ID: 1146570457

View in Genome Browser
Species Human (GRCh38)
Location 17:33948223-33948245
Sequence CAGAATGAGGTAAAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146570457_1146570461 28 Left 1146570457 17:33948223-33948245 CCAGCCTGCTTTACCTCATTCTG 0: 1
1: 0
2: 1
3: 51
4: 396
Right 1146570461 17:33948274-33948296 TCAATGCTCTGAGCCTCACTCGG 0: 1
1: 0
2: 1
3: 11
4: 142
1146570457_1146570460 -5 Left 1146570457 17:33948223-33948245 CCAGCCTGCTTTACCTCATTCTG 0: 1
1: 0
2: 1
3: 51
4: 396
Right 1146570460 17:33948241-33948263 TTCTGCAAAGACAAATCATCTGG 0: 1
1: 0
2: 2
3: 25
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146570457 Original CRISPR CAGAATGAGGTAAAGCAGGC TGG (reversed) Intronic
900637909 1:3674862-3674884 CAGAATGAAGCCAGGCAGGCTGG - Intronic
901120728 1:6890866-6890888 CAGAATCTGGCCAAGCAGGCTGG - Intronic
903259546 1:22123989-22124011 CAGAACCAGGTAGAGAAGGCTGG - Intronic
904938608 1:34149382-34149404 CAGGATGAGGCATTGCAGGCAGG - Intronic
905011558 1:34750586-34750608 CACAATGATTTACAGCAGGCAGG - Intronic
905032688 1:34898286-34898308 CAGACTGAGGATAAGCAGCCAGG + Intronic
905952527 1:41964260-41964282 CAGAGCGAGGAAAAGCAGGCTGG + Intronic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906320534 1:44812966-44812988 CAGAATGAGGGAGATCAGGTTGG - Intronic
906439377 1:45827579-45827601 CAGAATGAAGGAAAGAAGGCAGG + Intronic
906580232 1:46929993-46930015 CAGACTGGGGGACAGCAGGCAGG + Exonic
906588350 1:47000771-47000793 CAGACTGGGGTACAGAAGGCAGG + Intergenic
906603493 1:47148897-47148919 CAGACTGGGGGACAGCAGGCAGG - Exonic
906748993 1:48242158-48242180 CAGACTGAGGCAAATGAGGCTGG - Intronic
906803988 1:48761985-48762007 CAGGCTGAGGTAAGGCAGACGGG + Intronic
906856282 1:49308723-49308745 CAGAATGAGAAAAGGCAGGGTGG + Intronic
907356567 1:53879874-53879896 GAGAATGAAGAAAAGCAGGGTGG + Intronic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908216065 1:61953712-61953734 GAGTCTGAGGAAAAGCAGGCAGG - Intronic
909019059 1:70411298-70411320 GAGAAGGAGCTAAAGCACGCAGG - Exonic
909374393 1:74923686-74923708 CAGAATGAAGAAAAGCAGGGTGG + Intergenic
910289865 1:85589280-85589302 CAGCAGGTGGTAAAGCAGCCAGG - Intergenic
910857819 1:91713450-91713472 AAGAATGAGGCATAGCAGGGAGG - Intronic
911923922 1:103802902-103802924 CAGAATAAGTTAAATCAGGTTGG + Intergenic
912240652 1:107904307-107904329 CTGAATGATGTCCAGCAGGCGGG + Intronic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
913583912 1:120254679-120254701 CAGAACGAAGGAAAGAAGGCAGG + Intergenic
913624260 1:120643641-120643663 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
914565901 1:148866515-148866537 CAGAACGAAGGAAAGAAGGCAGG + Intronic
914606924 1:149263733-149263755 CAGAACGAAGGAAAGAAGGCAGG - Intergenic
914832016 1:151177088-151177110 CAGAAAGAAGGAAATCAGGCTGG + Intronic
916423392 1:164658041-164658063 CAGAATGATGGGTAGCAGGCAGG + Intronic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
917203700 1:172545872-172545894 CAGAAGGACGGAAGGCAGGCAGG - Intronic
918010008 1:180577894-180577916 GGGAATGAGGGAGAGCAGGCAGG - Intergenic
920673591 1:208023606-208023628 CAGAATAAGGTAAGGCAGCTGGG + Exonic
921383125 1:214544961-214544983 CACAAAGAGGTTAAGCAGGCAGG + Intronic
922026137 1:221750917-221750939 CTGAAAGAAGTAAGGCAGGCAGG + Intergenic
924629442 1:245723550-245723572 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1064797358 10:19028390-19028412 CAAATTGAGGGAATGCAGGCTGG + Intergenic
1065196363 10:23270223-23270245 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1065560946 10:26963164-26963186 CAGAATGAGGCAAAGTGGGGAGG - Intergenic
1065709559 10:28502401-28502423 CAGAAAGGAGAAAAGCAGGCGGG + Intergenic
1065900150 10:30198973-30198995 CACAATGAGGACAAGCAGCCAGG + Intergenic
1066218389 10:33311019-33311041 GAGTATGAGGCACAGCAGGCTGG + Intronic
1066379285 10:34887658-34887680 CAGAAATAGCAAAAGCAGGCAGG - Intergenic
1067676837 10:48388139-48388161 CAAAATGAAGTAAAGCTGGCAGG - Intronic
1067923130 10:50480484-50480506 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069590505 10:69638804-69638826 CAGAATGAGGGAGGCCAGGCGGG - Intergenic
1069759589 10:70799414-70799436 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1069892581 10:71661591-71661613 CAGAATGTCCTAAGGCAGGCTGG - Intronic
1070064646 10:73021661-73021683 GAGAATGAGCCAAAGCAGGGCGG + Intronic
1072052857 10:91723751-91723773 GAGGATGAGATAAAGCAAGCAGG - Intergenic
1073029658 10:100515451-100515473 CAGAATGATGGAAAGAAGGTAGG + Intronic
1073593523 10:104778481-104778503 GAGAATGAGACAATGCAGGCTGG - Intronic
1076980956 11:204484-204506 CAGAGTCAGGCAAAGCAGGCAGG - Exonic
1078501646 11:11885378-11885400 AAGAATGAAGAAAAGCAGGGTGG + Intronic
1078793546 11:14569386-14569408 GAGCATGAGGTGAAGCAGGGTGG + Intronic
1079580458 11:22056476-22056498 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1080193450 11:29579209-29579231 TAGAATGAGATAATGCAGGATGG + Intergenic
1080214592 11:29826862-29826884 GAGAGTGAGGGAAAGCAGGGTGG + Intergenic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1081583191 11:44366384-44366406 CAGAATGAGGAAATCCAGTCTGG + Intergenic
1081583198 11:44366442-44366464 CAGAATGAGGAAATCCAGTCTGG + Intergenic
1085179418 11:74521032-74521054 CAGGATGAGGGAGAGCAGGACGG + Intronic
1085722189 11:78922246-78922268 CAGCATGAGGAAAGGCAGGCAGG + Intronic
1086428214 11:86708044-86708066 CAGAAGGAGATAATGAAGGCTGG + Intergenic
1086699303 11:89881844-89881866 CATAATAAGGTAAAGCAGGTAGG - Intergenic
1086706868 11:89962670-89962692 CATAATAAGGTAAAGCAGGTAGG + Intergenic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1089079486 11:115763943-115763965 CTGCATGAGGTTCAGCAGGCTGG - Intergenic
1089101011 11:115962500-115962522 GAGACTGAGCTAAAGCAGGAAGG - Intergenic
1089427752 11:118393890-118393912 CTGAATTAGAAAAAGCAGGCTGG - Intronic
1090330059 11:125924420-125924442 CAGACTGTGCTAAAGCAAGCGGG + Intergenic
1090484096 11:127096646-127096668 CAGAATGAGGGAAAAGAGGAAGG + Intergenic
1092090118 12:5797417-5797439 CAGAATCAGGGAAAGCAAGTTGG + Intronic
1092347825 12:7730767-7730789 TAGAATGAGGTAAAGGACACTGG - Intronic
1098670988 12:73231378-73231400 CAGAAGGAAGTGAAGCAGGCAGG + Intergenic
1099161687 12:79249398-79249420 TAGAAAGAGGTAAAGAGGGCCGG - Intronic
1099615807 12:84933765-84933787 CAGAATGAAGTTATTCAGGCCGG - Intergenic
1099829789 12:87826740-87826762 CAGAATCAGGTAAAGCAAAAGGG + Intergenic
1100080843 12:90848068-90848090 GAGAATGGTGTAAACCAGGCAGG - Intergenic
1100670732 12:96809854-96809876 CAGAATGTAGTAAATTAGGCAGG - Intronic
1102496224 12:113321082-113321104 CAGAAACAGGTAGAGCAGCCAGG + Exonic
1102960829 12:117092376-117092398 CAGCATGGGCTAGAGCAGGCAGG + Intronic
1103659356 12:122501169-122501191 CAGAATGCGCTAAAGCAATCTGG + Intergenic
1104441138 12:128794271-128794293 AATAATGAGGAAAAGCAGGAGGG + Exonic
1104999024 12:132676722-132676744 CAGAGGGAGGTAGAGCAGGCTGG - Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1108801436 13:54100982-54101004 CAGAATGAGGAAAAAAAGGGGGG - Intergenic
1109149200 13:58823628-58823650 CAGTTAGAGGTGAAGCAGGCTGG - Intergenic
1110406840 13:75160409-75160431 CAGATTGCGGTAAAGAAGCCAGG - Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111641543 13:90976844-90976866 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
1112480048 13:99766965-99766987 CAGACAGAGGCAAAGCAGGGAGG - Intronic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113159207 13:107360593-107360615 CAGAATGTGAAAAAGCAGGTAGG - Intronic
1113990376 14:16023648-16023670 CCGAATGAAGTAACCCAGGCTGG + Intergenic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1116066131 14:39985380-39985402 CAGAATGAGGTCAGAAAGGCGGG + Intergenic
1116884392 14:50205345-50205367 CATAAAAAGTTAAAGCAGGCTGG - Intronic
1117157856 14:52958462-52958484 CAGACTGAGGTGCAGCAGGGTGG - Intergenic
1117503211 14:56374663-56374685 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1118330196 14:64808938-64808960 CAGAATGAGTCCAAGCAGACAGG + Intronic
1118362871 14:65070649-65070671 CAGAGTGAGCTAGAGCATGCGGG + Intronic
1119071683 14:71592032-71592054 CAGCATGAGGTCCAGCTGGCAGG + Intronic
1120288179 14:82532368-82532390 AAGAATGAAGGAAAGCAGGAAGG - Intergenic
1120799041 14:88669023-88669045 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1122099094 14:99393226-99393248 CAGAAAGAGGCACAGCCGGCAGG + Intergenic
1122851462 14:104534754-104534776 AAGTCTGAGGTATAGCAGGCTGG - Intronic
1125931640 15:43604410-43604432 CAGGATGAAGTAGAGCAAGCTGG - Exonic
1125944744 15:43703890-43703912 CAGGATGAAGTAGAGCAAGCTGG - Intergenic
1126607961 15:50499461-50499483 TAGAATGATGTAAAGCAGATAGG + Exonic
1126858887 15:52864930-52864952 CAGAAGGAGGTAAGTGAGGCTGG - Intergenic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127291065 15:57571704-57571726 CAGCATGAGATAAAGGAAGCAGG + Intergenic
1129169793 15:73800657-73800679 CAGAAGGAGGGAGGGCAGGCAGG - Intergenic
1130037352 15:80373181-80373203 CAGAATGATTTAAAGCAAGCAGG + Intronic
1130118153 15:81023643-81023665 TGGAATGAGGTAATGCTGGCAGG - Intronic
1130779141 15:87016684-87016706 GAGAATGAAGAAAAGCAGGATGG + Intronic
1131465402 15:92650922-92650944 CGGAAGGAGGGAAAGCTGGCTGG - Intronic
1132001746 15:98187507-98187529 CTGAATGAGGCACAGCAGACTGG - Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1132948142 16:2544029-2544051 AAGAATATAGTAAAGCAGGCCGG - Intronic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133454654 16:5931519-5931541 CAGAATGTGGTTGAGCATGCAGG - Intergenic
1134560033 16:15200882-15200904 CTGAATGAGGGATAGCAGTCTGG + Intergenic
1134920572 16:18112491-18112513 CTGAATGAGGGATAGCAGTCTGG + Intergenic
1135115604 16:19720727-19720749 CAGAATGAGGTCAGGCATGGTGG + Intronic
1136369518 16:29827345-29827367 CAGAATGAGGCAAGGCAGTGAGG + Intronic
1136487996 16:30585533-30585555 GAGGACGAGGGAAAGCAGGCCGG - Exonic
1137673793 16:50293837-50293859 CAGAATGAGGTAAAGCCCCCCGG + Intronic
1137697755 16:50473721-50473743 GCCAATGAGGGAAAGCAGGCGGG - Intergenic
1139850735 16:69950598-69950620 CAGGAGGAGTCAAAGCAGGCGGG - Intergenic
1139879720 16:70173510-70173532 CAGGAGGAGTCAAAGCAGGCGGG - Intronic
1140372805 16:74422038-74422060 CAGGAGGAGTCAAAGCAGGCGGG + Intergenic
1141044691 16:80705508-80705530 CACACTGAGGGAACGCAGGCAGG + Intronic
1142523993 17:525390-525412 AAAAATGATCTAAAGCAGGCAGG + Intronic
1143325058 17:6093284-6093306 CTGAATGAGATAAAGCAGGAAGG - Intronic
1143688859 17:8543288-8543310 CAGAATGAGGTCATGCAAGGAGG + Intronic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144826900 17:18110214-18110236 CAGGATGAGGTGAAACAGGCTGG - Intronic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146955018 17:36932411-36932433 CGGAGTGCGGAAAAGCAGGCGGG - Intergenic
1148029351 17:44608839-44608861 CAGGAGGAGGTAACCCAGGCAGG + Intergenic
1148664719 17:49365792-49365814 GAGAAAGAGGTAAAGGAGGGCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149532007 17:57402922-57402944 CAGACTGATGTAAAGCAGTAAGG + Intronic
1149685657 17:58533092-58533114 CAGACTGAAATACAGCAGGCAGG - Intronic
1149988829 17:61368928-61368950 CAGCATGAGGAAAAGCTGGTAGG - Intronic
1155106110 18:22667859-22667881 CAGAATGAGCCCAAGTAGGCAGG + Intergenic
1155117606 18:22784468-22784490 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1156268310 18:35508264-35508286 CAGAAGGAGGTACAGGAGGAAGG - Intergenic
1156509877 18:37627388-37627410 AAGAGTGAGGAAAAGCTGGCAGG + Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1158525240 18:58207422-58207444 AAGAATGGGTTAAGGCAGGCAGG + Intronic
1159566598 18:70058218-70058240 CAAAATAAAGTAAAACAGGCCGG + Intronic
1160220737 18:76975786-76975808 CAACCTGTGGTAAAGCAGGCAGG + Intergenic
1160997134 19:1887994-1888016 GAAAATGAGGCAAAGCAGCCAGG - Intergenic
1161334675 19:3706272-3706294 CAGCAGGAGGTACTGCAGGCTGG + Intergenic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1162301807 19:9848853-9848875 CAGCATGAAGGATAGCAGGCAGG - Intronic
1163121505 19:15221006-15221028 CTGAATGAGGTTAAGCAGGGAGG - Intergenic
1164942970 19:32265966-32265988 AAGGCAGAGGTAAAGCAGGCGGG - Intergenic
1165739211 19:38195688-38195710 AAGAATGAGGTACAGCAAGCTGG - Intronic
1166838006 19:45678971-45678993 CCGAATGAGGTGAAGCAGGTTGG - Intronic
1167315924 19:48762609-48762631 CAGAGAGAGGAAAGGCAGGCAGG + Intergenic
1167334074 19:48873943-48873965 CAGAAAGAAGTAAAGGAGCCAGG + Exonic
1168367551 19:55801803-55801825 CAGGATGAAGTGAGGCAGGCAGG - Intronic
925213662 2:2073351-2073373 CAGTAAGAGATACAGCAGGCTGG - Intronic
925560637 2:5190235-5190257 CAGAAAGAGGCCAAGCATGCAGG - Intergenic
925566950 2:5266141-5266163 CAGATTGAGGGAAAGCAGCAAGG + Intergenic
926083331 2:10006247-10006269 CAGTAAGAGGTGAAGCGGGCTGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
927138995 2:20117355-20117377 CATAATGAAGTACCGCAGGCTGG - Intergenic
927813004 2:26190622-26190644 CACAATGAGGAAATCCAGGCTGG + Exonic
927922065 2:26980550-26980572 CAGATTGAGGTTAAGCATACTGG - Intronic
927962413 2:27249348-27249370 CAGGATGGGGGAAAGCAGGGAGG + Intergenic
928911023 2:36420931-36420953 TGGAATGAGGCAAAACAGGCAGG - Intronic
929127417 2:38534480-38534502 AAAAAAGAGGTAAAGCAGGGAGG - Intergenic
930284288 2:49408883-49408905 CAGAATGAGGGAAAGCCTTCAGG - Intergenic
930772507 2:55141975-55141997 CAGAAAAAGGTACACCAGGCTGG + Intergenic
931234485 2:60401700-60401722 CAGAAGCAGGTAAGGCAGACTGG + Intergenic
931560344 2:63554834-63554856 GAGACTGAGGAAAAGCAGGGTGG + Intronic
932679989 2:73816623-73816645 CAGATTGAGGGACAGTAGGCTGG - Exonic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934548570 2:95240301-95240323 AAGAATGAAGAAAAGCAGGGTGG + Intronic
935263152 2:101371956-101371978 AAGAAAGAGGTAAAGAAGGGAGG + Intronic
937758383 2:125568846-125568868 CAGATTGAGGGAAATCATGCTGG - Intergenic
939364883 2:141218936-141218958 CAGAGTGAGGAAAAGCAGGGTGG + Intronic
939398284 2:141660175-141660197 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
939427974 2:142065413-142065435 CAGAATGAGGCCAAGCAGGAAGG - Intronic
939630911 2:144524740-144524762 CAGAGGGAGGAAAAGCAGGAGGG - Intergenic
939723325 2:145682112-145682134 CAGACTGGGGTAAAGCAGAAGGG + Intergenic
939976346 2:148720775-148720797 GGGAATGAGGAAAAGCAGGGTGG - Intronic
940804263 2:158168324-158168346 AAGCAAGAGGTGAAGCAGGCTGG + Intergenic
941298074 2:163765555-163765577 CAGAATGTGATGAAGCAGACAGG - Intergenic
941572302 2:167186693-167186715 CAGCATGAGGAAGAGCAAGCAGG - Intronic
942394790 2:175535769-175535791 CAGAATTAAGTAAAGCAGTGGGG + Intergenic
942856430 2:180555285-180555307 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
943054350 2:182957467-182957489 GAGCATGAGGAAAAACAGGCTGG - Exonic
943770381 2:191709987-191710009 CAGAATGAGATAAAGAAGTAGGG + Intergenic
944046393 2:195416095-195416117 TAGAATATAGTAAAGCAGGCAGG - Intergenic
944370345 2:198974732-198974754 CAGATTCAGCTAAAGCAGGTAGG - Intergenic
944803102 2:203255712-203255734 GAGAATGTGGGAAACCAGGCTGG - Intronic
945523988 2:210866008-210866030 GAGAGTGAGGAAAAGCAGGATGG + Intergenic
946759747 2:222981710-222981732 CAGATTGAGGTAAACCCCGCTGG + Intergenic
946786248 2:223246884-223246906 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
947153161 2:227135071-227135093 GTGAATGAGGTATATCAGGCAGG - Intronic
948197726 2:236107721-236107743 CAGAATCAGGAAAACCTGGCTGG + Intronic
948305790 2:236945840-236945862 CAGGATGAGGTAGGCCAGGCAGG - Intergenic
1170623732 20:18015022-18015044 CAGAATGAGCAAAATCAGGCCGG + Intronic
1172628024 20:36359825-36359847 CAAAATGAGGCAAGGCATGCTGG + Intronic
1174696659 20:52566109-52566131 CAGAATGAGGTGGAGCTAGCTGG + Intergenic
1176522830 21:7837870-7837892 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1177388016 21:20432871-20432893 CAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1178114750 21:29405636-29405658 AAGAAGGAAGGAAAGCAGGCAGG - Intronic
1178259768 21:31088374-31088396 CAGAGAGAGGTGAAGCCGGCTGG - Intergenic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178656850 21:34467882-34467904 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178686974 21:34719601-34719623 CAGAATGTCCTAAAGCAGGCTGG + Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1180066940 21:45417304-45417326 CAGAAGGAGGTAAGGCAAGCCGG - Intronic
1180316895 22:11283878-11283900 CCGAATGAAGTAACCCAGGCTGG - Intergenic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184676696 22:46046874-46046896 TAGAATGAGGTAGCGCTGGCAGG - Intergenic
1184796180 22:46734317-46734339 CAAAATGAGATAAAGCAGCCGGG + Intronic
949902090 3:8824016-8824038 CAGCATGAGGTTGAGCAGACAGG + Intronic
949938843 3:9137902-9137924 GAGACTGAGTTAAAGCTGGCTGG + Intronic
949963378 3:9333860-9333882 CAGCATGAGGCATAGCAGGTGGG - Intronic
950108322 3:10402372-10402394 CAGAGTGAGGTCAACCAGACAGG + Intronic
950727203 3:14924130-14924152 CTGACAGAGGTAAAGCAGGCAGG + Exonic
951456487 3:22898023-22898045 CAGAATGAGGTAATTAAGGTAGG + Intergenic
951632577 3:24737626-24737648 CAGAATGGGGTGAAGCGGGACGG + Intergenic
951860371 3:27245131-27245153 TAGAATGAAGTATAGCAGCCTGG - Intronic
952234263 3:31462876-31462898 AAGAATGAGGTAAGCCAGGCAGG + Intergenic
952572201 3:34731437-34731459 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
952574455 3:34758632-34758654 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
952635343 3:35522632-35522654 GAGAATGAGGCAGAGGAGGCAGG - Intergenic
953052820 3:39361634-39361656 GAGAATGAAGAAAAGCAGGTTGG + Intergenic
953642177 3:44718944-44718966 CAGAATCAGGAAAACCAGGTAGG + Intronic
953752977 3:45623598-45623620 CAGAATGAAAAAAAGTAGGCTGG + Intronic
954388281 3:50255720-50255742 AGCAATGAGGTAATGCAGGCAGG + Intronic
954441828 3:50526293-50526315 CAGACTCAGGTAAAGAAGGAGGG - Intergenic
955408600 3:58641662-58641684 CTCAAAGAGGTTAAGCAGGCTGG - Intronic
956809423 3:72849898-72849920 CAGTATGGTCTAAAGCAGGCAGG - Intronic
956880303 3:73504149-73504171 GAGAATGAGGTACATCAGGTGGG - Intronic
957271024 3:78030124-78030146 CAGTGAGAGGTGAAGCAGGCTGG + Intergenic
959299059 3:104576100-104576122 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
959345849 3:105193336-105193358 CAGAAGGAGGGAAAGCATGTTGG + Intergenic
959508678 3:107184149-107184171 CAGAAGAAGGTAACCCAGGCCGG + Intergenic
959615136 3:108338812-108338834 CAGAATGAGATAAAACAGGGAGG + Intronic
959845526 3:111028177-111028199 CACAATAAGGTAAAGAAGGATGG + Intergenic
959883627 3:111474106-111474128 GAGAGTGAGGAAAAGCAAGCTGG - Intronic
960290867 3:115882850-115882872 CAGCATGAGGTAAACTTGGCTGG - Intronic
960690203 3:120338916-120338938 TAGAAGGAGGAAAAGCAGACTGG + Intronic
961545717 3:127631436-127631458 CAGAAGGAGGCAAAGGAAGCAGG - Intronic
962984497 3:140522173-140522195 GGGAATGAAGAAAAGCAGGCTGG - Intronic
963447251 3:145428087-145428109 TAGAATGAGGTAATGCTGGCGGG + Intergenic
964270805 3:154954214-154954236 CAAGAAGAGGTAAAACAGGCTGG + Intergenic
964295254 3:155225880-155225902 AAGAGTGAGGAAAAGCAGGGTGG - Intergenic
964746812 3:160020287-160020309 AAGAAGGAGGGAAGGCAGGCAGG + Intronic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965736476 3:171826053-171826075 CAGAGTGAGGGAAAGCAGGCAGG + Intergenic
966454674 3:180101876-180101898 GAGAATGAAGAAAAGCAGGGTGG + Intergenic
967227081 3:187302341-187302363 CAGAATGATTTAAAGGAGGCTGG - Intergenic
967521767 3:190440413-190440435 AAGAATGAGGTAGAGTATGCAGG + Intronic
968584898 4:1411747-1411769 TAGAATGATGGAAAGCAGACAGG - Intergenic
969311299 4:6354266-6354288 GAGACTGAGGAAGAGCAGGCAGG - Intronic
969984261 4:11190810-11190832 GAGAATGCAGCAAAGCAGGCTGG - Intergenic
970988135 4:22182004-22182026 AGGAATGAGGTACAGCAGGGAGG - Intergenic
971299476 4:25429895-25429917 AAGAATGACATATAGCAGGCTGG + Intergenic
972422591 4:38903458-38903480 AAAAATGAGGTCAAGGAGGCTGG - Intronic
972543227 4:40057022-40057044 CAGAAGCAGGTAAAGGCGGCGGG + Exonic
972577469 4:40364992-40365014 CAGAAAGGGGTAACACAGGCCGG - Intergenic
974340175 4:60604198-60604220 GAGAATGAAGAAAAGCAGGATGG - Intergenic
974444443 4:61961253-61961275 CAGAAGGAGGGAAAGCAAGTGGG - Intronic
974621047 4:64355500-64355522 AAGAATAAGTTAAAACAGGCCGG + Intronic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
975733789 4:77362773-77362795 CAGAAAGAGGGAAAGCAGAAAGG + Intronic
975915860 4:79325083-79325105 CAGAATGGGGTAAGACAGGATGG + Intronic
976527944 4:86115328-86115350 CAGAGTGAGGAAAAGCAGGGTGG - Intronic
977084588 4:92576844-92576866 CAGAATGAAAAAAAGCAGGGTGG - Intronic
978182935 4:105823171-105823193 CAGAATGAGGAAAAGCTGTGGGG + Intronic
979038173 4:115752281-115752303 CAGAATGTGGTACAGCAAGCAGG - Intergenic
979301449 4:119092162-119092184 CATGATGAGGTAAAGCATGGAGG - Intergenic
979594240 4:122515746-122515768 CAGAATGAGGTAAGACAGTGTGG - Intergenic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
980054942 4:128070228-128070250 CAGAATGGGGTGAAGCCGGGAGG + Intronic
981290762 4:143071818-143071840 GAGAATGAGGAAAAGCCGGGTGG - Intergenic
982420998 4:155197448-155197470 AAGAAGGAAGGAAAGCAGGCAGG - Intergenic
982816055 4:159886206-159886228 CAAAATGAGGTTAAGGAAGCAGG - Intergenic
983957504 4:173715525-173715547 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
984531545 4:180922629-180922651 CAGAAGGCGCTAAAGCAGGCAGG + Intergenic
985287198 4:188348444-188348466 CAGAGTTAGGTAAAGCAGAGAGG + Intergenic
985886771 5:2686265-2686287 CAGTGTGAGGCAAAGCTGGCTGG - Intergenic
986527408 5:8695057-8695079 CAGGATGGGGTAAAGAATGCTGG - Intergenic
986667255 5:10114458-10114480 CAGAAGGAGGGAGTGCAGGCCGG - Intergenic
987260094 5:16194891-16194913 AAGAATGAAGAAAAGCAGGGTGG + Intergenic
987416197 5:17663995-17664017 GAGAATGAAGAAAAGCAGGATGG - Intergenic
987885476 5:23806768-23806790 CAGGATGAGGGAGAGAAGGCAGG - Intergenic
988202596 5:28086618-28086640 GAGAATGAGCTACAGCAGGGCGG + Intergenic
989301861 5:39904129-39904151 CAGAAAGAGGAAAAACTGGCTGG - Intergenic
990403821 5:55467868-55467890 CAGAAAGAGTTAAGGAAGGCAGG - Exonic
990917451 5:60925432-60925454 CAGAAGGAGCTATAGCAGTCTGG - Intronic
993055623 5:82976037-82976059 CAGAATGAGCCAAGGCAGGCAGG + Intergenic
993837753 5:92835599-92835621 GAGAAGGAGGAAAAGCAGGGTGG - Intergenic
994298681 5:98121172-98121194 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
994344069 5:98664349-98664371 GAGAGTGAGGAAAAGCAGGGCGG + Intergenic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
995049192 5:107683366-107683388 CTGAAGGATGTTAAGCAGGCAGG - Intergenic
995213962 5:109573475-109573497 GAGAAGGTGGTAATGCAGGCAGG - Intergenic
995258395 5:110073230-110073252 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
996054477 5:118968487-118968509 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
996778863 5:127161071-127161093 GAGAACGAAGTAAAGCAGGGTGG - Intergenic
997621039 5:135295559-135295581 CAGAATGAGGACATGCATGCAGG - Intronic
999365430 5:151020677-151020699 CAGGAGCAGGGAAAGCAGGCAGG - Exonic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999686903 5:154111360-154111382 CAGAATTAGGAAATTCAGGCAGG + Intronic
999700366 5:154222147-154222169 CAGAAAGACAAAAAGCAGGCAGG - Intronic
1000993713 5:167937677-167937699 CAGAATTGAGAAAAGCAGGCAGG - Intronic
1002211549 5:177602348-177602370 CAGAAAGGGGTAAGGCAGTCAGG - Intronic
1002501174 5:179648622-179648644 CAAAATAAGGTAGAGCCGGCTGG - Intergenic
1002967059 6:1977609-1977631 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1003605976 6:7561411-7561433 GGGAATGAGGTAAAGCATGCAGG - Intronic
1003651756 6:7967313-7967335 CAGAAGGAGGACAAGCAGGTTGG + Intronic
1004984028 6:21059587-21059609 GAGAGTGAGGAAAAGCAGGGCGG - Intronic
1006639017 6:35479509-35479531 CAGAGTGAGGGAAAACAAGCTGG + Intronic
