 GGGGATCCACAGATGTGGGAAGG + Intronic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1043231178 8:77803317-77803339 GCTTATTCACAGATGGAGCACGG + Intergenic
1047207992 8:122818856-122818878 GGACCTCCACAGATAGAGGATGG + Intronic
1048606039 8:135969936-135969958 GCAGATCTAGAGAGAGAGGATGG + Intergenic
1049062792 8:140289014-140289036 GGACACACACAGATGGAGGAAGG + Intronic
1049155314 8:141062628-141062650 GTAGATAGACAGATGGGGGAGGG + Intergenic
1049181017 8:141222228-141222250 GCAGCTTCACAGAGGCAGGAAGG + Intronic
1050425522 9:5508999-5509021 GCAGATCCCCAGAGGAAGCACGG + Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052861275 9:33439364-33439386 GCAGAACCAGAGATGGGGGTGGG - Intergenic
1053158615 9:35797528-35797550 GCGGGTCCACAGATAGAGGCAGG + Intronic
1053779856 9:41596218-41596240 GCAGATAAAAAGATGGGGGAGGG + Intergenic
1054167813 9:61806460-61806482 GCAGATAAAAAGATGGGGGAGGG + Intergenic
1054669732 9:67774443-67774465 GCAGATAAAAAGATGGGGGAGGG - Intergenic
1055793615 9:79949961-79949983 GCAGACCCAGGGATGGAGAAGGG + Intergenic
1059378204 9:113902171-113902193 TCAGAGCCACACAGGGAGGAAGG - Intronic
1059958752 9:119544878-119544900 GGAAATCATCAGATGGAGGAGGG - Intergenic
1061504362 9:131022973-131022995 GCAAATCCACAGAGACAGGAAGG - Intronic
1062133339 9:134912166-134912188 GCAGATCAACAGCTGGAGATGGG + Intronic
1203585776 Un_KI270747v1:2136-2158 ACAGATGCAGAGAGGGAGGATGG + Intergenic
1186603189 X:11060671-11060693 GCAAATCCACACATGGAGAGAGG - Intergenic
1188980603 X:36723716-36723738 GGAGATGCACATTTGGAGGAAGG + Intergenic
1190311939 X:49122892-49122914 GGAGATCCAGACATGGAGTAGGG - Intronic
1193767262 X:85545023-85545045 GCAGATTCCTAGAGGGAGGAGGG - Intergenic
1197153471 X:123245237-123245259 GCAGACACATAGGTGGAGGATGG + Intronic
1199984262 X:152939044-152939066 GGAGGGCCACAGATGGAGCAGGG + Intronic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic