ID: 1146568132

View in Genome Browser
Species Human (GRCh38)
Location 17:33930805-33930827
Sequence GCAGACCCACAGGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146568127_1146568132 -7 Left 1146568127 17:33930789-33930811 CCAGCAGGAAAATGGAGCAGACC 0: 1
1: 1
2: 1
3: 19
4: 387
Right 1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 193
1146568122_1146568132 23 Left 1146568122 17:33930759-33930781 CCATGTGTGAGTCCAGGGAGTCA 0: 1
1: 1
2: 2
3: 16
4: 143
Right 1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 193
1146568124_1146568132 11 Left 1146568124 17:33930771-33930793 CCAGGGAGTCAGCTGGTGCCAGC 0: 1
1: 1
2: 4
3: 28
4: 263
Right 1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146568132 Original CRISPR GCAGACCCACAGGTGGTGGA GGG Intronic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
902538600 1:17136508-17136530 AGATCCCCACAGGTGGTGGAAGG - Intergenic
902707685 1:18217015-18217037 CCAGACCCACAGCAGGGGGAGGG + Intronic
903012857 1:20343316-20343338 GCGGGCCGCCAGGTGGTGGAAGG - Exonic
904026281 1:27505587-27505609 GCAGACCCGCAGGTGGAAGGAGG - Intergenic
904856028 1:33498880-33498902 GCAGACCCAAAGGTAGGGGCAGG + Intergenic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
906738863 1:48161102-48161124 GCAGAACTACACGTGGTGGGAGG + Intergenic
907439203 1:54468503-54468525 GCAGACCCAGAGGTCTAGGAGGG + Intergenic
907947630 1:59150179-59150201 CCAGTTCCACTGGTGGTGGAAGG - Intergenic
908200281 1:61788249-61788271 GGAGACATCCAGGTGGTGGAGGG + Intronic
912707725 1:111927344-111927366 TCACACCCATAGGTGGAGGAGGG + Intronic
912935953 1:114003693-114003715 GCAGAACCATAGGCGGGGGAAGG - Intergenic
914361228 1:146938285-146938307 GCAGACGCACAGGAGTCGGAAGG - Intergenic
914491359 1:148152337-148152359 GCAGACGCACAGGAGTCGGAAGG + Intergenic
915200317 1:154221658-154221680 GCAAGCCCACGGGTGGAGGATGG - Intronic
915515748 1:156411527-156411549 GCAGGACCACAGGTGGTAGTTGG + Intronic
920945884 1:210528203-210528225 CCAGACCCAGGGGTGGTGCAGGG + Intronic
922473199 1:225889046-225889068 GCAGAGCCACAGGGGCTGCATGG + Exonic
922575761 1:226659719-226659741 GCAGACCTGCAGGTGGGGCAGGG + Intronic
922602940 1:226870771-226870793 GCAGACCCACAGCCGGGGAAGGG - Intronic
922766919 1:228160748-228160770 ACAGAACCAAAGGTGGAGGAAGG - Intergenic
922798494 1:228353233-228353255 GGAGAGCCACAGATGGTAGACGG + Intronic
1063028201 10:2204112-2204134 TCAGACCCACATGAGGTGCAAGG + Intergenic
1063462068 10:6221363-6221385 GCAAACTGAGAGGTGGTGGAGGG - Exonic
1065746323 10:28845807-28845829 GCAGACCTGGAGGTGATGGAGGG - Intergenic
1066783756 10:38979768-38979790 GCAGAGGCACAGGTGGTGACAGG + Intergenic
1067217707 10:44316620-44316642 GCAGAGCCACGGGTGGTGGGAGG - Intergenic
