ID: 1146574368

View in Genome Browser
Species Human (GRCh38)
Location 17:33978646-33978668
Sequence TTCCTATGCTTACGGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146574363_1146574368 20 Left 1146574363 17:33978603-33978625 CCCTATTTCATAGTTTAACATTT 0: 1
1: 0
2: 6
3: 56
4: 676
Right 1146574368 17:33978646-33978668 TTCCTATGCTTACGGTGTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 52
1146574364_1146574368 19 Left 1146574364 17:33978604-33978626 CCTATTTCATAGTTTAACATTTC 0: 1
1: 2
2: 3
3: 47
4: 523
Right 1146574368 17:33978646-33978668 TTCCTATGCTTACGGTGTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 52
1146574365_1146574368 -9 Left 1146574365 17:33978632-33978654 CCACCTGTGTCAAATTCCTATGC 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1146574368 17:33978646-33978668 TTCCTATGCTTACGGTGTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146574368 Original CRISPR TTCCTATGCTTACGGTGTGC TGG Intronic
900306360 1:2010807-2010829 TTCCTATACTTAGGGGGTGGGGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
916337112 1:163685342-163685364 TTCCTATTCCTATTGTGTGCTGG - Intergenic
919311133 1:195910923-195910945 TTTCTACACTTACAGTGTGCAGG + Intergenic
924728981 1:246695009-246695031 ATTCCATGCTTACTGTGTGCTGG + Intergenic
1063601734 10:7487996-7488018 CTCCTTTGGTTACAGTGTGCAGG - Intergenic
1067772514 10:49137684-49137706 TTCTTATGCTCACGGTGGGTGGG - Intergenic
1075181873 10:120218657-120218679 TTCTTATGCTTAGTGTTTGCAGG + Intergenic
1078480409 11:11670778-11670800 TTCCTCTGCTCTCTGTGTGCAGG - Intergenic
1079742802 11:24085143-24085165 TCACTATGCTCACTGTGTGCAGG - Intergenic
1082972344 11:59036940-59036962 AGCCCATGCTTATGGTGTGCAGG - Intronic
1083352200 11:62038077-62038099 TGCCTATGCTTATGGGGTGTTGG + Intergenic
1085469621 11:76749110-76749132 TTCTCATGCTTACGGGCTGCTGG - Intergenic
1085712892 11:78845967-78845989 CTCCTAGGCTCACAGTGTGCTGG - Intronic
1087122177 11:94586612-94586634 TTCCTATAGTTACGGTTTTCAGG + Intronic
1092582441 12:9858178-9858200 TTCCTATGCTCATGGTCTCCAGG - Intronic
1098384706 12:69906724-69906746 TTCCTTTGCTCAGGGTGAGCAGG + Intronic
1102566798 12:113802395-113802417 ATCCAATGCCCACGGTGTGCAGG + Intergenic
1104986862 12:132602301-132602323 TTCCTACACTCATGGTGTGCTGG + Intergenic
1105634177 13:22201434-22201456 TTCCCATTGTTACGGTGTGTGGG - Intergenic
1105720419 13:23108184-23108206 TTCCTGTGCTCCAGGTGTGCGGG + Intergenic
1116313216 14:43353082-43353104 TTACTATGCTTACCATTTGCTGG - Intergenic
1117649287 14:57886074-57886096 ATCACATGCTTACTGTGTGCTGG + Intronic
1117839267 14:59841817-59841839 TTCTTATGCTTATTGTTTGCAGG - Intronic
1146574368 17:33978646-33978668 TTCCTATGCTTACGGTGTGCTGG + Intronic
1147468226 17:40629665-40629687 GTCTTATGCTTAAGGTTTGCAGG - Intronic
1148561283 17:48608095-48608117 TTCCTCTGAATACTGTGTGCAGG - Exonic
1164478239 19:28591665-28591687 TTTCCATGCTTAGGGTCTGCAGG + Intergenic
939328658 2:140729371-140729393 TGCCTATGCTTACTGTGTAAGGG + Intronic
940015146 2:149096716-149096738 TTCCTAAGCTTACTTTCTGCAGG + Intronic
944984677 2:205161899-205161921 TTCCTGTGCATTCTGTGTGCTGG + Intronic
945193008 2:207209447-207209469 TTCCTATACTTGTGGTTTGCAGG - Intergenic
948636003 2:239338015-239338037 TTCCCTGGCTTTCGGTGTGCTGG - Intronic
1179814865 21:43899133-43899155 TTCCTCTGGTTAGAGTGTGCTGG + Intronic
965347702 3:167572674-167572696 TTCCTATGTTTTTGGTGTGAGGG - Intronic
973091519 4:46142978-46143000 TTCCTATGCTTACTTTGTTGAGG + Intergenic
978728036 4:111993607-111993629 TCACTATGCTTATGGTCTGCTGG - Intergenic
979134150 4:117087085-117087107 TTCCTACGCTTTGGGTGTGTGGG - Intergenic
981508260 4:145527165-145527187 TTTTTATGCTTTCTGTGTGCTGG + Intronic
990876157 5:60488529-60488551 TTCCTATTCTAATCGTGTGCAGG + Intronic
994024616 5:95068380-95068402 TTCCTATGTTTACTGTCTGTTGG - Intronic
1000141761 5:158411658-158411680 TTCCTATTCTTACAGGGTGCCGG + Intergenic
1023758635 7:43443783-43443805 TTCCTATGCTTAGGTCCTGCAGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035638027 8:1161841-1161863 TTCCTGTGCTCACGGCCTGCAGG + Intergenic
1041619201 8:59945716-59945738 TTCCTTTGCTTACGGTTTTTAGG + Intergenic
1042706788 8:71671948-71671970 TGCCTATGCTTGCGTTGTGACGG + Intergenic
1047069231 8:121324087-121324109 TTCCCATGCTTACTGTGTTTGGG + Intergenic
1049995373 9:1029236-1029258 TTCCTGTGGTTGCTGTGTGCAGG + Intergenic
1053225252 9:36349658-36349680 TGCCTATGCTTGTGGTGTGATGG + Intronic
1055657907 9:78470454-78470476 TTCCTATGCTTATGCTGCTCAGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1193214135 X:78842342-78842364 TTCATATGCTTACTGGATGCAGG - Intergenic
1199342335 X:146695618-146695640 GGCCTATGCTTATTGTGTGCAGG + Intergenic