ID: 1146570140

View in Genome Browser
Species Human (GRCh38)
Location 17:33945387-33945409
Sequence CTGTTAACTCAGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146570140 Original CRISPR CTGTTAACTCAGATGGAACA AGG Intronic
902340664 1:15781583-15781605 CTGTTAACTAAGAAGAAAAATGG + Intronic
903179171 1:21596945-21596967 CTCTGGACTCAGAGGGAACAAGG - Intronic
905758427 1:40532244-40532266 CAGTTAACTCATATGCAAAATGG - Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
908592852 1:65652134-65652156 CTGTTCACTCCCATGGAAAAGGG + Intergenic
908894503 1:68883167-68883189 CTGTTAACTGAGATGGGGAATGG + Intergenic
908923927 1:69230380-69230402 CTGTGAACTCAGATGAGTCAAGG - Intergenic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
909924531 1:81423727-81423749 ATGTTAACTGAGATGTAAAAAGG + Intronic
911138094 1:94464689-94464711 ATGTTGACTTAGATGAAACATGG + Intronic
912143825 1:106766564-106766586 CTGTGAACTCAGATGTGACTAGG + Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
916598718 1:166271882-166271904 CTGTAACCTCAGATGGCAGAAGG + Intergenic
918146499 1:181760759-181760781 CTTTGAAGTCAGATAGAACAGGG - Intronic
920930446 1:210382988-210383010 CAGTTAACTCATTTGTAACACGG + Intronic
921162677 1:212484207-212484229 CTGTTTACAAAGATGGGACAGGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
1063600063 10:7473086-7473108 CTGTTACCTTAGATGGCAAAGGG - Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063654821 10:7977726-7977748 CTTTTTGCTCAGATGGCACATGG + Intronic
1064140059 10:12782926-12782948 CTGTTATCTCAGATCCAGCATGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065261717 10:23930769-23930791 AAGTTAACTCAGTGGGAACATGG + Intronic
1066054572 10:31668493-31668515 CTGTTACCTCACATGGAAGAAGG + Intergenic
1068204761 10:53835986-53836008 CCTTTATCTCAGATGAAACAAGG + Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070376397 10:75835469-75835491 CTGTGAATTCATATGGAAAAAGG - Intronic
1071513565 10:86282472-86282494 CTGTTCCCTGAGATGGACCACGG - Intronic
1071960098 10:90801788-90801810 CTGTTCAATCAGATTGCACAAGG - Intronic
1072027818 10:91480092-91480114 CACTTAACTGAGATGTAACAGGG - Intronic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1072687086 10:97543947-97543969 CTGTTAAGTTAGTTGAAACAAGG + Intronic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1073419722 10:103414867-103414889 CTGTTATTCCAGATGGCACATGG - Intronic
1074472857 10:113743152-113743174 CTATTTACTCATATGAAACATGG + Intergenic
1074795963 10:116944147-116944169 CTGTTATCTGAGATGGTATATGG + Intronic
1076644229 10:131941363-131941385 GTCTTAAATTAGATGGAACATGG + Intronic
1077750981 11:4969793-4969815 CTGATAACTCAGAAGATACAAGG + Intronic
1077940278 11:6833573-6833595 TTATTAGCTCAGCTGGAACAAGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1082002289 11:47399992-47400014 CAGTTATCTCAGCTGGAAAATGG - Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1087476320 11:98639740-98639762 CTATTAACTTAGACTGAACACGG - Intergenic
1089256873 11:117198895-117198917 CTTTTAGCTCTGATGGGACATGG - Intergenic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1090642439 11:128740961-128740983 TTGTTAACCCAGAGGGAAAAAGG + Intronic
1093428158 12:19052683-19052705 CTGGTTACTCAGATAGCACATGG + Intergenic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097772825 12:63608766-63608788 GTGATAGCTGAGATGGAACAGGG - Intronic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099604174 12:84780730-84780752 TTGCTGTCTCAGATGGAACATGG + Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1101263789 12:103063591-103063613 CTGTTGCCTCAGGTGGCACAGGG - Intergenic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1107590124 13:41895134-41895156 CTGTTTACTGAGTGGGAACATGG + Intronic
1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG + Intronic
1110542565 13:76722460-76722482 CTGTTTCCTCAGTTGAAACAAGG + Intergenic
1110856200 13:80299427-80299449 CTGTTATCTCTGAGGAAACAAGG - Intergenic
1111005883 13:82248246-82248268 ATGTTAACTCACATGACACAAGG - Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116297583 14:43133188-43133210 GTGTTACCTCAGGTGGAAAAGGG + Intergenic
1118260224 14:64239343-64239365 CTATAAACTCAGAGGGAACTAGG + Intronic
1120312101 14:82842162-82842184 CTGTGAACTGTGATGAAACAGGG - Intergenic
1120640287 14:87002578-87002600 ATGTTTACTAAGATGGAACGTGG - Intergenic
1124182553 15:27490466-27490488 GTGTTGACTAAGATGGAAAATGG - Intronic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1124829374 15:33133138-33133160 CAGTTAACTCACAAGGAAGAGGG + Intronic
1126615133 15:50570482-50570504 TTGCTAACTAAGATGAAACAAGG - Intronic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127148555 15:56050398-56050420 CAGCCAACTGAGATGGAACACGG - Intergenic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1130958271 15:88642437-88642459 CTGTTAAGATAGATGGAATATGG + Intronic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1136671648 16:31863963-31863985 TTGTGGACTCTGATGGAACATGG + Intergenic
1140231328 16:73119592-73119614 CTGTTGGCTCACATGGAACATGG - Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1146272928 17:31496400-31496422 CTCTTAACCCAGATGGAACGGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1149445913 17:56713349-56713371 CTATTAACTCATATGTAAAATGG + Intergenic
1149447367 17:56724063-56724085 CTGTAAAGTCACATGGAAAAAGG + Intergenic
1149694879 17:58608988-58609010 CTTTTAACTCAGATTAAAAATGG + Intronic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1158062369 18:53360967-53360989 CTGTGACCTTAGATGGAAAAGGG + Intronic
1160354295 18:78214011-78214033 CATTTAACTCAGAACGAACAAGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1164145399 19:22509785-22509807 CACTTAGCTCAGATGGAACCTGG - Intronic
1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG + Intergenic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
925802879 2:7618709-7618731 GTGTGAACTCTGATGGGACATGG + Intergenic
927759052 2:25734705-25734727 CTGTTAAGTGAAATGGAACTTGG - Intronic
928457678 2:31437996-31438018 CTGTTAACTCTGATGGTCCCTGG - Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
930605948 2:53493179-53493201 CTGTAAACTCACATGGGAGAAGG - Intergenic
931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
941722922 2:168831227-168831249 CTGTAACCTCAGATGGCAGAAGG + Intronic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
941821626 2:169849647-169849669 CTGTTAAGTCAGATAGAATTTGG + Intronic
942190720 2:173466484-173466506 CTGTTACCTCAGTTGTAAAATGG + Intergenic
943515508 2:188881022-188881044 CTGTTAACTCTGAGGGATGAGGG + Intergenic
944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG + Intergenic
946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG + Intergenic
947274188 2:228372256-228372278 CTGTTAGCTTATATGGTACATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1177698033 21:24598879-24598901 GTGTTATCTCTCATGGAACAGGG + Intergenic
1178701713 21:34839454-34839476 CTGTGAACTCAAAGCGAACAGGG + Intronic
1179587897 21:42385287-42385309 GTGTTATCTCAGATGGAAGGTGG - Intronic
1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG + Intronic
1183919972 22:41157948-41157970 CTGTTAACTCATCTGGAGTAGGG + Intronic
949500388 3:4674671-4674693 TTGTTAACTCAGAAGTAACAAGG - Intronic
952039303 3:29242119-29242141 CTGATAACTGAGATGAAAAAAGG + Intergenic
955575525 3:60358653-60358675 CTGATAACACAGATACAACATGG + Intronic
960206822 3:114912027-114912049 ATGTTCACTTATATGGAACAAGG - Intronic
965033715 3:163406850-163406872 CTGTTAACTCTTATGGTAAAAGG - Intergenic
965636243 3:170784174-170784196 CTATTATCTCAGAAGGAACTTGG + Intronic
967546553 3:190736896-190736918 CTGCAAATTCAGATGGATCATGG - Intergenic
967770386 3:193328069-193328091 CTGTTAACTCAGTTGTGAAATGG - Intronic
969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG + Intronic
972047314 4:34682820-34682842 CTGTAAACTCAGTTTGCACATGG - Intergenic
973077134 4:45943266-45943288 CTGCTAACTCGGAGGGTACATGG - Intergenic
974615638 4:64276339-64276361 GTGTTAACTCTGAGAGAACATGG + Intronic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
978006530 4:103623959-103623981 CAGTTAACCTAGATTGAACAAGG - Intronic
979760859 4:124402571-124402593 CAGCTAAGTCAGATGGAAAAGGG - Intergenic
983899902 4:173122673-173122695 GTGTGAACTCAGGTGGAACCAGG + Intergenic
984104270 4:175525456-175525478 ATGTCAACTCAGAAAGAACATGG - Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
987029840 5:13965684-13965706 CTGTTAATTCAGGAGGAACTGGG - Intergenic
987844589 5:23266075-23266097 TTTTTATCTCACATGGAACATGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989566614 5:42907391-42907413 TTGTTAACTCAGAAGGCACAAGG + Intergenic
989567946 5:42919775-42919797 TTGTCAACTCAGAAGGCACAAGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
994293949 5:98066138-98066160 ATGTTAACTGAGAGGGAGCATGG - Intergenic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG + Intronic
995405698 5:111793100-111793122 CTGTAAATTCAAATGAAACATGG + Intronic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
995945112 5:117635627-117635649 GTGTCAACTCAGGTGGAAGAAGG - Intergenic
999333706 5:150696682-150696704 TTTCTAACTCTGATGGAACACGG - Exonic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
999935392 5:156480596-156480618 CTGCTACCCCAGATGGCACATGG + Intronic
1001360560 5:171081108-171081130 CTTTAAACTCAGATGGACTAGGG - Intronic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007717320 6:43864832-43864854 ATGGTAACTCAGGTGGAACTGGG + Intergenic
1008404467 6:51103346-51103368 CTGTTCACTCTGATGGTAGAGGG - Intergenic
1009597970 6:65760782-65760804 CTGTTAACTGAGAGAGAAGAAGG - Intergenic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1012257663 6:97052290-97052312 CTGTCAACTCAGATACCACAAGG + Intronic
1014831936 6:126112996-126113018 CTGTCCACTCAGATGCAAAAAGG - Intergenic
1022365409 7:29709901-29709923 GTGATAGCTGAGATGGAACAGGG + Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1022649820 7:32264459-32264481 TTTTTAAGTCAGATGGAACTAGG - Intronic
1022932389 7:35132460-35132482 GTGATAGCTGAGATGGAACAGGG - Intergenic
1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026962601 7:74418064-74418086 GTGTAAATTCAGAAGGAACATGG + Intergenic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1028202214 7:87975044-87975066 ATGTTACCTCACATGGAAAAAGG - Intronic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1029828315 7:103225255-103225277 GTGATAGCTGAGATGGAACAGGG - Intergenic
1031105493 7:117536991-117537013 TTGGTAACTCACATGGAACTGGG + Intronic
1031788819 7:126072956-126072978 CTGTGAGCTCATATGGCACAAGG + Intergenic
1033356970 7:140607814-140607836 CTGCTGGCTCATATGGAACAAGG - Intronic
1037602741 8:20411768-20411790 CTGTAAACTCATAATGAACACGG - Intergenic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1044273393 8:90272841-90272863 CTCTGAAGTCAGATGGCACAAGG - Intergenic
1048573722 8:135675220-135675242 CTGTTATCTTGGATGGAGCAAGG + Intergenic
1050746934 9:8887064-8887086 CAGTTAACTCACATGTAAAATGG - Intronic
1051078121 9:13264800-13264822 CTGTTAACTCACACCAAACATGG + Intronic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1054822928 9:69541956-69541978 GTATTAACTCAGATGGTCCAAGG - Intronic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1056514371 9:87336124-87336146 CTTCTAGCCCAGATGGAACATGG + Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060941874 9:127547211-127547233 CTGTTTCCTCAGCTGTAACATGG + Intronic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1188472423 X:30555361-30555383 CTGTTAACTTACATGGCAAAAGG + Intergenic
1188798264 X:34493549-34493571 CTGTTAAATCTGGTGGAATATGG + Intergenic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1195121235 X:101755124-101755146 CTGGTACCTCAGATGGTGCAGGG - Intergenic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic
1195578964 X:106480335-106480357 CACTTCACTCAGATGGACCATGG + Intergenic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1197210382 X:123823512-123823534 ATGTTATCTCAGAGGGTACAGGG - Intergenic
1198478621 X:137019667-137019689 CTGTTTTCTCAGCTGGAAAATGG - Intergenic
1199782807 X:151078553-151078575 CTGTTTACTCAGAAGTAAAATGG - Intergenic