1006712078 6:36083192-36083214 GAGAGTGAGGAAAAGCAGGGTGG + Intronic
1007969200 6:46033607-46033629 CAGAATGAGGAAGGGCTGGCAGG - Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1008934968 6:56981108-56981130 CAAAATCTGATAAAGCAGGCTGG - Intronic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1009405582 6:63308049-63308071 GGGAGTGAGGTAAACCAGGCTGG + Intronic
1010732918 6:79409978-79410000 CAGAATGAAGGAAAGCAGTTTGG - Intergenic
1015237603 6:130988790-130988812 AAGAATGAAGGAAAGGAGGCTGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017813832 6:158002778-158002800 CAGGATGAGGCAGAACAGGCAGG - Intronic
1017868804 6:158468839-158468861 TAGAATGAGTAAAAGCAGGGAGG + Intronic
1017999950 6:159570105-159570127 CAGAGTGAGGCAAAGCAAGGCGG + Intergenic
1018515894 6:164579781-164579803 TAAGATGAGGAAAAGCAGGCCGG - Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019349499 7:547580-547602 TAGAATGAGAAACAGCAGGCCGG - Intergenic
1020482498 7:8679241-8679263 AAGAATTGGATAAAGCAGGCTGG - Intronic
1020868141 7:13591481-13591503 GAGAGTGAGGAAAAGCAGGATGG - Intergenic
1022258852 7:28685043-28685065 CAGAGTGAGGAAAAACAGCCTGG - Intronic
1022425940 7:30268925-30268947 CAGCATGAGGAAAATCAAGCAGG + Intergenic
1022745428 7:33166854-33166876 GAGGGTGAGGTAAAGCAGGGTGG - Intronic
1022925092 7:35048746-35048768 CAGGATGAGGAAAAGCACACTGG - Intergenic
1023049236 7:36236575-36236597 CAGTAAGAGGTGAAGCTGGCTGG + Intronic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023196281 7:37642578-37642600 GAGAGTGAGGAAAAGCAGGTGGG - Intergenic
1023344091 7:39253266-39253288 TAGCATGAGGCAAAGAAGGCAGG - Intronic
1024859559 7:53823196-53823218 GAGAGTGAGGAAAAGCAGGGTGG + Intergenic
1024884310 7:54124378-54124400 CAGACTGAGGGAGAGAAGGCAGG + Intergenic
1025115062 7:56250626-56250648 CAGCATGAGGTAGAGATGGCAGG - Intergenic
1026294248 7:69037448-69037470 CAGGAGGAGGAAAAGCAGGTTGG - Intergenic
1028835515 7:95370279-95370301 CAGAATCAGGGAAGGCATGCTGG + Intronic
1030547409 7:110914091-110914113 CAGGAAGAGCAAAAGCAGGCTGG - Intronic
1031123059 7:117742965-117742987 CAGGAAGAGGTGAAGCAGGCTGG - Intronic
1032379298 7:131459453-131459475 GAGAATGAGGGAAGACAGGCAGG + Intronic
1032951325 7:136917583-136917605 CAGAATGAGGTAAACAAGGATGG + Intronic
1033205181 7:139414134-139414156 TAGAATGAGGTGAAGAAGGGGGG - Intronic
1033760223 7:144429382-144429404 CAGAATTATGTAAGGGAGGCAGG - Intergenic
1033977337 7:147117436-147117458 GAGAATGAAGGAAAGCAGGATGG - Intronic
1034277946 7:149831953-149831975 CAGGATGAGGTAAACCAGGTAGG - Intergenic
1034882879 7:154775924-154775946 CAGAGGGACGTAAAGGAGGCCGG - Intronic
1034939900 7:155223797-155223819 CTGAAAGGGGCAAAGCAGGCAGG - Intergenic
1035528718 8:334931-334953 CAGAAGGTGGCAAGGCAGGCAGG + Intergenic
1037167879 8:15853035-15853057 GAGAAAGAGGCAAAGCAGACAGG - Intergenic
1037716039 8:21401042-21401064 CATAATGAGATATAGGAGGCAGG - Intergenic
1039025473 8:33253211-33253233 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1039820407 8:41129567-41129589 GAGAATGAAGAAAAGCAGGTGGG + Intergenic
1040471940 8:47741134-47741156 CAGAATGACGTGAACCAGGGAGG + Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041021597 8:53643719-53643741 CAACATGAGGTACAGCAGGATGG - Intergenic
1041027630 8:53703394-53703416 CAGGCTTAGGAAAAGCAGGCAGG + Intergenic
1041396141 8:57393628-57393650 CCGAATGAGGTGAAGAATGCTGG - Intergenic
1041809981 8:61897160-61897182 CAGAATGAAGTTAATAAGGCTGG - Intergenic
1042426871 8:68659355-68659377 CAGAAGGAGGCAAAAGAGGCTGG - Intronic
1042870287 8:73391968-73391990 AACAATGAGGTAATGAAGGCCGG + Intergenic
1042917756 8:73892125-73892147 TAGAAAGTGGTAAACCAGGCTGG + Intergenic
1043161780 8:76855016-76855038 TGGAATGAAGGAAAGCAGGCAGG + Exonic
1043224101 8:77701021-77701043 CAGTGAGAGGTAAAGCTGGCTGG + Intergenic
1043553871 8:81406708-81406730 GAGAATGAGGTAAAGCGGAAAGG + Intergenic