1067639351 10:48031615-48031637 GCAGAGGCACAGGTGGTGGCAGG - Intergenic
1069853315 10:71424552-71424574 GCACACCCTCAGCTGGGGGAAGG - Intronic
1069984939 10:72276603-72276625 GCACACACACAGGTGAGGGAAGG + Intergenic
1070314279 10:75295346-75295368 GCAGACCCAGAGGTTGAGGGGGG + Intergenic
1070719607 10:78746961-78746983 GCAGACCCACAGGGTGAAGAAGG + Intergenic
1072737253 10:97887579-97887601 CCAGACCCAGACGTGGTGCAGGG + Intronic
1076131753 10:128018336-128018358 CCAGACCCCCAGGGGCTGGATGG + Intronic
1076156253 10:128207781-128207803 GCAGACCCACGGGAGGGGGCAGG - Intergenic
1076311411 10:129510363-129510385 GCAGAGCCACACCTGGTGGTGGG + Intronic
1076992834 11:284631-284653 GCAGACCCTCAGGTGGAGGCAGG + Exonic
1078406105 11:11071265-11071287 GCAAACCCACAGCTGGGAGAAGG - Intergenic
1080456857 11:32426881-32426903 CCAGTCCCGCAGGTGGAGGAGGG - Intronic
1080518888 11:33049358-33049380 AAACACCCACAGGTTGTGGAGGG - Intronic
1081595033 11:44453181-44453203 GCAGCCCCAGAGGTGGGGAAGGG - Intergenic
1081724413 11:45317827-45317849 GCAGTCCAACAGGTGGTAAAAGG - Intergenic
1083040652 11:59682098-59682120 AAACACCCACAGGTTGTGGAGGG + Intergenic
1083999752 11:66289605-66289627 GCAGACCCGGAGGTGGTGGTGGG + Intergenic
1084158929 11:67334030-67334052 GCAGAGGCAAAAGTGGTGGAAGG - Intronic
1085317592 11:75554866-75554888 GCAGAGCCACTGGTGGGGGCAGG - Intergenic
1085919201 11:80931597-80931619 ACAGACCCACAAGTGCTGAAGGG + Intergenic
1088645117 11:111911692-111911714 GCGGATCCAGGGGTGGTGGATGG + Exonic
1088732997 11:112699978-112700000 GCAGAACCAAAGCAGGTGGAGGG + Intergenic
1091793408 12:3284135-3284157 GAATACCCACATGGGGTGGAAGG - Exonic
1094498604 12:31004715-31004737 GAAGGCCCGCATGTGGTGGAAGG + Intergenic
1096676512 12:53229246-53229268 GCAGGCCCAGAGGTAGGGGATGG + Intronic
1097148081 12:56955257-56955279 GCAGACTGACAGGTGTGGGATGG + Intronic
1101317556 12:103643416-103643438 GCTGACTCACAGGAGGTGGGTGG - Intronic
1101559634 12:105844219-105844241 GCAGACCCACCTGTGCTGGGAGG + Intergenic
1103452452 12:121038881-121038903 GCAGCCCCACCGGGAGTGGAAGG - Exonic
1103924020 12:124413889-124413911 GAAGAGACACAGGTGGTGGCGGG + Intronic
1104968830 12:132522046-132522068 GCAGACCCACAGGCGCCGGCAGG - Intronic
1105545644 13:21348672-21348694 GGAGACCCACAGGTGGGGCCTGG - Intergenic
1108044449 13:46370166-46370188 GCAGAGGCACAGCTGGTGAACGG - Intronic
1108522931 13:51261213-51261235 GGAGATCCACATGTGGGGGAAGG + Intronic
1108647268 13:52442825-52442847 GCAGACACACAAGTAGTGAAAGG + Intronic
1117431662 14:55671297-55671319 GCAGACCCACATGTGAAGTATGG - Intronic
1119340942 14:73876998-73877020 GTAGACCCACAACTTGTGGATGG + Exonic
1121678986 14:95777018-95777040 GCAGCCCCCCAGGTGGTCGAGGG - Intergenic
1121736589 14:96222202-96222224 ACAGACCCACACGTGGGGCAGGG + Intronic
1122138893 14:99650389-99650411 GTGGACTCACAGGTGGGGGAGGG + Intronic
1122781950 14:104147456-104147478 GCAGACCCACAGGATGGGAATGG + Intronic
1122834646 14:104424850-104424872 TCTGACCCACAGCTGGTGGAGGG + Intergenic
1124624420 15:31299952-31299974 GCAGACCCCCAGGTGGCTGGAGG + Intergenic
1126735917 15:51732075-51732097 AAAGACCCACTGCTGGTGGAGGG + Intronic
1130851393 15:87797700-87797722 GAACACCCACAGGGTGTGGAAGG - Intergenic
1130902708 15:88219124-88219146 GCAGACCTACATGTGCAGGATGG + Intronic
1130994963 15:88898602-88898624 GGAGGACCACAGGTGGGGGATGG + Intergenic
1137541722 16:49367454-49367476 TCAGAGACACTGGTGGTGGAAGG - Intergenic
1139637681 16:68268015-68268037 GCAGAGCCACATATGGGGGAAGG - Intronic
1142468003 17:147033-147055 GCAGACAGACAGGTGGAGGATGG - Exonic
1142681568 17:1552353-1552375 GCAGACCCAAAGGGCGTTGATGG - Intronic
1143668039 17:8375889-8375911 GAAGACTCACAGGTGGGTGAAGG - Exonic
1143712582 17:8744666-8744688 GCAGAGCCACAGGTGGCTCAGGG + Exonic
1145222364 17:21099887-21099909 GAAGACGGACAGGTGGTGGCAGG - Intergenic
1145917804 17:28586387-28586409 GGAGACCCAGTGGTGGTGTAAGG + Intronic
1146079084 17:29761140-29761162 GCGGACTCACAGCTGGTTGATGG + Intronic
1146447348 17:32943004-32943026 GCAGACCCACACCAGGTGGATGG - Exonic
1146567862 17:33928767-33928789 GCAGATCCACAGATGGAGGAGGG + Intronic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1146721650 17:35128289-35128311 GGAGGCCCAAATGTGGTGGAGGG - Intronic
1147218607 17:38915124-38915146 GCAGCGCCCCAGGTGGTGGCGGG + Exonic
1147550340 17:41437446-41437468 GTGGGCCCACAGGTGGTGCAGGG + Exonic
1147927337 17:43953866-43953888 GCAGACGAGCAGGAGGTGGAAGG + Exonic
1147978626 17:44261670-44261692 GAAGAGCCTCAGGTGGGGGACGG - Intronic
1148817358 17:50339366-50339388 GCAGACCCAGAGTTAGAGGATGG + Intergenic
1152379059 17:79933066-79933088 GGAGGCCCACAGGTGGCGGAGGG + Exonic
1152386444 17:79977571-79977593 GCCGTCTCACAGGTGGGGGAAGG - Intronic
1152424206 17:80210226-80210248 GCAGTGCCCCTGGTGGTGGAGGG + Exonic
1152724067 17:81936725-81936747 GTAGGCCCCCAGGTGGGGGACGG - Intronic
1155073963 18:22339239-22339261 GCCGACCCACAGGAGTTAGAGGG + Intergenic
1157201505 18:45663811-45663833 GCAGGCCCAAAGGTGGAGGAGGG + Exonic
1158057434 18:53298417-53298439 GTAGTCCCACAGGAGGTGGAAGG + Intronic
1161010009 19:1955437-1955459 GCTGACCCACAGCCGGTGAAGGG - Intronic
1162697080 19:12484734-12484756 GAAGGCCCTCAGGTGGAGGAAGG - Exonic
1162776782 19:12984730-12984752 GGAGGCCCCCAGGTGGGGGAGGG - Intergenic
1163324338 19:16593434-16593456 GCAGACCTGCAGGTGGAGGCTGG - Intronic
1163633946 19:18429887-18429909 GCAGCCCCACAGGGGGAGGGAGG + Intronic
1165329820 19:35135277-35135299 ACAGCCCCACAGGAGGGGGAGGG + Intronic
1167394311 19:49217806-49217828 GAAGACGCACAGGTAGAGGAGGG - Intergenic
1167513479 19:49909356-49909378 GGAGCCACAGAGGTGGTGGAGGG + Exonic
1167831567 19:52027133-52027155 AAACACCCACAGGTTGTGGAGGG + Intronic
925909980 2:8567445-8567467 GCAGATCCACAGCGTGTGGAGGG - Intergenic
926244727 2:11114154-11114176 GCAGGCCCAAAGGTGGGAGAGGG + Intergenic
927188615 2:20500329-20500351 GCAGACCCCCAGGGGCAGGAAGG + Intergenic
927214771 2:20662063-20662085 CCAGACCCAGAGAGGGTGGATGG + Intergenic
928364453 2:30690495-30690517 GCTGAGCCACAGGTAGTGGATGG + Intergenic
929505515 2:42525106-42525128 AGAGACCCACAGGTGGGGGAGGG - Intronic
934654480 2:96110090-96110112 ACAGCCCAACAGGTGGTGGCAGG + Intergenic
935007138 2:99089792-99089814 GAAGACCCTCAGGTGGGGCAGGG - Intronic
935861090 2:107330450-107330472 GAAGACCAACAGATGGGGGAAGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936012473 2:108933799-108933821 GCAGCCCGTCAGGTGGGGGAGGG + Intronic
938626361 2:133113552-133113574 GGAAACCCACACCTGGTGGAAGG - Intronic
941365615 2:164607521-164607543 GGAAGCACACAGGTGGTGGAAGG + Intronic
942227740 2:173831793-173831815 GCTGACTCACAGATGCTGGACGG - Intergenic
943876411 2:193072766-193072788 CCAGGCCCACAGGTGGTGCTTGG + Intergenic
946314142 2:218898284-218898306 GCAGACCCGCAGGCGGAGGAGGG - Intronic
948069341 2:235107020-235107042 GCAGCCCCACAGATGGGGGTCGG - Intergenic
948438471 2:237969572-237969594 GCTGACCCCCAGGTGATGGATGG + Intronic
948600007 2:239102323-239102345 GCACCTGCACAGGTGGTGGAGGG - Intronic
1169347346 20:4839171-4839193 CCAGAGCCACAGGTGTTGGGAGG + Intergenic
1170913042 20:20593886-20593908 GCAGACCAGCTGGTGGTGGCAGG - Intronic
1171283001 20:23917200-23917222 GCAGAGCAGCAGGTGGTGGTTGG - Intergenic
1172997789 20:39083699-39083721 GCAGACCCAGATGTGGAGGGGGG + Intergenic
1173162715 20:40664296-40664318 GGAGACCCAGAGGAGGAGGAGGG - Intergenic
1174520529 20:51126757-51126779 GCAGAGGCAGAGGAGGTGGAAGG - Intergenic
1175753914 20:61517299-61517321 ACAGCCCCACAGGAGGTGGGAGG - Intronic
1179167652 21:38947254-38947276 GCAGACGCAGATGTGGTGGCTGG - Intergenic
1180049767 21:45325796-45325818 ACAGAACCACAGCTCGTGGAGGG - Intergenic
1181522996 22:23460050-23460072 GGAGCCCCCCAGGTGGAGGAAGG + Intergenic
1184438642 22:44495778-44495800 GGAGACCCACAGATGGTGCGTGG + Exonic
1184727432 22:46355113-46355135 GCTGCCCCACAGGTGGTTGCAGG + Intronic
1184927121 22:47650717-47650739 GAAGACTCAAAGCTGGTGGAGGG + Intergenic
1185305747 22:50114966-50114988 GCAAAGCCTCAGGTGGTGGCTGG - Intronic
949302976 3:2606058-2606080 GCAGACACACATGTAGTGCAAGG + Intronic
950462906 3:13135798-13135820 GCAGAGCCACTGGAGGGGGATGG + Intergenic
951179631 3:19644314-19644336 CCTGACCCACTGGTGGTGGATGG - Intergenic
953704310 3:45219815-45219837 GCAGTCCCACACATGGTGAAGGG + Intergenic
954948335 3:54446394-54446416 AAGGACCCACAGGTGGTGAAGGG + Intronic
958472715 3:94541772-94541794 GAACACCCACAGGTTGAGGAAGG + Intergenic
959128633 3:102322557-102322579 GCTGAGCCAAAGCTGGTGGATGG - Intronic
961635941 3:128332697-128332719 GCAGCCCCAGAGGTGGTGCTGGG + Intronic
961710391 3:128823871-128823893 CCAGAGCCATGGGTGGTGGAAGG - Intergenic
961817670 3:129559609-129559631 GAAGACCAACAGGTGGCGGGTGG - Exonic
967916051 3:194579136-194579158 GGAGTCCCACAGTTGGTGAATGG + Intergenic
968516200 4:1016658-1016680 GCAGACCCACAGGACGTGCGGGG - Intronic
969364894 4:6688703-6688725 GCAGGGCCACAGGCGGAGGAAGG + Intergenic
969589348 4:8112851-8112873 GCAGCCCAGCAGGTGATGGAAGG - Intronic
969809260 4:9635219-9635241 GCAGCCCCACAGATGGAGTAGGG - Intergenic
977121388 4:93106067-93106089 ACATAACAACAGGTGGTGGAAGG - Intronic
977400376 4:96524120-96524142 AAACACCCACAGGTTGTGGAGGG - Intergenic
978199061 4:106003929-106003951 GCAGCCTCTGAGGTGGTGGAGGG - Intronic
982508414 4:156249985-156250007 GAAGAGCCAGAGGTGGTGCAGGG - Intergenic
984628306 4:182034047-182034069 GAGGACTCACAAGTGGTGGAAGG + Intergenic
984777314 4:183493043-183493065 GGACAACCACAGGTGGTGTATGG - Intergenic
985823884 5:2178877-2178899 GCAGAGCCAAAGGTGTGGGAGGG + Intergenic
986307726 5:6528219-6528241 GGAGACCCACAGCTGCTGGCTGG - Intergenic
997165748 5:131659101-131659123 GCTGACCCACATCTGCTGGAAGG + Intronic
997978508 5:138454340-138454362 TCTGACCCACAGGTGGGAGAAGG + Intergenic
998684148 5:144505083-144505105 GCAGCCCAACAGGTGTTGGTGGG - Intergenic
1000232633 5:159330384-159330406 GCAGGCCCACAGGGAGGGGAGGG + Intronic
1001884732 5:175279091-175279113 GCATGCCCACAGGTGGTCAATGG - Intergenic
1001967046 5:175917663-175917685 GCAGAACCACAGATGGTGGGAGG - Intergenic
1002249889 5:177921549-177921571 GCAGAACCACAGATGGTGGGAGG + Intergenic
1002400775 5:178990689-178990711 GCCGACCCACAGGAAGTGGCCGG + Exonic
1004374278 6:15078171-15078193 GGTGAACCACAGGTGGTGGAGGG + Intergenic
1006078140 6:31547551-31547573 GCAGAGACGCAGGTGGAGGACGG - Intronic
1006829261 6:36958922-36958944 GCAGTCACACAGCTGGTGAATGG + Intronic
1011487632 6:87859335-87859357 GCAGAACCACAGAAGTTGGAGGG + Intergenic
1011544460 6:88468683-88468705 ACAGACCCATAGGTGTAGGAGGG + Intergenic
1011607442 6:89118290-89118312 GAGGACCCAGAGGTGGTGGCGGG + Intergenic
1012715742 6:102667194-102667216 GCAGATACAGAGGGGGTGGATGG - Intergenic
1013819959 6:114142956-114142978 GAAGAGCTACAAGTGGTGGACGG + Intronic
1017002198 6:150004584-150004606 GGAGCCCTACAGGTGCTGGAGGG + Intergenic
1019588337 7:1816513-1816535 GGAGCCCCCCAGGTGGAGGAAGG - Intronic
1023360554 7:39410883-39410905 CCAGTCTCACAGCTGGTGGATGG - Intronic
1023594730 7:41816945-41816967 CCAAACCCACAGGTGGTCAAAGG - Intergenic
1023793020 7:43768881-43768903 GCTGACCCGCAGGTGGTGGGTGG - Intronic
1023866804 7:44242218-44242240 GCAGACCCACGGGTGCTTCAGGG + Exonic
1030192257 7:106821556-106821578 GCAGATCCAATGGTGCTGGAGGG + Intergenic
1030905348 7:115174439-115174461 GGAACTCCACAGGTGGTGGAGGG + Intergenic
1032429949 7:131852507-131852529 GCAGCCACAAAGGTGGGGGAGGG - Intergenic
1032668430 7:134061709-134061731 GTAGATGCACAGGTGATGGAGGG - Intronic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1033629241 7:143140694-143140716 GCAGACGGACAGGTGCAGGAGGG + Intergenic
1035920910 8:3675221-3675243 GAAGACCAACAGGTGCTGCAAGG - Intronic
1038349760 8:26765268-26765290 CCAGACCCAAATGTGGAGGAGGG - Intronic
1038629238 8:29225190-29225212 GCAGGGCCACATGTGGAGGACGG + Intronic
1039848360 8:41342214-41342236 GAAGACCCACAGTTAGTGGGTGG - Intergenic
1041091939 8:54310150-54310172 CCAGACCCACAGGTGGTTTAAGG + Intergenic
1045428936 8:102095273-102095295 GCAGGACCACATGTGGTGGGTGG + Intronic
1049355068 8:142183455-142183477 CCTGAGCCACAGGTGGTGGGAGG - Intergenic
1051741674 9:20258458-20258480 CCAGACCCCCAGTTGTTGGATGG - Intergenic
1058835283 9:108854734-108854756 GCTGACCCAGAGCTGTTGGAAGG + Exonic
1060197838 9:121634810-121634832 GCCTAGCCACAGGTGGTGGCTGG - Intronic
1060613610 9:124990935-124990957 TCAGAATCACAGGAGGTGGATGG + Intronic
1061223025 9:129263245-129263267 GGACATCCACAGGTGCTGGATGG + Intergenic
1061789707 9:133052490-133052512 GCAGCCCAACAGGCTGTGGAGGG - Intronic
1185470334 X:377844-377866 GCGGACCCACTGGGTGTGGACGG - Intronic
1188042597 X:25387072-25387094 GCAGACCCAGAAGTGGAGAAGGG + Intergenic
1189177692 X:38974457-38974479 ACAGACCCTGAGTTGGTGGAAGG + Intergenic
1191227932 X:58065337-58065359 AAACACCCACAGGTTGTGGAGGG - Intergenic
1192239634 X:69319119-69319141 GGAAACCCTCAGGTGGGGGAGGG - Intergenic
1194503691 X:94707797-94707819 GAAGTCCCACAGGTTGTGGGAGG - Intergenic
1197153471 X:123245237-123245259 GCAGACACATAGGTGGAGGATGG + Intronic
1198075672 X:133190793-133190815 CCTGACTCACAGCTGGTGGAGGG - Intergenic
1198773001 X:140150707-140150729 GCAGGCCCAGAGGTGGAGAATGG + Intergenic
1199210157 X:145199004-145199026 GCAAACTGGCAGGTGGTGGAAGG + Intergenic
1199417657 X:147604529-147604551 GCAGTCACTCAGGTGGTGAACGG + Intergenic
1199782644 X:151076665-151076687 GCAGACCCAGGGCTGGTGGAGGG + Intergenic
1200281446 X:154780550-154780572 GCAGTCTCACAGGTGGTTGGCGG + Intronic
1201935674 Y:19408351-19408373 GCAAACCCACATGTGGTGGATGG + Intergenic