1044018462 8:87074720-87074742 GAGAATGAAGAAAAGCAGGGTGG - Intronic
1044113234 8:88302861-88302883 GAGAATGAAGAAAAGCAGGGAGG + Intronic
1044307162 8:90651020-90651042 TAGATTGAGGTAAAGAAGGCTGG + Intronic
1044447682 8:92297463-92297485 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1046663864 8:116977804-116977826 TAGAAAGTGGTAGAGCAGGCTGG - Intronic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1047226207 8:122957210-122957232 AATAATGAGGTAAAGATGGCAGG - Intronic
1047280419 8:123440449-123440471 CAGAAAGACGAAAAGCAGCCAGG - Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048315669 8:133360018-133360040 CAGACAGAGGCAAAGCTGGCAGG - Intergenic
1050231835 9:3534405-3534427 CAGAAACAGGTAAGACAGGCTGG + Intergenic
1052176884 9:25473007-25473029 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1053267631 9:36726585-36726607 CATAATGAGGTACAGAAAGCGGG - Intergenic
1053720612 9:40943272-40943294 AAGAAAGAGCAAAAGCAGGCCGG + Intergenic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1057917990 9:99072218-99072240 AAGTATGAGGAAAGGCAGGCAGG - Intergenic
1058451527 9:105100746-105100768 AAGAATGATGGAAATCAGGCCGG - Intergenic
1058935816 9:109768175-109768197 CAGGAGGGAGTAAAGCAGGCAGG + Intronic
1059262785 9:112994283-112994305 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1061218378 9:129235086-129235108 CAGATTGGGGGAAAGGAGGCCGG - Intergenic
1061939667 9:133877139-133877161 CAGAAGGGGGTCTAGCAGGCCGG - Intronic
1203454518 Un_GL000219v1:152611-152633 AAGAAAGAGCAAAAGCAGGCCGG - Intergenic
1185845303 X:3432323-3432345 CTGAATGCAGTAAAACAGGCAGG - Intergenic
1185853788 X:3513361-3513383 GAGAATGAGGCAAAGGAGTCTGG + Intergenic
1188282845 X:28291415-28291437 AGGACTGAGGTAAAGCAGTCAGG + Intergenic
1188361997 X:29266420-29266442 CAGGTTGAGGTAATGCAGGCAGG + Intronic
1190960288 X:55240486-55240508 AAGAGTGAGGAAAAGCAGGGTGG + Intronic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1191065643 X:56343942-56343964 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1191254002 X:58272030-58272052 CAGGGTGAGGTTGAGCAGGCTGG - Intergenic
1191832576 X:65430853-65430875 GAGAATGAAGAAAAGCAGGATGG - Intronic
1192292666 X:69814693-69814715 GAGAATGAAGAAAAGCAGGATGG + Intronic
1192572395 X:72217246-72217268 CAAAGTGAGTAAAAGCAGGCAGG - Intronic
1192897400 X:75458937-75458959 GAGAATGAAGAAAAGCAGGGTGG + Intronic
1192928268 X:75778896-75778918 CAGAAGGAGGCAATCCAGGCTGG + Intergenic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193191265 X:78573569-78573591 CAGAATGAGGTAGAGCAAGATGG - Intergenic
1193692738 X:84667638-84667660 CACCATGAGTTAAAGCAGTCTGG + Intergenic
1194179563 X:90695673-90695695 CAGGCTGAGGGAAAGAAGGCAGG + Intergenic
1194203441 X:90983151-90983173 AAGAGTGAGCAAAAGCAGGCTGG + Intergenic
1194451689 X:94051194-94051216 GAGAATGAGGTAAATCCGGGAGG + Intergenic
1194875251 X:99179008-99179030 AAGCATGAGGTAAAGCAGCAAGG - Intergenic
1195512691 X:105735667-105735689 AAGAATAAGGCAAAGCAGGGTGG - Intronic
1195640470 X:107169255-107169277 AAGAATAAGGTACAGCAGGAAGG + Intronic
1195693650 X:107650216-107650238 CAGAATGAGATAATGCAGGTAGG - Exonic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1196770016 X:119283947-119283969 AAGAATGAGGCAGATCAGGCCGG + Intergenic
1197180767 X:123533661-123533683 GAGAATGAAGAAAAGCAGGGTGG - Intergenic
1197349053 X:125359816-125359838 TAAAATGAGGTAAGGCATGCTGG + Intergenic
1197424116 X:126273505-126273527 GAGAGTGAGGAAAAGCAGGGTGG - Intergenic
1197878905 X:131143826-131143848 AAGAATGATGTAATGGAGGCCGG + Intergenic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1198542486 X:137654469-137654491 CTGAATGAAGTAAAGGAGGTGGG - Intergenic
1198825883 X:140697284-140697306 AAAAATTAGGTATAGCAGGCTGG - Intergenic
1199443651 X:147897036-147897058 CAGTAAGAGGTAAAGCCTGCTGG - Intergenic
1199573321 X:149289668-149289690 AAGAGTGAGATGAAGCAGGCTGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic