ID: 1146578044

View in Genome Browser
Species Human (GRCh38)
Location 17:34012046-34012068
Sequence CAAAATAAGGGGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1356
Summary {0: 1, 1: 1, 2: 43, 3: 146, 4: 1165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146578044_1146578057 18 Left 1146578044 17:34012046-34012068 CCTTCCTCCCTCCCCTTATTTTG 0: 1
1: 1
2: 43
3: 146
4: 1165
Right 1146578057 17:34012087-34012109 CCTGCCTGACACCAAGCCAGGGG 0: 1
1: 0
2: 0
3: 25
4: 221
1146578044_1146578053 16 Left 1146578044 17:34012046-34012068 CCTTCCTCCCTCCCCTTATTTTG 0: 1
1: 1
2: 43
3: 146
4: 1165
Right 1146578053 17:34012085-34012107 TCCCTGCCTGACACCAAGCCAGG 0: 1
1: 0
2: 7
3: 41
4: 358
1146578044_1146578058 19 Left 1146578044 17:34012046-34012068 CCTTCCTCCCTCCCCTTATTTTG 0: 1
1: 1
2: 43
3: 146
4: 1165
Right 1146578058 17:34012088-34012110 CTGCCTGACACCAAGCCAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 257
1146578044_1146578055 17 Left 1146578044 17:34012046-34012068 CCTTCCTCCCTCCCCTTATTTTG 0: 1
1: 1
2: 43
3: 146
4: 1165
Right 1146578055 17:34012086-34012108 CCCTGCCTGACACCAAGCCAGGG 0: 1
1: 0
2: 2
3: 35
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146578044 Original CRISPR CAAAATAAGGGGAGGGAGGA AGG (reversed) Intronic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
900670082 1:3846889-3846911 GGAAAGAAAGGGAGGGAGGAAGG + Intronic
900859041 1:5212134-5212156 GAAACTATGGGGAGGGAGGGAGG + Intergenic
900882944 1:5394825-5394847 TAAAAGAAAGGGAGGAAGGAAGG + Intergenic
900979906 1:6040482-6040504 CAAAATAAGGGAGGGGAAGAGGG - Intronic
901140571 1:7026605-7026627 GAAACTAAGGGCTGGGAGGATGG + Intronic
901199030 1:7456275-7456297 AAGAAGAATGGGAGGGAGGAAGG + Intronic
901701617 1:11047438-11047460 CAAAAAAAAGGGAGGGGTGAGGG - Intergenic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
901938663 1:12645294-12645316 CAAAAGGAGGGAAGGAAGGAAGG - Intronic
902261054 1:15225172-15225194 CAAAAAAAGGGAAGGAAGGAAGG + Intergenic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
903202007 1:21748921-21748943 GAAAAAAACAGGAGGGAGGAGGG + Intronic
904073095 1:27816982-27817004 GGAAGGAAGGGGAGGGAGGAAGG + Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904422274 1:30402016-30402038 CAAACTTGAGGGAGGGAGGAAGG - Intergenic
904816930 1:33210783-33210805 CAAAATAAAGGGATGGAGGAAGG - Intergenic
904985179 1:34540194-34540216 AAAAAAAATGGGAGGGGGGAAGG + Intergenic
905034681 1:34910048-34910070 AAGAATAAGGGGAGGAAAGATGG - Intronic
905178784 1:36154384-36154406 CAAGACAAGGGGTGGGAGGTGGG + Intronic
905685522 1:39904844-39904866 AAAATTAGGGGGAGGGGGGAGGG - Intergenic
905772087 1:40644890-40644912 CACAGAAAGGGGAGGGAGAATGG + Intronic
906223264 1:44099917-44099939 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
906468949 1:46110823-46110845 GAAAAAAAGCGGAGGGGGGAGGG + Intronic
906509696 1:46403925-46403947 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
906538488 1:46565907-46565929 AGAGAAAAGGGGAGGGAGGAAGG - Intronic
906626766 1:47332013-47332035 GAAAAGAAGGGTAGGAAGGATGG + Intergenic
906927777 1:50137506-50137528 AAAAAAAAGGGAAGGAAGGAAGG + Intronic
907022412 1:51080995-51081017 AAAAAAAAGGGGGGGGGGGAAGG + Intergenic
907132274 1:52107645-52107667 AAAAAAAGGAGGAGGGAGGAGGG - Intergenic
907380421 1:54082706-54082728 GAAAGTGAGGGGAGGGAGGAAGG + Intronic
907619403 1:55961186-55961208 CAGAATATGAGGTGGGAGGATGG - Intergenic
907826098 1:58018255-58018277 CAAAATGAGAGAAGGTAGGAAGG - Intronic
907858487 1:58327282-58327304 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
907922129 1:58923402-58923424 CAAAAGAGGGTGAGGGAGAAGGG - Intergenic
908000145 1:59671522-59671544 CAGAGTAGGTGGAGGGAGGAAGG + Intronic
908288798 1:62640597-62640619 CAAAATACAGGGAAGGAGCAAGG + Intronic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
908556287 1:65259783-65259805 CAAACTGAGGGGTGGGAGGATGG + Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
909602216 1:77472579-77472601 GAAAAGAAGAGGAGGGAGGGAGG + Intronic
909645243 1:77909695-77909717 CAATATAATGGGGGAGAGGATGG - Intronic
909795186 1:79726420-79726442 AAAAATATGTGGAAGGAGGATGG + Intergenic
909985071 1:82151449-82151471 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
910295837 1:85644131-85644153 CAAAATAAAAGGATGGAGGAAGG + Intergenic
910383810 1:86659731-86659753 CAAAAGAAAGGGATGGAGGAAGG + Intergenic
910709983 1:90169112-90169134 CAAAATAAAGGGATGGAGGAAGG + Intergenic
910840831 1:91559903-91559925 CCAAAGAATGGGATGGAGGATGG + Intergenic
911065981 1:93788971-93788993 AAAAATAAAGGAAGGGAGGGAGG - Intronic
911094424 1:94044129-94044151 GAAAAAAAAGGAAGGGAGGAAGG - Intronic
911175163 1:94811178-94811200 GAAAATAAGGGGGAGAAGGAGGG - Intergenic
911477386 1:98390269-98390291 CAAACTAGAGGGAGGAAGGACGG + Intergenic
911596578 1:99804938-99804960 CAAAATTGGGGGTGGAAGGAGGG - Intergenic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
911834345 1:102596992-102597014 CAAGAAAAGGGAAGGAAGGAAGG + Intergenic
911857561 1:102899810-102899832 GAGAATAAGGTGAGGCAGGAGGG + Intronic
911987750 1:104651679-104651701 CAAAACAAGGGGACAGAGTATGG - Intergenic
912114580 1:106389513-106389535 CGAAATAAAGGAAGGAAGGAAGG - Intergenic
912723029 1:112035833-112035855 GAGAATAAAGGGAGGAAGGATGG - Intergenic
912859399 1:113199531-113199553 GAAAAAATGGGGTGGGAGGATGG + Intergenic
912870291 1:113298061-113298083 AAAAAAAAGGGGAGAGAGCAAGG - Intergenic
912938451 1:114024078-114024100 GAGAATGAGGTGAGGGAGGAGGG + Intergenic
913092368 1:115486122-115486144 AAAAATAAAGGGATGGAGAATGG + Intergenic
913467186 1:119155130-119155152 CAAAATAAAGGGATGGAGGAAGG - Intergenic
913484372 1:119320274-119320296 GAAAAGGAAGGGAGGGAGGAAGG - Intergenic
913942964 1:125125205-125125227 CAAAATAAAGGGATGGAGGAAGG + Intergenic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
915424756 1:155815960-155815982 GAAAATAAGGGGAAGAAGCAGGG + Intronic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915907230 1:159887774-159887796 GGGAATAAGGGGAGGGCGGAGGG + Intronic
916386642 1:164280414-164280436 CCAAATGAAGGGAGGGAGGGAGG + Intergenic
916463262 1:165048138-165048160 GAAAATAAGGGGCAGGAGGGAGG - Intergenic
916593359 1:166215986-166216008 CAAAAGGAGGGAAGGTAGGAGGG - Intergenic
917264236 1:173202960-173202982 GAAGATGAGAGGAGGGAGGAGGG - Intronic
917482902 1:175427799-175427821 AAAAAAGAGGGAAGGGAGGAAGG - Intronic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917952634 1:180056462-180056484 AAAAAAAAGGGGGGGGGGGAGGG - Intronic
918132499 1:181642033-181642055 CAAAATAATAAGAGGGAGCAGGG + Intronic
918195019 1:182213202-182213224 GAAAAAAATGGGAGGGAAGAAGG - Intergenic
918394297 1:184097954-184097976 AGAAAGAAGGGGAGGGAGGGAGG + Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918665623 1:187146876-187146898 AAGAAAAAAGGGAGGGAGGAAGG - Intergenic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
919121506 1:193346514-193346536 GCAGATATGGGGAGGGAGGATGG + Intergenic
919354174 1:196500141-196500163 CAAAAAAAAGGGAGGAAAGAAGG + Intronic
919553834 1:199026999-199027021 AGAAATAAGAGGAGGAAGGAAGG - Intergenic
919712010 1:200738637-200738659 GAAAAGGAAGGGAGGGAGGAGGG - Intergenic
919787178 1:201266436-201266458 TAAAAGAAAGGAAGGGAGGAAGG - Intergenic
919800078 1:201348564-201348586 GAAACTAAGGGCAGGCAGGAAGG + Intergenic
920063269 1:203244069-203244091 AAGAAGAAGGGGAGGAAGGAGGG + Intronic
920098731 1:203503322-203503344 GAAGAGAAGGGGAGAGAGGAAGG - Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920364157 1:205439344-205439366 CAAAGGAAGGGGTTGGAGGATGG + Intronic
920364253 1:205439837-205439859 CAAAATGAAGGGAGAGAGGAAGG + Intronic
920850478 1:209624935-209624957 GAAAAAAAGGGAAGGAAGGAAGG + Intronic
921072156 1:211669878-211669900 CAGAAGAAGGGGAGGGGTGATGG - Intronic
921468864 1:215524696-215524718 TACTAGAAGGGGAGGGAGGAGGG - Intergenic
921566946 1:216732842-216732864 AAAAAAAAGGGGGGGGAGGAGGG + Intronic
921585540 1:216942062-216942084 CCAAAAGAGGGGAGGGAGGGAGG - Intronic
921661411 1:217807248-217807270 CCAAAAGAGGGGAGGGAGGGAGG + Intronic
921918557 1:220641599-220641621 CAAAATAAAGGGAAGAAGGAAGG + Intronic
922325203 1:224521832-224521854 AAAAATAAGGTGGGGGATGAGGG - Intronic
922436527 1:225612840-225612862 CAAAAAAAAGGGGGGGAGGAGGG + Intronic
922437348 1:225619579-225619601 CAAAATAAGACTAGGGAGGTGGG - Intronic
922887060 1:229028289-229028311 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923093029 1:230753853-230753875 CTAAACAAAGGGAGGGAGGGAGG - Intronic
923103065 1:230832658-230832680 CAAAATGAGGGGGTGGAGGGAGG + Intergenic
923191378 1:231623780-231623802 CAAGATAAGGGGTGGGGAGAAGG + Intronic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
923332929 1:232942494-232942516 CAAAATAGGAGAAGGAAGGAAGG + Intergenic
923569068 1:235098409-235098431 CAAACTCTAGGGAGGGAGGAAGG + Intergenic
923643955 1:235796143-235796165 CAAAAAAAGAGGAGGGAATATGG + Intronic
923828140 1:237522892-237522914 CAAAATAAGGGAAGCAAGAAAGG - Intronic
923920352 1:238557135-238557157 GAAAATAAGGGCAGAGGGGATGG + Intergenic
923953302 1:238985912-238985934 CAAAATAAGAGGAGGAAATAAGG + Intergenic
924052152 1:240090166-240090188 CAAAAGAAGGGAAAGAAGGAGGG - Intronic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1062767171 10:74690-74712 GAAAGTAAGGGGAAGGAGAAGGG + Intergenic
1063138403 10:3236608-3236630 CAAAGGAAGGGGACGGAGAACGG - Intergenic
1063207592 10:3849155-3849177 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1063718817 10:8557579-8557601 TAAAAGAATGGGAGGGTGGAAGG + Intergenic
1064493526 10:15884751-15884773 AAAAAAAAAGGAAGGGAGGAAGG - Intergenic
1064497443 10:15927560-15927582 AATAATAAAGGTAGGGAGGATGG + Intergenic
1064525233 10:16249268-16249290 TACTAGAAGGGGAGGGAGGATGG + Intergenic
1064817991 10:19288695-19288717 CAGAATGAGAGGAGGAAGGATGG - Intronic
1065077130 10:22091554-22091576 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1065341515 10:24711108-24711130 AAAAAAAAGGGAAGGAAGGAAGG + Intronic
1065351559 10:24800132-24800154 CTAAATAAGGGAAGGCAGGCAGG - Intergenic
1065421978 10:25555050-25555072 GGAAAGAAGGGGAGGGAGGGAGG + Intronic
1065434583 10:25693856-25693878 CAAAATGGGGGAAGGAAGGACGG - Intergenic
1065759088 10:28965013-28965035 CAAGAGGAGGGGAGAGAGGAGGG - Intergenic
1065833135 10:29632743-29632765 CTAAATAAAGGTAGGCAGGAAGG + Intronic
1065933928 10:30503660-30503682 CAAAATAAGAGTGGGTAGGAGGG - Intergenic
1066258259 10:33703128-33703150 TAAAATAAGAGGAAGAAGGAAGG - Intergenic
1066371526 10:34821991-34822013 AAAGAAAAGGGGAGGGAGGAAGG + Intergenic
1066371549 10:34822065-34822087 GAAAAAGAAGGGAGGGAGGAAGG + Intergenic
1066523382 10:36247959-36247981 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1067078675 10:43202127-43202149 CAACTTAAGGGGAAGGAAGAAGG - Intronic
1067493717 10:46741667-46741689 CAAAACAGGGGAAGGAAGGAAGG - Intergenic
1067600943 10:47598738-47598760 CAAAACAGGGGAAGGAAGGAAGG + Intergenic
1067991526 10:51218866-51218888 GAGAAGAAGGGGAGGAAGGAAGG + Intronic
1068266359 10:54655207-54655229 CAAAAAAAAGGAAGGGAGGAAGG + Intronic
1068343096 10:55734537-55734559 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1068897193 10:62219057-62219079 CAAAAGAAGGGGAGGAGGAAGGG - Intronic
1069610449 10:69769213-69769235 GAAAAAAAAGGGAGGGAGGGAGG - Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069824079 10:71244661-71244683 CAAGAGGAGAGGAGGGAGGAGGG + Intronic
1069966936 10:72127069-72127091 CAACATAAGGGAATGGAGGGTGG + Intronic
1070065252 10:73027600-73027622 AAAAAAAAGGGAAGGAAGGAAGG + Intronic
1070493920 10:77003798-77003820 AAGGATAAGGGGAGGGATGATGG + Intronic
1070682224 10:78456651-78456673 CAAAAAAATGGGGGGGTGGATGG + Intergenic
1070941885 10:80356039-80356061 TAAAATGTGGGAAGGGAGGAAGG + Intronic
1071160067 10:82735024-82735046 AAAAAGAAGGGAAGGGAAGAAGG + Intronic
1071199885 10:83209427-83209449 CATAATGAGGGGGTGGAGGAGGG - Intergenic
1071652488 10:87406605-87406627 CAAAACAGGGGAAGGAAGGAGGG + Intergenic
1072161493 10:92771231-92771253 GAAAAAGAAGGGAGGGAGGAAGG - Intergenic
1072742553 10:97918205-97918227 GGAAATAAGGGAAGGGACGAGGG - Intronic
1072842877 10:98794986-98795008 GAAAGGGAGGGGAGGGAGGAAGG + Intronic
1072879013 10:99205085-99205107 CAAAAGCAGGGAAGGTAGGAGGG + Intronic
1072908221 10:99474978-99475000 CAAGAAAAGGAGAGGGAAGAGGG + Intergenic
1073178115 10:101568908-101568930 TCAAACAAGGGGAGGGAGGCTGG + Intergenic
1073312878 10:102556746-102556768 AAAAAGGAAGGGAGGGAGGAAGG + Intronic
1073342715 10:102757873-102757895 AAAAAAAAGGGGGGGGGGGAGGG - Intronic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074087023 10:110215877-110215899 AAAAAGAGAGGGAGGGAGGATGG + Intronic
1074655714 10:115585611-115585633 CAAAATAAAAGGATGGAGGAAGG - Intronic
1074807463 10:117067749-117067771 TAAAATAATGGCAGGAAGGATGG + Intronic
1074909980 10:117899682-117899704 AAAAAAAAAGGAAGGGAGGAAGG + Intergenic
1075051274 10:119184017-119184039 CAACAAAAGGGGAGGGGGGAGGG + Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077817690 11:5703194-5703216 CTACACTAGGGGAGGGAGGAGGG - Intronic
1077885610 11:6385439-6385461 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
1078312668 11:10260888-10260910 AGAAAGAAGGGGAGGGAGGGAGG + Intronic
1078380724 11:10837711-10837733 CAAGAAAGGGGGAGGGGGGAAGG - Intronic
1078911919 11:15740454-15740476 CAAAAGAAAAGGAAGGAGGAAGG + Intergenic
1079591790 11:22191882-22191904 GAAAAAAAGAAGAGGGAGGAAGG - Intergenic
1079687162 11:23373563-23373585 AAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1079749999 11:24185316-24185338 GAAGAAAAAGGGAGGGAGGATGG + Intergenic
1079839026 11:25371026-25371048 CCAAAATGGGGGAGGGAGGAAGG + Intergenic
1079956901 11:26877458-26877480 CAAAATAAAGGCATAGAGGAAGG + Intergenic
1080011780 11:27467278-27467300 CAAAATAAGGCGGGGCACGATGG + Intronic
1080312051 11:30905851-30905873 CAGGATTAGGGAAGGGAGGAGGG + Intronic
1080782881 11:35447501-35447523 CAAAATAAAAGGATGGAGGAAGG - Intronic
1081341567 11:41934154-41934176 TAAAATAAAGGGAGGAAAGAAGG + Intergenic
1081401586 11:42649198-42649220 GAAAAGAGGGGGAGGGAGGCTGG - Intergenic
1081718693 11:45270015-45270037 GAAAATAAGGGTAGGGTGGCTGG - Intronic
1082063385 11:47879463-47879485 CGAAAGAGGGGAAGGGAGGAGGG + Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083280818 11:61626496-61626518 CACAATGGGGGGAGGGGGGAGGG - Intergenic
1083341082 11:61958804-61958826 AAAAATAAAGGAAGGTAGGAAGG - Intronic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083975438 11:66115776-66115798 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1084122249 11:67076502-67076524 CCAAATAAGAGGAGGGAAGTCGG + Intergenic
1084219919 11:67671534-67671556 AAAAAAAAGGGGGGGGAGGCAGG - Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085525075 11:77159405-77159427 CAGCATCAGGGGAGGGAGGGTGG - Intronic
1085786041 11:79450861-79450883 CAAAATAAGGGGGGTAGGGAAGG - Intergenic
1085806701 11:79643198-79643220 AGAAATAACGGGAGGGGGGAAGG + Intergenic
1085860195 11:80224246-80224268 AAAAAAAAGGGCAGGGAGGGCGG - Intergenic
1085872969 11:80372050-80372072 CAAAATAAAGCCAGGCAGGATGG - Intergenic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086092059 11:83014783-83014805 AAAGAGAAGGGGAGGGAGGGAGG + Intronic
1086260265 11:84931300-84931322 GAAAATAAAGGGTGGGAGAAGGG - Intronic
1086382668 11:86274021-86274043 CAAAATGAGGGAAGAGAGCAGGG - Intronic
1086428456 11:86711647-86711669 TTAAAAAAGTGGAGGGAGGAGGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086515870 11:87612800-87612822 AAAAATAAGTGGAGGAGGGAAGG - Intergenic
1086741005 11:90368941-90368963 AAAAAGATGGGGAGAGAGGAAGG - Intergenic
1087465506 11:98499472-98499494 AAAACTAAGGGGTGAGAGGAGGG - Intergenic
1087501171 11:98956018-98956040 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1087761763 11:102110473-102110495 GAAAAGAAAGGGAGGAAGGAAGG + Exonic
1087997003 11:104821797-104821819 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1088157320 11:106823239-106823261 CAAAAGCAGGGAAGGCAGGAGGG - Intronic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089014715 11:115156605-115156627 CAAAATAAGAGAAGGAAGGAAGG - Intergenic
1089125832 11:116175852-116175874 GAAAAGGAAGGGAGGGAGGAGGG - Intergenic
1089157063 11:116410578-116410600 GGAAATAAGGGGAGAAAGGAGGG + Intergenic
1089437419 11:118482084-118482106 CAGAATCAGGTGAGTGAGGAGGG + Exonic
1089735452 11:120547507-120547529 TCAGATAAGGGGAGGGAGGAAGG + Intronic
1089835877 11:121370155-121370177 AAAAATAGGGGGAGGAAAGATGG + Intergenic
1089944897 11:122460240-122460262 TAAAAAAAGGAGAGGGAGAAGGG + Intergenic
1090283941 11:125482520-125482542 CAAAAAAAGAGGAGGGAGGTTGG + Intronic
1090357060 11:126147210-126147232 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1090411091 11:126510456-126510478 CAAAAAAAAGGAAGGAAGGAAGG - Intronic
1090584398 11:128194707-128194729 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1090742002 11:129670949-129670971 CCAAAACGGGGGAGGGAGGAAGG - Intergenic
1090836651 11:130458912-130458934 CAAGATGAGGGCAGGGATGAAGG - Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091517097 12:1195873-1195895 CAAAAAAAGGGGGGGGGGGGCGG - Intronic
1091612110 12:2019482-2019504 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092585252 12:9893696-9893718 GAAAAAAAAGGGAGGGAGGAAGG - Intronic
1092619464 12:10248573-10248595 GAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1092867777 12:12779108-12779130 AAAAATTAGGAGAGAGAGGAGGG - Intronic
1092943393 12:13431107-13431129 CAAATTAAGGGGAGGCAGCTGGG - Intergenic
1093206659 12:16259424-16259446 GGAAATAAGGGAAGGAAGGAGGG - Intronic
1093237268 12:16626734-16626756 TAAAATAAGGGCAGAGAAGAAGG + Intergenic
1093975112 12:25413199-25413221 CAAAAAAAAGGGGGGGGGGAGGG - Intronic
1095089849 12:38093598-38093620 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1095444510 12:42270677-42270699 AAAAAAAAGGGTGGGGAGGACGG + Intronic
1096347056 12:50858311-50858333 CAAAATAATTGGAGGGAGAATGG - Intronic
1096463551 12:51836170-51836192 TAGAACCAGGGGAGGGAGGATGG + Intergenic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1096603084 12:52744302-52744324 AAAGAGAAGGGAAGGGAGGAAGG + Intergenic
1096711978 12:53464317-53464339 TAAATAAAGGGGAGGGAGGGAGG - Intronic
1096810111 12:54164011-54164033 CAAGAGAAGGGGAGGAAGGCAGG + Intergenic
1096830885 12:54313177-54313199 AAAAAGGAAGGGAGGGAGGAAGG + Intronic
1096869516 12:54584582-54584604 TAAAAGAGAGGGAGGGAGGAGGG + Intronic
1097116743 12:56702966-56702988 AAAAAAAAGGGGCGGGGGGAAGG + Intergenic
1097276276 12:57815571-57815593 CAAAATATGGGGAGAGGTGAGGG - Intronic
1097376383 12:58848227-58848249 CAAAAAAAAGGGAGGGAGGAAGG - Intergenic
1097406165 12:59193440-59193462 CAAATTTAGGGGAGGGAGCATGG - Intergenic
1097582456 12:61474442-61474464 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1097602165 12:61706736-61706758 CAAAACAAGGACAGGAAGGAAGG + Intergenic
1097638335 12:62148538-62148560 CCAAAAGAGGGGAAGGAGGAAGG + Intronic
1097864428 12:64547582-64547604 AAAAAGAAGGGAAGGAAGGACGG + Intergenic
1098046534 12:66407166-66407188 TAAAAGAAGGGAAGGGAGAATGG - Intronic
1098104240 12:67052759-67052781 AAAAATGAAGGGAGGGAGGGAGG + Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1099003788 12:77213418-77213440 AAAAAAAGTGGGAGGGAGGAGGG - Intergenic
1099101787 12:78450556-78450578 AAAAAGAAGAGGAGAGAGGAAGG + Intergenic
1099134877 12:78885205-78885227 AAAAATAAGTGGAGAAAGGAAGG + Intronic
1099168747 12:79338661-79338683 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1099493006 12:83309007-83309029 AAAGAAAGGGGGAGGGAGGAAGG - Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1099809144 12:87558452-87558474 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1100286285 12:93169617-93169639 GAAAGGAAGGGGAGGGAGGGAGG + Intergenic
1100405318 12:94267834-94267856 AAAAAGAAGGGGAGGAGGGAAGG - Intronic
1100430669 12:94529340-94529362 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
1100742258 12:97607081-97607103 CAAAATAGACGGATGGAGGAAGG - Intergenic
1100863746 12:98833740-98833762 ACAAAGGAGGGGAGGGAGGAAGG - Intronic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1102337292 12:112092668-112092690 AAAAAAAAGGGGGGGGAGAAAGG - Intronic
1102503160 12:113366809-113366831 AAAAAGAAGGGGAGGGAAGGGGG - Intronic
1102515941 12:113446712-113446734 CAGGATAAGGGGAGAGAGAATGG + Intergenic
1102526582 12:113516275-113516297 AAAAATAAAGGAAGGGAGGAAGG - Intergenic
1102906290 12:116677881-116677903 GAATACAAGAGGAGGGAGGATGG - Intergenic
1103101404 12:118179448-118179470 GATATTATGGGGAGGGAGGAGGG + Intronic
1103135009 12:118499459-118499481 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1103461870 12:121111306-121111328 AAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1103510285 12:121468895-121468917 CAAAAAAAGGAGAGTAAGGAAGG - Intronic
1103659509 12:122502351-122502373 CAAAGTTGGGGGTGGGAGGATGG + Intergenic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104301611 12:127569855-127569877 GAAAATAAAGGAAGGGAGGATGG - Intergenic
1104330028 12:127836152-127836174 CAAAAAAAGGGGCGGGGGGAGGG - Intergenic
1104420663 12:128631976-128631998 CAAAATAATTGGAGTGGGGATGG + Intronic
1104841003 12:131825655-131825677 GAGAAAGAGGGGAGGGAGGAAGG - Intergenic
1105233844 13:18527003-18527025 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1105330879 13:19414073-19414095 CACAAAAAGGGCAGGCAGGAAGG + Intergenic
1105456818 13:20548627-20548649 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1105481954 13:20785892-20785914 GAAAGAAAGAGGAGGGAGGAAGG + Intronic
1106180615 13:27366215-27366237 AAAAAAAAGGGCGGGGAGGAAGG - Intergenic
1106671662 13:31912649-31912671 AAAAAGAAAGGGAGGAAGGAAGG - Intergenic
1107489575 13:40868432-40868454 CAAAATAAATGGATGGAGGAAGG - Intergenic
1107705184 13:43095777-43095799 TAAAATAAGGATAGAGAGGAGGG + Intronic
1107718058 13:43220068-43220090 CAAAGGGAGGGGAGGAAGGAAGG + Intronic
1107774741 13:43825781-43825803 AAAAAAAAAGGGAGGGAGTAGGG + Intronic
1107878837 13:44815564-44815586 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1108070039 13:46619099-46619121 CAAAAAAAAGGAAGGAAGGAAGG - Intronic
1108231559 13:48349229-48349251 AAAAAGAAAGGGAGGGAAGATGG - Intronic
1108554638 13:51581249-51581271 CAAAGTTTGAGGAGGGAGGAAGG - Intergenic
1108853832 13:54768883-54768905 CAAGGGAAGGGAAGGGAGGAAGG - Intergenic
1108894191 13:55302684-55302706 TAAATTAAGGGGATGGAGGAGGG - Intergenic
1109157555 13:58929588-58929610 TAAAATAAGAGGAGAGAAGAAGG + Intergenic
1109267878 13:60221622-60221644 CAATAGAAGGGTAAGGAGGACGG - Intergenic
1109346644 13:61123129-61123151 CCAAATTCGGGGAGGGGGGAGGG - Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109734859 13:66469451-66469473 CAAAAGGAAGGGAGGGAGGGGGG + Intronic
1111074544 13:83216506-83216528 CAAATCAAGGGGAGGGAGCAAGG - Intergenic
1111275006 13:85936564-85936586 GAAAAGAAGGAGAGGAAGGAAGG - Intergenic
1111319191 13:86603094-86603116 AAAAATAAAGGAAGGAAGGAGGG - Intergenic
1111446120 13:88347867-88347889 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1111452618 13:88438740-88438762 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1111569846 13:90069679-90069701 CAAAAAAAAGGAAGGAAGGAAGG - Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1112047721 13:95614708-95614730 CATAATGAAGGAAGGGAGGATGG - Intronic
1112516654 13:100059021-100059043 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1112634960 13:101206202-101206224 AAAGATACAGGGAGGGAGGAAGG - Intronic
1112643929 13:101307672-101307694 CAAGAAAAGGGAAGGGAGGAGGG + Intronic
1113330705 13:109324285-109324307 CACAATAAGGGCAGGGAAGAGGG + Intergenic
1113574935 13:111388660-111388682 GACAATGAGGAGAGGGAGGAGGG - Intergenic
1114043706 14:18703114-18703136 AGAAATAAGAGGAGGGGGGAAGG + Intergenic
1114047993 14:18893556-18893578 AGAAATAAGAGGAGGGGGGAAGG + Intergenic
1114116222 14:19625850-19625872 AGAAATAAGAGGAGGGGGGAAGG - Intergenic
1114419935 14:22573354-22573376 ACATAGAAGGGGAGGGAGGAAGG + Intronic
1114821481 14:26025113-26025135 CAAAATAAGGTAAGATAGGAGGG - Intergenic
1114871948 14:26669241-26669263 CAAAATAAGGGAGAGAAGGAGGG + Intergenic
1115071560 14:29328824-29328846 ATAAATAAGGGAAGGGATGAAGG + Intergenic
1115393505 14:32880035-32880057 GAAAGTAAAGGGAGGGAGAAAGG - Intergenic
1115522113 14:34243301-34243323 CAAAAAAAGAGGAGGGGGTAGGG + Intronic
1116392468 14:44409263-44409285 AAAAATAAAGGGAGGTAGCATGG - Intergenic
1116966268 14:51018302-51018324 AAGAAAAAAGGGAGGGAGGAGGG - Intronic
1117094782 14:52285841-52285863 TAAAATAGGGGGAGGAAAGAAGG - Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117335640 14:54755137-54755159 CAAAATAGAGGCAGTGAGGATGG + Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117383892 14:55192264-55192286 AAAAAAAAGGGGAGGGGGGCTGG - Intergenic
1117489389 14:56230884-56230906 GAAAATAAAGGGATGGAGGAAGG + Intronic
1117557136 14:56897089-56897111 GAAAAAAAAGGGAGGGCGGAGGG + Intergenic
1117579580 14:57138704-57138726 CAAATGAGGGGGAAGGAGGATGG + Intergenic
1117612471 14:57498979-57499001 GAAAGAAAGGGCAGGGAGGAAGG - Intergenic
1117760772 14:59025914-59025936 CAAAAAGCAGGGAGGGAGGAAGG + Intergenic
1117914065 14:60658610-60658632 GAAAAAAAGGGGTGGGGGGACGG + Intergenic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118388157 14:65273934-65273956 GAAAATGAGGGAAGGAAGGAAGG + Intergenic
1118991929 14:70804903-70804925 CAGAAAGAAGGGAGGGAGGAAGG + Intronic
1119131406 14:72176273-72176295 CCCAATGAGGGGTGGGAGGAGGG - Intronic
1119420421 14:74504907-74504929 TGAAAGAAGGGGAGAGAGGAAGG - Intronic
1119595417 14:75928548-75928570 CAATCTCAGGGGAGGGAGGGAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1121398043 14:93644820-93644842 CAAAAAAACTGGAGGGAGGGAGG - Intronic
1121468206 14:94129400-94129422 GAAGGGAAGGGGAGGGAGGAAGG + Intronic
1121559465 14:94863991-94864013 GAAAATAAAGAAAGGGAGGAAGG - Intergenic
1122040401 14:98983779-98983801 CAATAGGAAGGGAGGGAGGAAGG + Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122607519 14:102957215-102957237 AAAAAAAAAGGGAGGGATGAGGG + Intronic
1122706818 14:103627085-103627107 CCAAATGAGAGGAGGGAGGCAGG - Intronic
1123432438 15:20230035-20230057 CAAAAAAAGGGCGGGGGGGAAGG + Intergenic
1124044067 15:26131823-26131845 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1124167756 15:27343161-27343183 AACACGAAGGGGAGGGAGGAAGG + Intronic
1124211976 15:27770995-27771017 GAAAAGAAGGGAAGGAAGGAAGG - Intronic
1124455807 15:29841716-29841738 AAAAAGGAGGGGAGGGAGGGAGG - Intronic
1124548146 15:30651916-30651938 GGGAAGAAGGGGAGGGAGGAAGG - Intronic
1124563478 15:30795445-30795467 CAAATTAAGGTGATGGAGGGTGG - Intergenic
1124889568 15:33719897-33719919 CATAATAATGGGATGGTGGAAGG - Intronic
1124954523 15:34351406-34351428 GAAAAAAAGGGACGGGAGGAGGG + Intronic
1125745782 15:41996370-41996392 AAAAAAAAAAGGAGGGAGGAAGG + Intronic
1126151022 15:45523568-45523590 TAAAATATTGGGAGAGAGGAAGG + Intergenic
1126282339 15:46968802-46968824 CAAAATAATGGGATGGAGAAAGG + Intergenic
1126469213 15:48989287-48989309 CTAAATAAGCTGGGGGAGGAGGG - Exonic
1126526143 15:49656796-49656818 AAAAAAGAAGGGAGGGAGGAAGG + Intergenic
1126688508 15:51268516-51268538 AAAAAAAAGGGGGGGGGGGAAGG - Intronic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1127357351 15:58213219-58213241 CAAAATGAGGGGAGAGGGGTGGG - Intronic
1127534256 15:59875132-59875154 CAAAAAAAGGAAAGGAAGGAAGG - Intergenic
1127815065 15:62600775-62600797 CAAAATAATGGGTGGGAAGAGGG - Intronic
1127818213 15:62631618-62631640 AGAAAGAAAGGGAGGGAGGAGGG - Intronic
1127940338 15:63688873-63688895 CAAAAAAAGGGGCTGGGGGAAGG + Intronic
1128134283 15:65251179-65251201 CAAAATAAGAGATGGGAGGCAGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1128903503 15:71447096-71447118 CAAAAAAAATGGAGGGAAGAGGG - Intronic
1128942392 15:71799434-71799456 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1129171340 15:73810014-73810036 CAGACTCAGGAGAGGGAGGAAGG + Intergenic
1129431062 15:75502459-75502481 AAAAAGAGAGGGAGGGAGGAAGG + Intronic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129480608 15:75822365-75822387 AAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1129538072 15:76330312-76330334 CAAAGAAAGGGAAGGAAGGAGGG - Intergenic
1129538305 15:76332065-76332087 AAAAAAAAAGGGAGGGGGGAGGG - Intergenic
1129880962 15:79005754-79005776 AAAAATAAAGGGAGAGAGGAAGG - Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130127372 15:81105164-81105186 AAAAAGGAAGGGAGGGAGGAAGG - Intronic
1130626797 15:85523801-85523823 CAAAAAAAGGGGGGCGGGGAGGG - Intronic
1130635444 15:85615004-85615026 TGAAATAAAAGGAGGGAGGAAGG - Intronic
1131334459 15:91534407-91534429 CATAAAAAGGAGAGGGAGAATGG + Intergenic
1131753821 15:95538921-95538943 CAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1131878532 15:96837560-96837582 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
1131949579 15:97666575-97666597 CAAATCAGGGGGAGAGAGGATGG - Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132304068 15:100796846-100796868 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1132433396 15:101778255-101778277 CAAATTAAGGTGATGGAGGGTGG + Intergenic
1132737128 16:1392427-1392449 CAAAAAAAGAGGGGGGAAGAGGG - Intronic
1133160386 16:3907995-3908017 AAAAAAAAGGGGGGGGGGGAGGG - Intergenic
1133702154 16:8318743-8318765 CAGAATAGAGGGTGGGAGGAGGG - Intergenic
1133904371 16:10008209-10008231 CCAAATAAGGGGATTGGGGAAGG - Intronic
1134188878 16:12106048-12106070 CTAAGTAACGCGAGGGAGGAGGG + Intronic
1134811626 16:17172195-17172217 GAAAAAAAAGGGAGAGAGGAGGG - Intronic
1135939558 16:26809613-26809635 AAAGAGAGGGGGAGGGAGGAAGG + Intergenic
1136006848 16:27336689-27336711 AAAAAAAAGGAAAGGGAGGAAGG + Intronic
1136021177 16:27441078-27441100 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
1136138824 16:28275884-28275906 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
1136154058 16:28370967-28370989 CAAAACAAAGGGAGAGAGAATGG - Intergenic
1136209034 16:28744297-28744319 CAAAACAAAGGGAGAGAGAATGG + Intergenic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136770939 16:32840540-32840562 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1136852202 16:33621102-33621124 AAAAAAAAGGGCAGGGGGGAAGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137465300 16:48702925-48702947 CAAAAGGAAGGGAGGAAGGAAGG - Intergenic
1137846836 16:51698102-51698124 CCAAGTGAAGGGAGGGAGGAGGG + Intergenic
1137862603 16:51861656-51861678 AAAAAAAAAGGGAGGGGGGAGGG - Intergenic
1138396103 16:56705825-56705847 CAAGGTTGGGGGAGGGAGGAAGG - Intronic
1138480691 16:57301226-57301248 CGAAATGAGGGGATGCAGGAAGG - Intergenic
1138835283 16:60427434-60427456 GAAAAGAAGGGAAGGAAGGAGGG - Intergenic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1139044633 16:63041856-63041878 CTAAATGGGGGGAGGGGGGAGGG - Intergenic
1139462123 16:67130697-67130719 CAAAATATGAGATGGGAGGAAGG + Intronic
1140133586 16:72185342-72185364 GTAAAGAAGGGCAGGGAGGAGGG - Intergenic
1140339315 16:74141441-74141463 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1140944625 16:79756464-79756486 CAAAAGAAATGAAGGGAGGAAGG + Intergenic
1140967661 16:79982972-79982994 AGAAAGAAGGGGAGGAAGGAAGG - Intergenic
1203073362 16_KI270728v1_random:1102653-1102675 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1203113798 16_KI270728v1_random:1469573-1469595 AAAAAAAAGGGTAGGGGGGACGG - Intergenic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1142722679 17:1787264-1787286 CAAAAACAAGGAAGGGAGGATGG - Intronic
1143111012 17:4552823-4552845 AAAAATAAGGGGTGGGGGGCAGG - Intronic
1143179495 17:4975157-4975179 GACAAGAAGGGGAGGCAGGAGGG + Intronic
1143224522 17:5289147-5289169 AAGAAGAAAGGGAGGGAGGAAGG - Intronic
1143261925 17:5605920-5605942 GAAGATAAGGGGATGGAGAAAGG + Intronic
1143267682 17:5652718-5652740 CAGTATATGGGGAGGGAGGAAGG + Intergenic
1143297682 17:5883493-5883515 CAAAAAAAGGGAAGGGAAGGCGG - Intronic
1143674535 17:8422298-8422320 CAAAAAAAGGTGGGGGTGGAGGG - Intronic
1143738977 17:8938534-8938556 GAGGATAAGGGGAGGGAGAATGG - Intronic
1143869787 17:9949858-9949880 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
1143976390 17:10833038-10833060 CAAGAAAAGGGAAGGGAAGAGGG + Intronic
1144374800 17:14628281-14628303 CATAAGAAGGGAAGGAAGGATGG + Intergenic
1144444745 17:15316461-15316483 TCAAAGGAGGGGAGGGAGGAGGG + Intronic
1144445338 17:15322067-15322089 TCAAAGGAGGGGAGGGAGGAGGG + Intronic
1144572015 17:16406286-16406308 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1144718625 17:17452032-17452054 CAAAACAAGTAAAGGGAGGAAGG + Intergenic
1144877700 17:18411054-18411076 AAAAGGATGGGGAGGGAGGAGGG - Intergenic
1145154529 17:20533349-20533371 AAAAGGATGGGGAGGGAGGAGGG + Intergenic
1145238541 17:21225997-21226019 GAAGAAAAGGGGAGGGAAGAGGG - Intergenic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1145868849 17:28257358-28257380 GGAAAGAAGGGAAGGGAGGAAGG + Intergenic
1145978553 17:28998116-28998138 GAAGCTATGGGGAGGGAGGAGGG + Intronic
1146138366 17:30343110-30343132 CAAACTTAGGGGAAGGAAGAGGG - Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146296113 17:31652073-31652095 CAAAAAGAGAGGAGGAAGGAAGG + Intergenic
1146321765 17:31852329-31852351 CAGATTAAGGGAAGGAAGGAGGG + Intronic
1146478209 17:33180320-33180342 CACAATGAGGGGAAGGAGCATGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1146671488 17:34741017-34741039 CAAAATGTGGTGAGGGAGGGGGG + Intergenic
1147129700 17:38399870-38399892 CCAAAGAAGGGGTGGGAGGAGGG + Exonic
1147198292 17:38782310-38782332 TGAAATGAGGGCAGGGAGGATGG - Intronic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147788067 17:42994557-42994579 CAAAGTGAGGGGAGGAATGAGGG - Intergenic
1148262695 17:46197123-46197145 AAAAAGAAAGGAAGGGAGGAAGG + Intronic
1148264155 17:46211238-46211260 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1148268214 17:46243472-46243494 GAAAAGAAAAGGAGGGAGGAAGG + Intergenic
1148346748 17:46908415-46908437 GAAAATAGGGTAAGGGAGGAAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148721220 17:49754648-49754670 GAGAAGAAGGGGAGGGAAGAGGG + Intronic
1149027875 17:52050983-52051005 AAAAAAAAGGGAAGGAAGGAAGG + Intronic
1149108625 17:52998392-52998414 GAAAATAAGGGAAGGGAACAAGG + Intergenic
1149295409 17:55257603-55257625 CACAATAAAGGGAGGGAAGTTGG + Intergenic
1149328022 17:55552718-55552740 GAAAAAAAGGGGAGGGGAGAAGG - Intergenic
1149687839 17:58548089-58548111 CAAAAGAAGAGTAAGGAGGAGGG - Intergenic
1150041737 17:61869846-61869868 CCAAATAAGGGAATGGAGGAAGG - Exonic
1150082687 17:62254318-62254340 AAAAAAAAGGGGTGGGGGGAGGG + Intergenic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150618554 17:66791139-66791161 CAAACAAAAGGGAGGGGGGAGGG - Intronic
1150692928 17:67380044-67380066 CAAAAAAAAGGAAGGAAGGAAGG - Intronic
1150786259 17:68165371-68165393 GAAGGGAAGGGGAGGGAGGAGGG + Intergenic
1150860035 17:68791760-68791782 CTAAAAGTGGGGAGGGAGGAAGG + Intergenic
1150931810 17:69592954-69592976 AAAAATGGAGGGAGGGAGGAAGG - Intergenic
1151050999 17:70978550-70978572 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151051009 17:70978576-70978598 GAAAAGAAGGGGAGGGAGGGAGG + Intergenic
1151084438 17:71364457-71364479 CACAGTAAGGAGAGGGAGGAGGG - Intergenic
1151133718 17:71924835-71924857 AGAAAGAAAGGGAGGGAGGAAGG + Intergenic
1151635079 17:75341583-75341605 GAAAAAAAAGGGAAGGAGGAAGG + Intronic
1151792856 17:76320298-76320320 GAAAAGAAAGGAAGGGAGGAAGG + Intronic
1151867802 17:76815954-76815976 CAAAAAAAAAGAAGGGAGGAAGG + Intergenic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1152513392 17:80805429-80805451 TAAAATAAGGGGAAGCAGGACGG - Intronic
1152598467 17:81249548-81249570 AAAAAGAGGGGGAGGGGGGAAGG + Intronic
1153060053 18:985840-985862 TAAAGTAGGGGGAGGGAGGGAGG - Intergenic
1153175048 18:2362323-2362345 AAAGAAAAAGGGAGGGAGGAAGG - Intergenic
1153432621 18:5035204-5035226 TAAAAGAAGAGGAGGGAGGGAGG + Intergenic
1153441484 18:5124273-5124295 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1153442952 18:5141137-5141159 GAAAATAGGGGAAGGAAGGAAGG - Intergenic
1153901277 18:9619039-9619061 AGAAAGAAGGGGAGGGAGGGAGG + Intergenic
1154095769 18:11413720-11413742 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1154242868 18:12668293-12668315 CAAAAAAAGTGGATGGAGGCTGG + Intronic
1154309055 18:13253619-13253641 CAAATGAAGTGGGGGGAGGAAGG + Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1154515845 18:15164652-15164674 AAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1155040995 18:22065669-22065691 GAAAGAAAAGGGAGGGAGGAAGG - Intergenic
1155261529 18:24047602-24047624 AGAAATAAAGGGAGGGAGGAAGG - Intronic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155334254 18:24748745-24748767 AAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1155370663 18:25097023-25097045 CAAAGTAAAGGGTGGGAGGTTGG - Intronic
1155398940 18:25417104-25417126 AAAAATAAGGGCAGTGGGGAGGG + Intergenic
1156282498 18:35653781-35653803 CATAATAAAGGGAGGTAGTAGGG + Intronic
1156290874 18:35747837-35747859 ATAAATGAGGGGAGGGAGCAGGG + Intergenic
1156509180 18:37621162-37621184 CAAAAAGAGGGCAGGAAGGAAGG - Intergenic
1156749357 18:40431758-40431780 CTAACTAAGGGGAGGGATTAGGG + Intergenic
1156752372 18:40474642-40474664 AAAAATAAGGGGAGGTGAGAGGG - Intergenic
1156785111 18:40902588-40902610 CAAAATAAGATGAGTCAGGATGG - Intergenic
1156822647 18:41391488-41391510 CAAAATAACTGCAGGGAGAAAGG - Intergenic
1157192002 18:45589519-45589541 TAAAAAAAGGGGAGTGGGGAGGG - Intronic
1157298991 18:46466279-46466301 CTAAATCAGGGGAGGAAAGAAGG + Intergenic
1157689368 18:49668626-49668648 AAAAAAAAAGGGAGAGAGGATGG - Intergenic
1157713264 18:49864444-49864466 CAAAAGAAGGGGAGGAGGGGAGG - Intronic
1157865036 18:51175431-51175453 GTAATTTAGGGGAGGGAGGAGGG - Exonic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1158279294 18:55803529-55803551 AAAAAGAAAGGGAGGGAGGGAGG - Intergenic
1158334915 18:56405660-56405682 CAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1158560096 18:58506211-58506233 CCAAAAGAGGGGAGGGAGGGAGG + Intronic
1158886135 18:61829210-61829232 CACTGTAAGGGGAGGCAGGAAGG + Intronic
1158918189 18:62158414-62158436 AAAACTAAGGGGAGGGAAAATGG + Intronic
1159218086 18:65423233-65423255 CAAAAGTAGGGAAGGAAGGAGGG - Intergenic
1159310795 18:66706273-66706295 CATAATAAAAGGAGGAAGGAAGG + Intergenic
1159313127 18:66736245-66736267 AAAAATAACGGAAGGAAGGAAGG - Intergenic
1159331048 18:66994379-66994401 CAAAATGGGGGTGGGGAGGAGGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159576320 18:70182482-70182504 CAGCAAAAGGGAAGGGAGGAAGG + Intronic
1159964136 18:74579384-74579406 AGAAAGAAGGGAAGGGAGGAAGG - Intronic
1160106769 18:75985101-75985123 CAAACTCAGGGCATGGAGGAGGG + Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160615203 18:80121151-80121173 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1160965250 19:1744574-1744596 GAAAGGAGGGGGAGGGAGGAGGG - Intergenic
1161207101 19:3047010-3047032 AAAACTGAGGGGAGGGAGGAGGG - Intronic
1161509558 19:4662976-4662998 TAAAATGAGGACAGGGAGGAGGG - Intronic
1161754109 19:6119263-6119285 GAAAGGAAGGGAAGGGAGGAAGG - Intronic
1162097602 19:8320266-8320288 CAAAATAAGTGGAAGCTGGAGGG - Intronic
1162317947 19:9952324-9952346 AAAAAGGAGGGGAAGGAGGAAGG + Intergenic
1162696645 19:12481917-12481939 AAAAAAAAGGGAAGGAAGGAAGG + Intronic
1162957810 19:14109050-14109072 TAAAATATGGGGAGAGAGGCTGG + Intronic
1163345115 19:16736228-16736250 CAAAAGAAAGAGAGAGAGGAAGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1163914339 19:20227051-20227073 GAAAATAAAGGGACGGAGGAAGG - Intergenic
1164522211 19:28988316-28988338 GGAAGGAAGGGGAGGGAGGAAGG + Intergenic
1164793160 19:31004876-31004898 CAAAAAAAAGGAAGGAAGGAGGG - Intergenic
1165494249 19:36142412-36142434 CACAAGAAGGGGAGGAAGGTGGG - Intronic
1166222076 19:41371871-41371893 CAAAAAAAGGGGGGTCAGGAAGG - Intronic
1166359786 19:42248330-42248352 CAAAATGTGGGGAGGGAAAAGGG + Exonic
1166616750 19:44255831-44255853 CACAATAAGAGGAGAGAGAAAGG + Intronic
1166668447 19:44695576-44695598 CAAGATAAGGGGAGGTTGAAAGG + Intergenic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1167381376 19:49140132-49140154 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1202670541 1_KI270709v1_random:46058-46080 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925238829 2:2303719-2303741 CAAACCAAGGGCCGGGAGGAGGG + Intronic
925448330 2:3947224-3947246 CAAAATACAGGGAGGAGGGAGGG - Intergenic
925466473 2:4110924-4110946 AAGAAGAAAGGGAGGGAGGAAGG - Intergenic
925600000 2:5598555-5598577 CTAAATAAGGAGAGAGAGGTGGG + Intergenic
925806175 2:7650936-7650958 CAAAAGGAAGGAAGGGAGGAAGG - Intergenic
925923181 2:8651722-8651744 CAAAAAGAGGAGAGGGAGGGAGG + Intergenic
926000785 2:9330766-9330788 CAAAATAAAGGGGCGGGGGAAGG - Intronic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926777357 2:16435704-16435726 CAGAGTTAGGGGAGGGAGAATGG - Intergenic
927789353 2:25998369-25998391 AAAAATAAGGGAGGGAAGGAAGG - Intergenic
927889464 2:26739240-26739262 GACAAAGAGGGGAGGGAGGACGG + Intergenic
927924845 2:27004405-27004427 GAAAATGAGGGGGAGGAGGAAGG - Intronic
928164803 2:28962836-28962858 GAAAAGGAAGGGAGGGAGGATGG - Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928491443 2:31788138-31788160 CAAAGTAGAGGGAGGAAGGAAGG + Intergenic
928935889 2:36677557-36677579 CAAAATTAGGGGAAGAGGGAGGG + Intergenic
928984375 2:37166588-37166610 AAAAAAAAAGGGAGGAAGGAAGG - Intergenic
929091101 2:38218099-38218121 AAAAATAAAGGAAGGAAGGAAGG - Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929521529 2:42656758-42656780 TAAGAAAAGGGGAGGAAGGAAGG - Intronic
929536230 2:42786083-42786105 CACAGTGAGGGAAGGGAGGAGGG + Intronic
929720581 2:44363372-44363394 CAAAAAAAAAGGAGGGGGGAAGG - Intronic
929878523 2:45816797-45816819 ACAATTAGGGGGAGGGAGGATGG - Intronic
930045238 2:47165029-47165051 CAAAATTTGGGGAGGGATAAGGG - Intronic
930352668 2:50277456-50277478 AAAAAGAAGGGAAGGAAGGAAGG - Intronic
930589336 2:53308746-53308768 CAAGAAAAGGGGATGGAGGTGGG - Intergenic
930695400 2:54406634-54406656 AAAAATTAGGGAAGGAAGGAAGG + Intergenic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
931380711 2:61750692-61750714 CAATAGCAGGGGAGGGAGCAAGG + Intergenic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931650223 2:64461788-64461810 AAAACTATGGGGAGGGAGAATGG - Intergenic
931760694 2:65414261-65414283 CCAAATAGGGGAAAGGAGGAAGG + Intronic
931919430 2:66997014-66997036 CAAAAATAGGGGAGGGAGTGAGG - Intergenic
932238041 2:70136759-70136781 AAAAACAAGGGGTGGGAGGCAGG - Intergenic
932531733 2:72541366-72541388 GGAAATAAGGGGAGGAAGAAAGG - Intronic
932589991 2:73059468-73059490 CTAAATAAGGGGAGGGAATGTGG - Intronic
933769584 2:85734501-85734523 AAAAAAAAGGAGTGGGAGGAAGG + Intergenic
934165438 2:89290046-89290068 CATAAGAAAGGGAGGGAAGAAGG - Intergenic
934201835 2:89892416-89892438 CATAAGAAAGGGAGGGAAGAAGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
934880437 2:97972428-97972450 GAAAGAAAGGGGAGGGAGGGAGG + Intronic
934998875 2:98991338-98991360 CAAAATAAAGGGATGGAGGAAGG + Intergenic
934999870 2:99002769-99002791 CAAAATAAAGGGATGGAGGAAGG + Intronic
935311483 2:101788142-101788164 CAATATAAGGGGAGGGAATGGGG - Intronic
935443532 2:103131967-103131989 AAAAAGAAAGGAAGGGAGGAAGG + Intergenic
935746892 2:106196482-106196504 GACAGTAAGGGGAGGGAGCAGGG - Intergenic
936471096 2:112799305-112799327 CAAACTGATGGGAGGGAGGGTGG + Intergenic
936478431 2:112862884-112862906 GAAAATAGGGGGAGGAAGGGAGG - Intergenic
936611758 2:114008537-114008559 CAGAATCAGGGAAGGGAAGAAGG + Intergenic
936704799 2:115059099-115059121 CCAAACGAAGGGAGGGAGGAAGG + Intronic
936775124 2:115963873-115963895 CAAAATAAAGGGATGGAGGAAGG - Intergenic
936912754 2:117609844-117609866 AAAGAAAAAGGGAGGGAGGAAGG + Intergenic
936971535 2:118181067-118181089 TGAAATAAGGTCAGGGAGGAAGG + Intergenic
936997744 2:118433115-118433137 AAAAATAAAGGAAGGAAGGAAGG + Intergenic
936999074 2:118446706-118446728 CAAAAGGAAGGGAGGGAGGGAGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937394322 2:121521218-121521240 CAAAATAATGGGGTGGAGGAGGG + Intronic
938120347 2:128628601-128628623 CCGAAGAAAGGGAGGGAGGAAGG - Intergenic
938483050 2:131677811-131677833 AAAGATCAGAGGAGGGAGGAGGG - Intergenic
938516081 2:132009279-132009301 GGAAAAAAAGGGAGGGAGGAGGG - Intergenic
938569228 2:132546886-132546908 CAAATGAAGGGGAGGGAAGGAGG + Intronic
938758183 2:134399824-134399846 CAAAGTAAGGGAAGGGAAGGGGG + Intronic
939258877 2:139781270-139781292 CAAAAGGAAGGGAGGAAGGAAGG - Intergenic
939756493 2:146118928-146118950 AAAAATGAAGGGAGGGAGGAAGG + Intergenic
939904641 2:147896953-147896975 AAAAAAAAGGGGCGGGGGGAGGG - Intronic
939915643 2:148040028-148040050 AAAAATTAAGGGCGGGAGGAGGG + Intronic
939946139 2:148413496-148413518 AAAAAAAAGGTGGGGGAGGAGGG - Intronic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940705570 2:157101131-157101153 CAAAATAAAGGGATTGAGGAAGG - Intergenic
941423717 2:165317349-165317371 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
941753962 2:169164637-169164659 CATAATTATGGGATGGAGGAGGG + Intronic
942041531 2:172068877-172068899 AAAAAGAAAGGAAGGGAGGAAGG - Intronic
942313322 2:174676299-174676321 AAAAAAGAAGGGAGGGAGGAAGG - Intronic
942340011 2:174933977-174933999 GAAAATTAGGAGAGGGAGTAAGG + Intronic
942411962 2:175718849-175718871 CAAAATAAAGGGATGGAGGAAGG + Intergenic
942807289 2:179946457-179946479 AAAAAAAAGGGGGGGGGGGAAGG + Intronic
943663000 2:190578780-190578802 AAAAAAAAGCGGAGGGAGGGAGG + Intergenic
943831812 2:192472962-192472984 TAAGGTAAGGGGAGGGAAGAGGG + Intergenic
944143917 2:196485669-196485691 CATAACAAGGGGACCGAGGAAGG + Intronic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
945028952 2:205645797-205645819 GAAAAGAAGGGGAGGAAGGGAGG + Intergenic
945111678 2:206366221-206366243 AAAAAGAAAGGGAGGAAGGAAGG - Intergenic
945155912 2:206837368-206837390 AAAAAGGAGGGGAGGAAGGAAGG - Intergenic
945590810 2:211728194-211728216 CAAAATACAGGAAGGAAGGAAGG - Intronic
946214307 2:218172070-218172092 CTAAAAGAGGGAAGGGAGGAAGG + Intergenic
946312039 2:218887443-218887465 GAACCTAAGGGGAAGGAGGATGG - Intronic
946426644 2:219601959-219601981 CAAGGAAAGAGGAGGGAGGAAGG - Intronic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946586081 2:221189412-221189434 AATAAAAAGAGGAGGGAGGAGGG - Intergenic
947038901 2:225892489-225892511 CAAAATAGAAGAAGGGAGGAGGG + Intergenic
947148016 2:227086376-227086398 GAAAAGAAGGGAAAGGAGGAAGG - Intronic
947491461 2:230598753-230598775 TAAAGAGAGGGGAGGGAGGAGGG + Intergenic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947909164 2:233790407-233790429 GAAGAAAAGGGGAGGAAGGAAGG - Intronic
948028567 2:234798447-234798469 CAAAAAAGAGGAAGGGAGGAGGG - Intergenic
948258135 2:236583470-236583492 GAAAATAAGAGTAGGTAGGATGG + Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948385925 2:237580748-237580770 AAAAAGAAGGGGGGGGAGGAGGG + Intronic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
1168868705 20:1110570-1110592 AAAGAGAAGGGGAGGGAGCAAGG - Intergenic
1168912683 20:1462355-1462377 CAAGAAAAAGGGAGGGAGGAGGG - Intronic
1168925080 20:1572522-1572544 CAAAACAGGAGGACGGAGGACGG + Intronic
1168928957 20:1605550-1605572 CAAAACAGGAGGACGGAGGACGG + Intronic
1169062957 20:2674842-2674864 CAAAAAAGGGGGATGGGGGAGGG - Intergenic
1169447245 20:5682702-5682724 CAAAAAAAGGGAAGGAAGGAAGG - Intergenic
1169525955 20:6426095-6426117 AAAAAAGAGGGGAGAGAGGAAGG - Intergenic
1169787182 20:9371487-9371509 CAAAAGGAAGGAAGGGAGGAAGG - Intronic
1169844791 20:9977798-9977820 AAAAACAAGGGAAGGGAAGATGG - Intergenic
1169947315 20:11003120-11003142 CAAAAACAGGGGAGGGGAGAAGG - Intergenic
1170433625 20:16300548-16300570 AAAAATAAGAGGTTGGAGGAAGG + Intronic
1170552025 20:17486416-17486438 CAAGAGAAAGGGTGGGAGGATGG + Intergenic
1171096373 20:22336057-22336079 AAAAATGAAAGGAGGGAGGAAGG - Intergenic
1171514995 20:25723070-25723092 CTAAATTAGGGGAGGAAGGATGG + Intergenic
1171904160 20:30886743-30886765 CAAAATAAAGTGATGGAGGAAGG - Intergenic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1172799789 20:37567783-37567805 TAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1172987018 20:38999831-38999853 CAAGACAAGGGCAGTGAGGATGG - Intronic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173520786 20:43698834-43698856 AAAAAAAAAGGGAGGGGGGAGGG - Intronic
1173615422 20:44400328-44400350 CGAAACAGGGAGAGGGAGGAGGG + Intronic
1173666474 20:44766771-44766793 CATAATAAGGGGTGGGGGGATGG - Intronic
1173671718 20:44803669-44803691 GGAAAAAAGGGGAGGGGGGATGG + Intronic
1173690447 20:44956887-44956909 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1173690998 20:44960752-44960774 TTAAATAAGGGGATGAAGGAAGG + Intergenic
1174185717 20:48704552-48704574 AAAAAGAGAGGGAGGGAGGAAGG - Intronic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174329797 20:49808926-49808948 AAAAAAAAGGGGGGGGTGGAGGG + Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174777774 20:53361575-53361597 CAAAAGAAAGGGTGGAAGGAAGG - Intronic
1174872852 20:54199589-54199611 CAAAACAAGGTCAGGGAGGGAGG + Intergenic
1175028812 20:55931638-55931660 CTAGATAGGGGGAGGGAGGGAGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175649048 20:60701132-60701154 CAATAAAAAGGGAGGGTGGATGG - Intergenic
1175831560 20:61967597-61967619 TAAAAAAAGGGGAGGAAGGAAGG - Intronic
1175849756 20:62083512-62083534 AAAAAGAAGGGGAGAGAGGGAGG - Intergenic
1176349769 21:5783425-5783447 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176356583 21:5904009-5904031 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176544090 21:8181495-8181517 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176550793 21:8220222-8220244 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176563041 21:8364540-8364562 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1176569591 21:8402489-8402511 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176777829 21:13155280-13155302 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1177670175 21:24214575-24214597 CAAAAGAAAGGGAGGGAGGAAGG + Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1178016121 21:28347585-28347607 GAAGAAAAAGGGAGGGAGGAAGG - Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178362171 21:31957820-31957842 AAAAATCAGGGCAGGAAGGAAGG + Intronic
1178399169 21:32268986-32269008 ACAAATAAGGGGAGGAAGGGCGG + Exonic
1178531817 21:33382268-33382290 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1178534783 21:33402966-33402988 AAAAAAAAGGGGAGGGGGGCGGG + Exonic
1178663179 21:34523483-34523505 CAAAAGGGAGGGAGGGAGGAGGG + Intronic
1178693818 21:34775478-34775500 CAAAAAGAGGCCAGGGAGGAGGG + Intergenic
1178808589 21:35860173-35860195 GAAAAGAGAGGGAGGGAGGAAGG + Intronic
1179080336 21:38164963-38164985 CCAAACATGGGGAGGGAGGGAGG + Intronic
1179160794 21:38895902-38895924 CAAAATAATGGGAGAGGGGGTGG + Intergenic
1179481997 21:41684444-41684466 TGATATGAGGGGAGGGAGGAGGG + Intergenic
1180466528 22:15616232-15616254 AGAAATAAGAGGAGGGGGGAAGG + Intergenic
1180564003 22:16647760-16647782 CACAAAAAGGGCAGGCAGGAAGG - Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181528391 22:23502607-23502629 CAAATGGAGGGGTGGGAGGATGG - Intergenic
1181742070 22:24929143-24929165 CAAAAGAAGGGGAGAGAGAAGGG - Intergenic
1181779702 22:25183848-25183870 GAAAATGAGGGAAGGAAGGAAGG - Intronic
1181828386 22:25538441-25538463 CAAAAAGTGGGGAGGGAGGTAGG + Intergenic
1182344354 22:29650566-29650588 AAAAGGAAGGGGAGGGAGGAAGG - Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182680708 22:32077321-32077343 GAAAAAAGGGGGAGAGAGGAAGG - Intronic
1182741718 22:32572499-32572521 AAAGAGAAAGGGAGGGAGGAAGG - Intronic
1182787390 22:32919108-32919130 CCAAATGAGGGGAAGGAGAAAGG - Intronic
1183636280 22:39064939-39064961 CAAAGTAAGGGGAGGGGGTTTGG + Intronic
1183650725 22:39152084-39152106 CAATAAAAGGGGAGCGAGGTGGG + Intronic
1183924164 22:41193847-41193869 CTCAAAAAAGGGAGGGAGGAAGG + Intergenic
1184027829 22:41871058-41871080 GAATAAAGGGGGAGGGAGGAGGG - Intronic
1184197059 22:42936910-42936932 CAAAAAAAGGGGGGGGGGCAGGG + Intronic
1184469870 22:44690345-44690367 CAAGGCAGGGGGAGGGAGGAGGG + Intronic
1184497739 22:44852209-44852231 AAAAAAAAAGGAAGGGAGGAAGG + Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184630523 22:45774634-45774656 CAAAATAAAGGCAGGGGGGCTGG + Intronic
1184770504 22:46594308-46594330 AAAAACAGGGGCAGGGAGGAGGG - Intronic
1185148000 22:49149741-49149763 GAGAAGCAGGGGAGGGAGGAAGG + Intergenic
1203248958 22_KI270733v1_random:97730-97752 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
949111104 3:261356-261378 AAAAATAAAGGAAGGAAGGAGGG + Intronic
949190840 3:1246818-1246840 GAAACCAAGGGGAGGGAGGGAGG - Intronic
949263305 3:2127388-2127410 CAAATTAAGTGGAGGGAGGGAGG + Intronic
949508053 3:4745011-4745033 GAAAAGAAAGGGAAGGAGGAAGG - Intronic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950008867 3:9708292-9708314 CCAAAGGAGGGGAGGAAGGACGG + Intronic
950023944 3:9808190-9808212 AAAAAAAGGGGGGGGGAGGAGGG - Intronic
950404110 3:12793984-12794006 CAAAAAAAAGGAGGGGAGGAAGG - Intergenic
950791656 3:15477068-15477090 CAAAACAAGAGGGGGGAAGATGG - Intronic
951086502 3:18518228-18518250 CAAAATAAAGGGATGGAGGAAGG + Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951479854 3:23148591-23148613 GAAAAGGAAGGGAGGGAGGAAGG + Intergenic
951508423 3:23475199-23475221 CAAAAGGAGGGGAGTTAGGAGGG - Intronic
951532517 3:23711059-23711081 CAAAATAAGTGGGGGAAGAAAGG + Intergenic
951597205 3:24331287-24331309 AAAAAGAAGGGGAGAGAGCAGGG + Intronic
951761757 3:26155544-26155566 GAAAGTAAGGGAAGCGAGGAGGG - Intergenic
951927830 3:27928092-27928114 CACAAAAAGTGGTGGGAGGAAGG + Intergenic
952230526 3:31424905-31424927 AAAGAGAAAGGGAGGGAGGAAGG + Intergenic
952433269 3:33246883-33246905 AAAAATGAAGGGAGGAAGGAAGG - Intergenic
952433276 3:33246923-33246945 GAAAAGAGAGGGAGGGAGGAAGG - Intergenic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952504152 3:33992507-33992529 CAAACTGAGGGAAGGGAGCAGGG - Intergenic
952669699 3:35951769-35951791 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
952755699 3:36864631-36864653 CAGAATCAGGGGAGGGTGGAGGG - Intronic
952783437 3:37127323-37127345 AAAAAAAAGGGGAGAGAGAAGGG + Intronic
952946865 3:38483834-38483856 TAAAAGGAGGGGAGGGAGGGAGG - Exonic
953246865 3:41200450-41200472 TGAAATAAGGGGGTGGAGGAAGG + Intronic
953413242 3:42701806-42701828 CAAATTAAAGGGAGGAAGCAGGG + Intronic
953748018 3:45590112-45590134 CAAGATACGGGGAGGCAGGAGGG + Intronic
953802807 3:46040137-46040159 CAAAATAAAGGAAGGGAGACAGG + Intergenic
954005317 3:47585968-47585990 AAAAATGAGGGGAGGGAGTTTGG - Exonic
954272743 3:49522461-49522483 AAAAAAAAGGGGTGGGAGGGGGG - Intronic
954748122 3:52798512-52798534 CAAGAGGAGGGGAGGGAGAAAGG - Intronic
955205823 3:56895087-56895109 CAAATTACAGGGAGGGAGGGAGG - Intronic
955395723 3:58555842-58555864 AAAAATAAGGGCTGGGAGAAGGG + Intergenic
955427024 3:58802011-58802033 AAAATTAGGGGGAGGGAGGAAGG - Intronic
955498022 3:59556512-59556534 TAAAAATAGGAGAGGGAGGAGGG + Intergenic
955617653 3:60825910-60825932 CAAAGAAAGTGGAGGGTGGAGGG + Intronic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
955984286 3:64556840-64556862 CAAAATAATGGATGGGTGGAAGG - Intronic
956618637 3:71198409-71198431 CAAGATGGGGGGAGGGAGGGGGG + Intronic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
956715972 3:72080409-72080431 GAAGAGATGGGGAGGGAGGAAGG - Intergenic
957047374 3:75386347-75386369 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
957157415 3:76562911-76562933 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
957297441 3:78351178-78351200 CAAAAGAAAGGAAGGAAGGAAGG - Intergenic
957520405 3:81311602-81311624 AAAGAAAAAGGGAGGGAGGAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957580942 3:82072373-82072395 AGAAATAAGGAGAGGGAGAAAGG + Intergenic
958164059 3:89856452-89856474 CAAAATAATCCGAGGGAGGAAGG + Intergenic
958253155 3:91293403-91293425 CAAAATAAAGGGATGGAGGAAGG + Intergenic
958431215 3:94043645-94043667 GAAAGAAAGGGGAGGGGGGAGGG - Intronic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
959456099 3:106563690-106563712 CAAAAAAAAGGAAGGCAGGAAGG + Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960566020 3:119132335-119132357 CAAAATAAAGGGATGGAGGAAGG + Intronic
960573276 3:119206023-119206045 AAAAAAAAGGGGGGGGGGGAGGG - Intergenic
961044967 3:123701824-123701846 CAATAAAAGGGGAAGGAGAAAGG + Intronic
961213530 3:125142907-125142929 CAGAGTCAGGGAAGGGAGGAGGG - Intronic
961476249 3:127147945-127147967 AAATAAAGGGGGAGGGAGGAGGG + Intergenic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962357038 3:134703627-134703649 AAAGATCAGGGGTGGGAGGAGGG + Intronic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962567265 3:136674108-136674130 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
962759602 3:138497682-138497704 GAAAAAAAAAGGAGGGAGGAAGG + Intronic
962764475 3:138549013-138549035 CAAAATAAAGGGGTAGAGGAAGG + Intronic
962927941 3:140012276-140012298 GAAAGAAAGGGGAGGGAGCAGGG + Intronic
963053974 3:141168688-141168710 CAAAATTCGGGGAGGTGGGAAGG - Intergenic
963089357 3:141467856-141467878 CCAAAAAGGGGAAGGGAGGAAGG - Intergenic
963400903 3:144797877-144797899 TAAAATAATGGAAGGAAGGAAGG - Intergenic
963414304 3:144975129-144975151 GAAAAGAAGGGGAAGGAGAAGGG - Intergenic
963423753 3:145096430-145096452 GAAAAGAATGGGAGGGAGGGAGG - Intergenic
963429451 3:145179774-145179796 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964079825 3:152740837-152740859 CAAAGTAAGGGGACTGGGGAAGG + Intergenic
964101786 3:152996134-152996156 CAAAAGAAAGGAAGGAAGGAAGG + Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
964229209 3:154443376-154443398 CAAAAAACGAGGTGGGAGGATGG - Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964651327 3:159014924-159014946 TACAATAAGGTTAGGGAGGAAGG - Intronic
964701503 3:159572970-159572992 CAAAATAAAAGGATGGAGGAAGG - Intronic
964763176 3:160153472-160153494 CCAGATAAGGGGAGAGAGAAAGG - Intergenic
964873042 3:161334407-161334429 CTAAAGAAGGGAAGGAAGGAGGG - Intergenic
965465579 3:169026561-169026583 CAAAAAAAAGGGAGGGGGGAGGG - Intergenic
965502741 3:169475743-169475765 AAAAAAAAGGGGGAGGAGGAGGG + Intronic
966364488 3:179169243-179169265 AAAAATTAGGGGAGGGGAGAAGG - Intronic
966494678 3:180566548-180566570 TAAAATGAGGGGAGGGAGCCAGG - Intergenic
966789984 3:183658795-183658817 AAAAAAAATGGGAGGAAGGAAGG - Intronic
966836104 3:184050641-184050663 CAAAAAAAAGGAAGGTAGGAAGG - Intergenic
966921934 3:184617991-184618013 CCAAATAAGAGGAAAGAGGAAGG - Intronic
966945776 3:184776251-184776273 CAAACTTAGGGGAGCGAGAAAGG + Intergenic
967012171 3:185446054-185446076 CAAAACCAGGGCATGGAGGATGG + Intronic
967109475 3:186280993-186281015 CAGAATAAGGGAAGGAAGGTGGG - Intronic
967568512 3:190999762-190999784 GGAAGGAAGGGGAGGGAGGAGGG + Intergenic
967899978 3:194440050-194440072 CAAAATGTGGGTAGGGAGGGAGG + Intronic
967986870 3:195101801-195101823 AAAAAAAAGGGGAGAGGGGAAGG + Intronic
968698577 4:2044171-2044193 CAAAACAAGGGGAGGCAGGCAGG - Intergenic
969134415 4:5018972-5018994 AAAAAAAAGGAGTGGGAGGATGG - Intronic
969475149 4:7418118-7418140 CAGAAAAAAGGGAAGGAGGAAGG - Intronic
970237885 4:13976907-13976929 CAAGATATGGGGAGGGAGGGAGG - Intergenic
970572124 4:17393340-17393362 AAAAAAAAGGGGGGGGGGGAGGG + Intergenic
970906880 4:21226224-21226246 CAGCATAGGGGGAGGGAGGGGGG + Intronic
971394300 4:26214378-26214400 AGAAAGAAGGGGAGGGAGGGAGG + Intronic
971455816 4:26842571-26842593 AGAAAGAAAGGGAGGGAGGAAGG - Intergenic
971709653 4:30094258-30094280 GAAAAAAATGGCAGGGAGGATGG + Intergenic
971775552 4:30960068-30960090 GAAAAGGAGGGGAGGAAGGAAGG + Intronic
972103848 4:35457616-35457638 AAAAATAAAGGAAGGAAGGAAGG + Intergenic
973251033 4:48060031-48060053 CAAAATAAAGGGATGGAGGAAGG + Intergenic
973321684 4:48816973-48816995 CAAAAAAAGGGGTGGGAGAGGGG + Intronic
973755010 4:54065533-54065555 AGAAAGAAGGGGAGGAAGGAAGG + Intronic
973765367 4:54157165-54157187 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
973765386 4:54157210-54157232 AAGAAAAAGGGGGGGGAGGAAGG + Intronic
973901099 4:55472728-55472750 CAAAAGAAGGGGGGGGACAAGGG - Intronic
974151188 4:58011275-58011297 CAAAATAAAGGGATGGAGGAAGG + Intergenic
974220464 4:58962700-58962722 CAAAACTAGGGCAAGGAGGAGGG - Intergenic
974223139 4:59002693-59002715 GAAAAACAGGGGAGAGAGGATGG - Intergenic
974432878 4:61820836-61820858 CAAAATAACGGTTGGGAGAAAGG - Intronic
974522170 4:62995964-62995986 AGAAATTAAGGGAGGGAGGAAGG + Intergenic
974547890 4:63335860-63335882 CAAAATACAGGGATGGAAGAAGG + Intergenic
974612878 4:64239517-64239539 CAAAATAAAGGGATGGAGGAAGG - Intergenic
974831467 4:67194682-67194704 CAAAATAAAGGAAGGAAGGAAGG + Intergenic
975503418 4:75112133-75112155 CAAAATAAAGGGATGGAGGAAGG + Intergenic
976026132 4:80689826-80689848 CAAAATAAAAGGATGGAGGAAGG + Intronic
976140802 4:81989476-81989498 CAAAAAACGGGGAGGGATGGGGG + Intronic
976221802 4:82762171-82762193 CAAAAGAAGAGGAGAGGGGAGGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976546786 4:86344654-86344676 GAATATGAGGGGAGGGAGGAAGG + Intronic
976548607 4:86367255-86367277 CAATATGAGGGGATGGTGGAGGG + Intronic
976548689 4:86368275-86368297 GAAACTATGGGGAGGGAGTAGGG - Intronic
976776124 4:88707876-88707898 GAAAATAAGGGAAGGGAGGAAGG - Exonic
976967014 4:91055787-91055809 AAAAAGAAAGGGAGGGAGGGAGG - Intronic
978014468 4:103725361-103725383 CAAAATATGGGGAGGAAATAAGG - Intergenic
978483745 4:109226221-109226243 CAGAAGAATGGGAGGTAGGAGGG + Intronic
978564017 4:110063087-110063109 CAAAATAAGATCAGCGAGGAAGG - Intronic
978697549 4:111600453-111600475 CCAAAGAAAGGGAGGGAGGTTGG - Intergenic
979283001 4:118888689-118888711 CGAGATAAGGGAAAGGAGGACGG - Intronic
979366553 4:119831453-119831475 CAAAATAATGGAAGGAGGGAGGG - Intergenic
979385984 4:120066415-120066437 GAAAGTAAGGGGTGGGAGGTGGG + Intronic
979397992 4:120211722-120211744 TAAAAGAAAGAGAGGGAGGAAGG - Intergenic
979562141 4:122112237-122112259 CAAAATAAAAGGATGGAGGAAGG + Intergenic
979925900 4:126563582-126563604 CCAAATATCGGGAGGGACGACGG + Intergenic
980038687 4:127914283-127914305 TAAAATATGGGGAGGGAGGGAGG - Intergenic
980098960 4:128522384-128522406 TGAAATAAAGGAAGGGAGGAAGG - Intergenic
980266154 4:130518931-130518953 TAAAATAATGGAAGGAAGGAGGG + Intergenic
981030394 4:140119614-140119636 AAAAAAAAAGGAAGGGAGGAAGG - Intronic
981086579 4:140689739-140689761 AAAAAAAAGGGGTGGGAGGAAGG - Intronic
981328619 4:143482415-143482437 GAAAAAAAAGGAAGGGAGGAAGG + Intergenic
981638889 4:146912709-146912731 CAAGAGAAGGGAGGGGAGGAGGG + Intronic
981736877 4:147962664-147962686 AAAAATAAAGGGAGTGAGGTAGG - Intronic
981950710 4:150403561-150403583 AAAAAGAAGGGGAAGGAGAAGGG - Intronic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982088138 4:151857190-151857212 TAGCATGAGGGGAGGGAGGAGGG - Intergenic
982156013 4:152521638-152521660 AGAAATAAGGGGACGGTGGAAGG + Intronic
982341845 4:154308281-154308303 CAAAAGAAGGGAGGGGAGGAAGG + Intronic
982550647 4:156794516-156794538 AAAAAAGAAGGGAGGGAGGAAGG + Intronic
983018658 4:162647126-162647148 CCAAAAAAGGGGAGGGTGGGAGG - Intergenic
983086041 4:163445538-163445560 TAAAAAAAGGGAAGGAAGGAAGG + Intergenic
983373220 4:166891113-166891135 CAAAATAAAGGGATGGATGGAGG - Intronic
983912587 4:173256558-173256580 AAAAATACGGGAAGGAAGGAAGG - Intronic
983953949 4:173675329-173675351 GAAAAGAAAAGGAGGGAGGAAGG - Intergenic
984008520 4:174342473-174342495 GAAAAGAAGGGAAGGAAGGAAGG + Intergenic
984421784 4:179532598-179532620 GAAAGTTTGGGGAGGGAGGAAGG + Intergenic
984501549 4:180565284-180565306 AAAAAGAAAGGAAGGGAGGAAGG - Intergenic
984605946 4:181786472-181786494 CTAAAGAAGGTGAGGGATGAGGG + Intergenic
984821072 4:183883129-183883151 CAAAATAATTGGGGGGAGGAGGG - Intronic
984908781 4:184652853-184652875 AAAAAGAAAAGGAGGGAGGAAGG + Intronic
985073328 4:186190205-186190227 TAAAATAGGGGGAGGAAGGAAGG - Intergenic
985114327 4:186576102-186576124 CAAAATAAGGGGGGTGGGGGTGG + Intergenic
985385356 4:189440724-189440746 CAAAATAAGAAAAGGGGGGAGGG - Intergenic
985711480 5:1432057-1432079 CAGAGGAAGGGTAGGGAGGAAGG + Intronic
985830847 5:2228543-2228565 CAAAAGAAGGGAAGGAAGGAAGG + Intergenic
985905029 5:2827860-2827882 GAAAGGAAGGGGAGGAAGGAAGG + Intergenic
986078471 5:4363288-4363310 AGAAAGAAGGGGAGGGAGGGAGG - Intergenic
986383222 5:7207143-7207165 CAATATAAGGTAAGGAAGGAAGG - Intergenic
986870153 5:12036354-12036376 CAAAATACGGGGGTAGAGGAAGG + Intergenic
986927900 5:12781228-12781250 GAAAAAGAGGGAAGGGAGGAAGG - Intergenic
987361012 5:17106477-17106499 AAAAAAAGGGGGAGGGAAGACGG - Intronic
987385929 5:17329380-17329402 AAGAAAAAAGGGAGGGAGGAGGG - Intergenic
987536729 5:19199201-19199223 AAAATTAAGGGAAGGAAGGAAGG + Intergenic
987563119 5:19549811-19549833 AAAAAGAAAGGGAGGGAGGGAGG + Intronic
987603868 5:20107906-20107928 CAAGAAAGGGGGAGGGGGGAGGG - Intronic
987808213 5:22798058-22798080 CAAAATAAGGGAGAGTAGGAAGG - Intronic
988195041 5:27993967-27993989 CAAAATGAAGCCAGGGAGGATGG + Intergenic
988886580 5:35564515-35564537 CCAAATAAGGGGAGGAATAAGGG - Intergenic
989130148 5:38099295-38099317 AGAAAGAAGGGAAGGGAGGAGGG - Intergenic
989221118 5:38965791-38965813 GAAAACAAGGGTGGGGAGGAGGG + Intronic
989697715 5:44223153-44223175 AGAAATGAGGGGAGGGAGGGAGG + Intergenic
989794262 5:45447169-45447191 CAAAATAAAAGGATGGAGGAAGG + Intronic
989797800 5:45497560-45497582 CAAAATAAAAGGATGGAGGAAGG - Intronic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989949673 5:50282361-50282383 CAAAATAAAAGGATGGAGGAAGG + Intergenic
990448909 5:55917616-55917638 CCAACTATGGGGAGAGAGGAAGG - Intronic
990831249 5:59960701-59960723 CAAAAAGAGGGGAGGGAGAGAGG + Intronic
991042198 5:62187779-62187801 AAAAATAAAGGAAGGAAGGAAGG + Intergenic
991329434 5:65477746-65477768 AAAAATGTGGGGAGGGAGCAAGG - Intronic
991900306 5:71454003-71454025 GAAAGTAATGGGAGGGAGGCTGG - Intergenic
991942037 5:71862607-71862629 CAAAAGGAGGGAAGAGAGGAGGG + Intergenic
992051788 5:72947893-72947915 GAAAGAAAGGGGAGAGAGGAAGG - Intergenic
992055794 5:72988038-72988060 CAAAGTAAATGGAGGGATGATGG + Intronic
992483274 5:77171920-77171942 CAGGATGAGGGGAGGAAGGATGG + Intergenic
992501298 5:77346800-77346822 TAAAACAAGAGGAAGGAGGAAGG + Intronic
993176575 5:84494383-84494405 GGAAGAAAGGGGAGGGAGGAAGG - Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993728276 5:91393064-91393086 CAAACTAAGGGAGGGGAGGATGG - Intergenic
993772942 5:91953595-91953617 CAAAATAAAGGTAAGGAGGTAGG + Intergenic
993955082 5:94222346-94222368 GAAAAGAAGAGGAGAGAGGATGG + Intronic
994001660 5:94788677-94788699 CTAAACATGGGGAGGGAGGGAGG - Intronic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994598718 5:101873700-101873722 CATAAAAAGGTGAGAGAGGATGG + Intergenic
994636783 5:102353582-102353604 CAAAATAAAGGGATGGAGGAAGG + Intergenic
994712827 5:103286244-103286266 AAAAAAAAGGTGAGGGAGAAGGG - Intergenic
995432564 5:112097768-112097790 AAAAATAAAGGAAGGAAGGAGGG + Intergenic
996039123 5:118791005-118791027 CAAAAGTAGGGGATGGGGGATGG - Intergenic
996113630 5:119594395-119594417 CAAAATAAGTTGAGAGAGAAGGG + Intronic
996170355 5:120282618-120282640 CAAAATAAAAGGATGAAGGAAGG + Intergenic
996186967 5:120489510-120489532 CAAAATAAAGGGATGGAGGAAGG - Intronic
996232614 5:121085009-121085031 CAAAATAAAGGGATGGAGGATGG - Intergenic
996292719 5:121872629-121872651 AAAAAAAATGGGAGGGAGGAGGG - Intergenic
996403932 5:123089031-123089053 CAGAAGAAGGGGAGGGGAGAGGG - Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997396881 5:133568056-133568078 CAAAAATGGGGGAGGGAGGGTGG + Intronic
997701420 5:135903295-135903317 CCAAATAGGGGAGGGGAGGAGGG + Intergenic
997778799 5:136636572-136636594 AAAAAAAAGGGAAGGAAGGAAGG - Intergenic
997909284 5:137853536-137853558 GAGAATGAGGGGTGGGAGGAGGG + Intergenic
998305570 5:141072819-141072841 GAAAAGAAAGGGAGGGAGGGAGG + Intergenic
998444621 5:142188882-142188904 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
998453245 5:142250728-142250750 CAAAGTAAGTGGAGGAAGGTTGG + Intergenic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998879192 5:146629742-146629764 GAAGAAAAGGGGAGGGAGGGAGG - Intronic
999256067 5:150210601-150210623 CAAAAGCTGGGGAGGTAGGAAGG + Exonic
999330544 5:150671141-150671163 GAAATTAAGTGGAGGGTGGATGG - Intronic
999355879 5:150930132-150930154 CAAACAAGGGGGAGGGAGGATGG - Intergenic
999652162 5:153778101-153778123 GAAAAAAATGGGAGGGAGGTTGG + Intronic
999887350 5:155937494-155937516 TAAAAGAAGTGGAGGGAGAAAGG + Intronic
1000118554 5:158175772-158175794 AAAGATAAGGGGAGGGGTGATGG + Intergenic
1000602157 5:163287804-163287826 GGAAAAAAGGGAAGGGAGGAAGG + Intergenic
1000763415 5:165254810-165254832 AATAATAAAGGGAGGAAGGAAGG - Intergenic
1000992897 5:167928959-167928981 AGAAATAAAGGGAGGAAGGAAGG + Intronic
1001165427 5:169361337-169361359 GAAAAAAAGGGGAGGGGGGCAGG + Intergenic
1002255420 5:177954751-177954773 AAGAAGAAAGGGAGGGAGGAGGG + Intergenic
1002464037 5:179395514-179395536 AGAAAGAAAGGGAGGGAGGAAGG + Intergenic
1002517579 5:179771076-179771098 CAAAACAAAGGGAGTGAGGGAGG - Intronic
1002606300 5:180384997-180385019 AAAAAAGAGTGGAGGGAGGACGG + Intergenic
1002703747 5:181146775-181146797 GAAAATAGGGGGAGGAAGGGGGG - Intergenic
1002796990 6:480466-480488 TAAAATAAGGGGGGGGGGAATGG - Intergenic
1002863048 6:1096916-1096938 TAATGTAAAGGGAGGGAGGAAGG + Intergenic
1002886993 6:1306273-1306295 CACAAGGAGGGGAGGGAAGAAGG - Intergenic
1002894481 6:1368638-1368660 GAAAAATAGGTGAGGGAGGAGGG - Intergenic
1002923004 6:1586482-1586504 GAAAACAAGAGGAAGGAGGAAGG - Intergenic
1003398317 6:5771826-5771848 AAAAAGAAGAGAAGGGAGGAAGG - Intergenic
1003476079 6:6484393-6484415 AAGAAGAAAGGGAGGGAGGAAGG + Intergenic
1003509108 6:6764579-6764601 AAAAAGGAAGGGAGGGAGGAAGG + Intergenic
1003568845 6:7242693-7242715 AAAAAAAAGGGGGGGGGGGAAGG + Intronic
1003608501 6:7587448-7587470 CCAAATTAGGAGAGGGAGTAAGG - Intergenic
1003754437 6:9100686-9100708 AGAAAAAAGGGGAGGAAGGAAGG - Intergenic
1003758991 6:9153488-9153510 CAGAATAAGAGAAGAGAGGAGGG + Intergenic
1003782212 6:9442210-9442232 CAAAATAATGTTATGGAGGATGG - Intergenic
1004486886 6:16074518-16074540 CAAGATTAGAGGAGAGAGGAAGG + Intergenic
1004497018 6:16174305-16174327 TCAAAAAAGGGGAGGGGGGAGGG - Intergenic
1004658934 6:17692524-17692546 CAAAAAGAAAGGAGGGAGGATGG + Intronic
1004811208 6:19265818-19265840 TCAAATAAAGGGAGGGAGGTGGG + Intergenic
1004822998 6:19388806-19388828 AAAAAGAAGGGAAGGAAGGATGG + Intergenic
1004869533 6:19890753-19890775 AAAAAGAGAGGGAGGGAGGAAGG - Intergenic
1005112058 6:22293569-22293591 GAAAAGAAAGGGAGGAAGGAAGG + Intronic
1005457431 6:26034298-26034320 CAAAAAAAGGGGAGGGGGAGTGG + Intergenic
1005466131 6:26115996-26116018 GAAAATAAAGGAAGGGAGAATGG + Intronic
1005584149 6:27259827-27259849 CAAATTCAGAGGAGGGAGGCAGG - Intergenic
1005705336 6:28446062-28446084 AAAAAGTAGGGAAGGGAGGAGGG - Intergenic
1005771816 6:29081451-29081473 AAAAAAAAGGGAAGGAAGGAAGG - Intergenic
1005972304 6:30770934-30770956 CAGAATAAGAGGAGAGGGGAGGG - Intergenic
1006077380 6:31542440-31542462 CTAGCTGAGGGGAGGGAGGAGGG + Exonic
1006236600 6:32638743-32638765 AAAGAAAAGGGAAGGGAGGAAGG + Intronic
1006284818 6:33084843-33084865 CAAAAAAAAGGAAGGAAGGAAGG + Intronic
1006318474 6:33304909-33304931 CGTAATAGGGGGAGGGATGATGG - Intronic
1006681597 6:35800739-35800761 CGAAAGGAAGGGAGGGAGGAAGG - Intergenic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006847479 6:37072605-37072627 AAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1006881411 6:37343204-37343226 CAAAACAAGGGAAGAGAGAATGG - Intergenic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007199453 6:40094189-40094211 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1007263476 6:40580173-40580195 CAAAATAGGGTGTGGGAGAAGGG - Intronic
1007302337 6:40876704-40876726 AGAAAGAATGGGAGGGAGGAAGG - Intergenic
1007516474 6:42417054-42417076 CTTAAAAAGGGCAGGGAGGAGGG - Intronic
1007675244 6:43588372-43588394 GAAAAGAAAGGAAGGGAGGAAGG - Intronic
1007795167 6:44341336-44341358 CAGAAAAAGGGTAGAGAGGAAGG + Intronic
1007833260 6:44655004-44655026 GAAAGTAAGGGAAGGAAGGAAGG + Intergenic
1007930884 6:45689756-45689778 CAAAAAAAGAAGAGGAAGGAAGG - Intergenic
1009567779 6:65334761-65334783 CACAATAAAAGGAGGGAAGAAGG - Intronic
1009718028 6:67426311-67426333 CAAAATAAAGGGATGGAGAAAGG - Intergenic
1009777447 6:68222824-68222846 CAAAAGAAGGGGAAGAAGAAGGG + Intergenic
1009921827 6:70071882-70071904 CAAAGTAAGTGGAGGGATGCTGG + Intronic
1009929275 6:70157008-70157030 AAAAGTAAGGGAAAGGAGGAAGG + Intronic
1009939553 6:70274353-70274375 GAAAATAGGGGGTGGGAGGAGGG - Intronic
1010091880 6:71992476-71992498 AAAAAGAAGGGAAGGAAGGAAGG - Intronic
1010348940 6:74848385-74848407 CCAAAACAGGGGAAGGAGGAAGG + Intergenic
1010704333 6:79089802-79089824 AAAAAGAGAGGGAGGGAGGAAGG - Intergenic
1010788204 6:80030307-80030329 CAATATAAGGGAAGGAATGATGG + Intronic
1011247240 6:85332228-85332250 CACAAAAAGGGGAGGGAGAGAGG + Intergenic
1011406688 6:87022830-87022852 AAAAAAAAGGGAAGGAAGGAAGG + Intergenic
1011472636 6:87723192-87723214 CAGTATATGGGTAGGGAGGAGGG - Intergenic
1011550512 6:88527503-88527525 GGAAAGAAGGGGAGGGAGGGAGG + Intergenic
1011552161 6:88539782-88539804 GAAAACAAGAGGAGGAAGGAAGG + Intergenic
1011775455 6:90725505-90725527 CAAAATATGAGGAGAGGGGAAGG + Intergenic
1012135774 6:95554090-95554112 CAGAATAGGGTGAGGGTGGAGGG - Intergenic
1012953869 6:105547840-105547862 CTAAAGAAGGAGAGGAAGGAAGG + Intergenic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013671603 6:112409083-112409105 AAAAACAAGGGGAGGCAGTAGGG + Intergenic
1014028390 6:116674309-116674331 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1014265068 6:119268320-119268342 CAAAATACAGGGAAGGAGCAAGG + Intronic
1015054965 6:128889573-128889595 GAAAATAAAGAAAGGGAGGAAGG - Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015419727 6:132993093-132993115 AAAAAAAAGGGCAGGGAGGTGGG - Intergenic
1015571337 6:134624397-134624419 GGAAAGAAAGGGAGGGAGGAAGG - Intergenic
1015645464 6:135383213-135383235 AAAAAAAAAGGGAGGGGGGAAGG - Intronic
1016359013 6:143248334-143248356 CAAAAATATGGGAGGAAGGAAGG - Intronic
1016570785 6:145509869-145509891 CAAAGTAAAGGGATGGAGAAAGG + Intronic
1016841656 6:148531968-148531990 CAAAATAAAGGGAGTGGGGAAGG + Intronic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1018423277 6:163658547-163658569 AAAGGGAAGGGGAGGGAGGAAGG - Intergenic
1018814424 6:167320430-167320452 GAAGAAAAGGGGAAGGAGGAAGG - Intergenic
1019374476 7:682029-682051 TGAAGTAAGGGGAGGGAGGGAGG + Intronic
1019543292 7:1560934-1560956 CAAAATCCGGGCAGGGGGGAAGG - Intergenic
1019758184 7:2788807-2788829 AAAAAAAAGGGGAGGTAAGATGG - Intronic
1020113397 7:5460891-5460913 AAAAATATGGTGAGGGATGAAGG - Intronic
1020224538 7:6269752-6269774 CAAGATAAGGAGAGAGAGGATGG - Intronic
1020227050 7:6288597-6288619 CAAAAGGGAGGGAGGGAGGAAGG - Intergenic
1020240418 7:6390083-6390105 AAAAAAAAAGGGAGGGAGGGAGG - Intronic
1020739487 7:11995939-11995961 CAATACAAGAGGAGGGAGGAAGG - Intergenic
1020808273 7:12818329-12818351 CAAATTATGGGGAGGGAAGAAGG - Intergenic
1021183945 7:17540994-17541016 GAAAAGAAAGGGAGGGAAGAAGG + Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021529614 7:21630208-21630230 CAAAATGTGGGGTGGGGGGAAGG - Intronic
1021656707 7:22880655-22880677 GAAAAGAAAGGAAGGGAGGAGGG - Intergenic
1021705914 7:23367579-23367601 CAACGACAGGGGAGGGAGGAAGG + Intronic
1021760700 7:23900780-23900802 ATAAATAAAGGGAGGGAGGGAGG - Intergenic
1021870340 7:25000105-25000127 TAAACTAAAGGGATGGAGGAAGG - Intergenic
1021947929 7:25745979-25746001 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1021954178 7:25807294-25807316 CAAAACGAAGGGAGGGAGGAGGG + Intergenic
1022004346 7:26253783-26253805 GACAAGAAAGGGAGGGAGGAAGG + Intergenic
1022135635 7:27445453-27445475 TAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1022139081 7:27476501-27476523 CAAAAGGGAGGGAGGGAGGAAGG + Intergenic
1022413999 7:30162681-30162703 CACTCTCAGGGGAGGGAGGAGGG - Exonic
1023147081 7:37162000-37162022 AAAAAAAAGGGGAGGAGGGAAGG + Intronic
1023895209 7:44427395-44427417 CAGAATAAGGGGAGCAAGGATGG + Intronic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1023962695 7:44940232-44940254 CAAAAAAAAGGGGGGGGGGAGGG + Intergenic
1024142728 7:46478661-46478683 CAAAGAAAGGGGAGAGAGGAAGG + Intergenic
1024270156 7:47635826-47635848 GGAAAGAAGAGGAGGGAGGAAGG + Intergenic
1024330445 7:48149356-48149378 AAAAAAAAGGGAAGGGAGGGAGG - Intergenic
1024529868 7:50382866-50382888 GAGAATATGGGGAGGGGGGATGG - Intronic
1024570211 7:50716923-50716945 CCAGATGAGGGGAGGGAGGAAGG + Intronic
1024876515 7:54030334-54030356 GAAAAAAAAGGGAGGAAGGAAGG + Intergenic
1024965242 7:55018653-55018675 CAAAAGAAGGGAAAGGGGGAAGG + Intergenic
1025028785 7:55539033-55539055 AAAAAAAAGGGGGGGGGGGAGGG + Intronic
1025479361 7:60962735-60962757 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1025552623 7:62269589-62269611 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1025565862 7:62433239-62433261 CAAAAGGAAGGGAGGGAGCAAGG + Intergenic
1025872668 7:65449359-65449381 CAGAAGAAAGGGAGGGAAGAAGG - Intergenic
1025982788 7:66420964-66420986 CGAAGTAAGGGGTGGGGGGACGG - Intergenic
1026306449 7:69146340-69146362 GAAAAAAAGAAGAGGGAGGAAGG - Intergenic
1026387793 7:69867772-69867794 AAAAATAGGGGGAGAGAGGGAGG - Intronic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026520508 7:71113711-71113733 GAAAAAGAGGGGAGGGAGGGAGG - Intergenic
1026545923 7:71321948-71321970 CAAAAAAAAGGAAGGAAGGAAGG - Intronic
1026871843 7:73857495-73857517 AAAAAGAAGGGAAGGAAGGAAGG - Intergenic
1026876452 7:73881737-73881759 CAGAATCAGGGGAGGGGGGTGGG + Intergenic
1026876646 7:73883023-73883045 CAAAATAAGGGGGTTGAGGCTGG + Intergenic
1026882346 7:73915466-73915488 GAAAAGGAAGGGAGGGAGGAAGG - Intergenic
1026953700 7:74363903-74363925 AAAAAAAAAGGGAGGGAGGAAGG + Intronic
1027453511 7:78359399-78359421 CAAAATACAGGGAAGGAGCAAGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027902619 7:84136915-84136937 AAGAAGAAGGGGAGGAAGGAAGG + Intronic
1028658157 7:93234792-93234814 CAAAATAATGGGAGGAAGGAAGG + Intronic
1029830052 7:103246864-103246886 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1030034468 7:105396839-105396861 AGAAATAGAGGGAGGGAGGAAGG + Intronic
1030035304 7:105403752-105403774 CGAAAGGAAGGGAGGGAGGAAGG - Intergenic
1030035326 7:105403862-105403884 CAAAAGAAAGGAAGGGAGGGAGG - Intergenic
1030741027 7:113110196-113110218 AGAAATAAGGGGAGGGAATATGG + Intergenic
1030999236 7:116395716-116395738 AAAAAAAAGGAGGGGGAGGAAGG - Intronic
1031049935 7:116934797-116934819 AAAGAAAGGGGGAGGGAGGAAGG - Intergenic
1031081790 7:117265150-117265172 AAAAAAAAAGGGAGGGAGGCAGG - Intergenic
1031214878 7:118877323-118877345 GAAAGGAAGGGAAGGGAGGAAGG + Intergenic
1031323815 7:120366492-120366514 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1032325565 7:130925310-130925332 GAAGAAAAGGGAAGGGAGGAGGG + Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032604708 7:133337623-133337645 AAAAAAAAGGGAAGGAAGGAAGG - Intronic
1032610465 7:133407284-133407306 CAAAGTAAGAGGATGGTGGATGG - Intronic
1032705555 7:134418642-134418664 GAAAATCAGGGGGGGCAGGAGGG + Intergenic
1032813625 7:135448534-135448556 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1032842333 7:135724168-135724190 CAAGTTAAGGGGAAGGAGGTGGG + Intronic
1033724460 7:144099098-144099120 AAAAAAAGAGGGAGGGAGGAAGG - Intergenic
1033840366 7:145366128-145366150 TAAGATACGGGGAGGGGGGAGGG + Intergenic
1034218800 7:149428757-149428779 CAGAACAAGGGGAGAGACGATGG + Intergenic
1034607450 7:152330142-152330164 CAAAAAAAGGGAGGGGGGGAGGG + Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035485667 7:159223220-159223242 CACAGTTAGGGCAGGGAGGATGG + Intergenic
1035776270 8:2191198-2191220 GAAAGGGAGGGGAGGGAGGAAGG - Intergenic
1035824227 8:2627429-2627451 CAAAAGGAAGGGAGGGAGGGAGG + Intergenic
1035985118 8:4420904-4420926 CAAAAGACAGGGAGGGAGGAGGG - Intronic
1036051649 8:5205763-5205785 AAAAAAAAAGAGAGGGAGGAAGG + Intergenic
1036448715 8:8846254-8846276 AAAAAAAAGGGGGGGGGGGAAGG + Intronic
1036663023 8:10720530-10720552 GAAGAGAAAGGGAGGGAGGAAGG + Intergenic
1036765118 8:11544933-11544955 TACAAACAGGGGAGGGAGGAGGG - Intronic
1037542461 8:19885586-19885608 GAAAAGAAGGAAAGGGAGGAGGG - Intergenic
1037691245 8:21183308-21183330 GAAAATGAGGGGAGGAAGGGAGG - Intergenic
1037777429 8:21844918-21844940 CAAGATGAGGTGAGGGAGGTGGG - Intergenic
1037908359 8:22728599-22728621 CAAAAAAAGGGAAGGAAGGAAGG - Intronic
1037951313 8:23020011-23020033 AAAACAGAGGGGAGGGAGGAAGG + Intronic
1038137295 8:24801570-24801592 CAAAAGAAGGAGGGGAAGGAAGG + Intergenic
1038426162 8:27465261-27465283 AATTAGAAGGGGAGGGAGGATGG - Intronic
1038448435 8:27620833-27620855 GAAGAGAAGGGAAGGGAGGAAGG - Intergenic
1038667661 8:29554250-29554272 AAAAAGAAGGGGAGGGAGGGAGG - Intergenic
1038786319 8:30619987-30620009 CAACAGAAGAGGATGGAGGAAGG + Intronic
1039459246 8:37729517-37729539 CAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1039977611 8:42380693-42380715 AAGAAAAAAGGGAGGGAGGAAGG + Intergenic
1040011020 8:42661308-42661330 AAAAAGAAGGTGGGGGAGGAGGG - Intergenic
1040051899 8:43023409-43023431 GAAAAGAAGGGAAGGAAGGAAGG - Exonic
1040366985 8:46727687-46727709 CAAAATAAAGGCATGGAGGAAGG + Intergenic
1040549810 8:48429240-48429262 AGAAAGATGGGGAGGGAGGAGGG + Intergenic
1040675897 8:49749683-49749705 GAAAACAAAGGGAGGGAGGGAGG + Intergenic
1040824619 8:51607839-51607861 CAAAAAAAAGGAAGAGAGGAAGG + Intronic
1040927257 8:52697587-52697609 AAAAATAAGCGAAGGAAGGAAGG + Intronic
1041238481 8:55828515-55828537 AAAAAAAAGGGGGGGGGGGAGGG - Intergenic
1041645068 8:60243272-60243294 GAAAAGAGGAGGAGGGAGGAAGG - Intronic
1041674087 8:60520695-60520717 CAGAATGAGGGAAGAGAGGAGGG - Intronic
1041758363 8:61338136-61338158 CAAAATAAAGTGAGAGAAGATGG - Intronic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1042230641 8:66550964-66550986 CAAATTAAGGGTTGGGAGGTGGG - Intergenic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042434322 8:68745518-68745540 CAAAATAAAAGAATGGAGGAAGG + Intronic
1042656092 8:71098448-71098470 AGAAAGAAAGGGAGGGAGGAAGG - Intergenic
1042704168 8:71649339-71649361 AAAAATAAGGTGTGGAAGGAGGG + Intergenic
1042922613 8:73934386-73934408 AAAAAAAAGGGAAGGAAGGAAGG - Intergenic
1042980629 8:74522943-74522965 GAAAATAAAGGGATGGAAGAAGG + Intergenic
1043404753 8:79918803-79918825 CAAAACAAGGGGTGGGGGGTGGG + Exonic
1044253206 8:90028708-90028730 AAAAAGAAAGGAAGGGAGGAAGG - Intronic
1044323511 8:90833212-90833234 CAAAGTGATGGGATGGAGGATGG - Intronic
1044619116 8:94172000-94172022 CGGGAGAAGGGGAGGGAGGAGGG - Intronic
1044769005 8:95609593-95609615 CAAAAAAAGAGAAGGAAGGAAGG - Intergenic
1045608692 8:103809485-103809507 AAAAAGGAGTGGAGGGAGGAGGG - Intronic
1045826995 8:106409446-106409468 CAAAAAACAGGAAGGGAGGAGGG + Intronic
1045882975 8:107063133-107063155 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046047739 8:108984455-108984477 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1046292361 8:112179801-112179823 CAAGAGAAAGGGAGAGAGGAGGG + Intergenic
1046469391 8:114650039-114650061 AAAAATAAGGGGTGAGAGAATGG - Intergenic
1046555459 8:115768322-115768344 GGAAAGAAGGGAAGGGAGGAAGG - Intronic
1046558436 8:115806693-115806715 AAAAAGAAAGGGAGGAAGGAAGG + Intronic
1046905340 8:119566359-119566381 TTTAATAAGGGGAGGGAAGAGGG - Intronic
1047261301 8:123262951-123262973 GAAAAGAAAGGGAGGGAGGGAGG + Intronic
1047434743 8:124826973-124826995 CATACTAAGGGGAGGGGGAAAGG - Intergenic
1047580663 8:126211943-126211965 CAAAGTAAAGGGATGGAGAAAGG - Intergenic
1047736739 8:127772251-127772273 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1047903549 8:129449360-129449382 CAAAATAAAAGAAGTGAGGAAGG + Intergenic
1047948846 8:129910952-129910974 CAAAACAATGGGAGAGAGGCCGG - Intronic
1048391562 8:133970587-133970609 GAAAATAAAGGAAGGAAGGAAGG + Intergenic
1048567758 8:135621127-135621149 TAAAAAAAAGGGGGGGAGGATGG + Intronic
1048724458 8:137366706-137366728 CCAAAAGAGGGGAGGGAAGAAGG - Intergenic
1048806115 8:138242790-138242812 AAAAACAAGGGGTGGGAAGATGG + Intronic
1048989605 8:139753431-139753453 GTGAATAAAGGGAGGGAGGAAGG - Intronic
1049153302 8:141050304-141050326 AAAAAAAAGGGATGGGAGGATGG + Intergenic
1049518723 8:143076986-143077008 TACAATAAGGGCAGGAAGGAAGG + Intergenic
1049784890 8:144445660-144445682 AAAAAGAAAGGGAGGGAGGGAGG + Intergenic
1049846252 8:144803258-144803280 CAGCATCAGGAGAGGGAGGATGG - Intronic
1050366966 9:4881721-4881743 AAGAAAAAAGGGAGGGAGGAAGG - Intronic
1050511202 9:6397506-6397528 CAAAAGAAAGGAAGGGAGGGAGG + Intergenic
1050638779 9:7642749-7642771 CCAAAAGAGGGGAGGGAGGAGGG - Intergenic
1050912196 9:11085590-11085612 AAAAAAAAAGGAAGGGAGGAGGG + Intergenic
1051216418 9:14803002-14803024 AGAAAGAAAGGGAGGGAGGAAGG - Intronic
1051258663 9:15239752-15239774 CCAAAAGAGGGGAGGGAGGATGG + Intronic
1051295548 9:15591667-15591689 AGAAAAAATGGGAGGGAGGAAGG - Intronic
1051647167 9:19280149-19280171 AAAAAAAAAGGAAGGGAGGAAGG - Intronic
1052411816 9:28131034-28131056 GGAGATAAGGGGAGGGAGGCTGG - Intronic
1052494884 9:29213293-29213315 CAAATTAAGGGGAGAAAGGGGGG - Intergenic
1052505246 9:29345008-29345030 AAAAAAAAGGGGGGGGTGGAGGG - Intergenic
1052775808 9:32731164-32731186 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1052892335 9:33713644-33713666 CCAAATTGGGGGAGGGAGGAAGG - Intergenic
1053196465 9:36122987-36123009 CAAGCTGAGGGGAAGGAGGAGGG - Exonic
1053346807 9:37384223-37384245 CAAAAAAAAGGAAGGAAGGAAGG - Intergenic
1053568251 9:39276053-39276075 CAAAATAAAGGTATGGAGGAAGG + Intronic
1053834225 9:42116807-42116829 CAAAATAAAGGTATGGAGGAAGG + Intronic
1054128892 9:61342957-61342979 CAAAATAAAGGTATGGAGGAAGG - Intergenic
1054596324 9:67070602-67070624 CAAAATAAAGGTATGGAGGAAGG - Intergenic
1055249575 9:74286938-74286960 AAAAATAATGAGGGGGAGGATGG - Intergenic
1055344888 9:75325543-75325565 CAAAATAAAAGGACAGAGGAAGG - Intergenic
1055488974 9:76785006-76785028 CAAACAAAGGGGAGGGATAAAGG - Intronic
1055881224 9:81006289-81006311 CATTATAAGGGTAGGGAGGGAGG + Intergenic
1056360687 9:85854728-85854750 AAAAAAAAAGGGAGGGAGGGAGG + Intergenic
1056407069 9:86284384-86284406 AAAAGTGATGGGAGGGAGGAAGG + Intergenic
1056869491 9:90264215-90264237 CAAAATGAGGAGAGGTAGGGTGG - Intergenic
1056962506 9:91138636-91138658 GAAAGGAAGGGGAGGCAGGAGGG - Intergenic
1057016622 9:91657862-91657884 GAAAACAAGGAGATGGAGGAGGG - Intronic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057912049 9:99026771-99026793 CATAGAAAGGGGAGGAAGGAGGG - Intronic
1057931287 9:99195845-99195867 TAAAAGAAAGGGAAGGAGGAAGG - Intergenic
1057939483 9:99268838-99268860 CAAAAAAAAGGGAGAGAGAAAGG - Intergenic
1058226709 9:102372728-102372750 AAAAAAAAGGGGGTGGAGGAGGG + Intergenic
1058602153 9:106681828-106681850 CAATCTCAGGGGAGGGATGAAGG + Intergenic
1058643311 9:107107854-107107876 CAAAAGCAAAGGAGGGAGGAAGG + Intergenic
1058658020 9:107242382-107242404 AAAAGAAAAGGGAGGGAGGAAGG + Intergenic
1058887842 9:109336002-109336024 AAAAATATGGGGAGGTGGGAGGG + Intergenic
1058950443 9:109898747-109898769 CCAAATATGGGGGAGGAGGAAGG - Intronic
1058961166 9:109994104-109994126 GCAGCTAAGGGGAGGGAGGACGG + Intronic
1059215008 9:112553174-112553196 GAAAAGAAGGGGAGGGGAGAGGG - Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059675819 9:116538173-116538195 AAGAAGAAAGGGAGGGAGGAAGG + Intronic
1059876890 9:118645247-118645269 GAAAAGAGGGGGAAGGAGGAAGG - Intergenic
1059953864 9:119495892-119495914 CAAAATAAGGCCAGTGAGGCTGG + Intronic
1060183409 9:121549408-121549430 CATAATAAGGTGAGAAAGGAGGG + Intergenic
1060651094 9:125327930-125327952 CATAATGAGGGGAGAGAAGAGGG - Intronic
1060830921 9:126715657-126715679 GAAGGTAAGGGAAGGGAGGAAGG + Intergenic
1061005381 9:127926200-127926222 AGAAAGAAGGGGAGGAAGGAAGG - Intronic
1061085786 9:128397426-128397448 GAGAATAGGGGGAGGGGGGATGG + Intergenic
1061381168 9:130258693-130258715 AAAAAGAAAGGAAGGGAGGAAGG + Intergenic
1062427061 9:136510929-136510951 CAAAATTAGGGGAGAGGGGATGG - Intronic
1203465356 Un_GL000220v1:80981-81003 GAAAAGAAAGGGAGGGAGGAAGG - Intergenic
1185931102 X:4204329-4204351 CCAAAAAAGGGGAGGGTGGCAGG + Intergenic
1186240013 X:7555503-7555525 GAAAATAAGGGAAGGAGGGAAGG + Intergenic
1186253430 X:7693965-7693987 AAAAATAAGGGAAAAGAGGAAGG - Intergenic
1186417797 X:9398743-9398765 AAAAATAAAGGAAGGAAGGAAGG + Intergenic
1186448595 X:9653412-9653434 AGAAATCTGGGGAGGGAGGATGG - Intronic
1186590119 X:10921404-10921426 AGAAATAAAAGGAGGGAGGAAGG - Intergenic
1186850231 X:13572683-13572705 AAAAATAATGTGAGAGAGGAGGG + Intronic
1187073544 X:15912006-15912028 CAACAGAAGGGGAAGAAGGAGGG - Intergenic
1187267321 X:17747188-17747210 CAGAAGAAGGGCAGGGATGAGGG - Intronic
1187538489 X:20166667-20166689 GAAAATGAGGGGAGGGAGGGAGG - Intronic
1187671516 X:21670848-21670870 CCAAAAGAGGGGAGGGTGGAAGG - Intergenic
1187742232 X:22368408-22368430 CAAAAGAAGGGGATCGAGAAAGG - Intergenic
1187756620 X:22534556-22534578 TAAAATAAGGGAGGGGAGGAGGG - Intergenic
1187783540 X:22857344-22857366 GAAAAGAGGGGGAGGGAGGGAGG - Intergenic
1187913696 X:24133486-24133508 CTAAAAAGGGGGAGGGAGCAGGG - Intergenic
1188068808 X:25694902-25694924 CAATACAAGAGGTGGGAGGACGG - Intergenic
1188108621 X:26171064-26171086 CAAGATAATGGAAGGAAGGAAGG - Intergenic
1188511793 X:30944019-30944041 GAAAAAAAGGAGTGGGAGGAAGG + Intronic
1188891616 X:35618284-35618306 GAGAAGAAGGGCAGGGAGGATGG + Intergenic
1189110846 X:38286969-38286991 CAAGATGAGGAGAGGGAGAAGGG - Exonic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189867083 X:45342075-45342097 GAAAATAAGGGGAGGGTGTGAGG + Intergenic
1190110739 X:47587480-47587502 GAGAAGTAGGGGAGGGAGGATGG - Intronic
1190259617 X:48789789-48789811 CAACAGAGGTGGAGGGAGGAGGG + Intronic
1190294985 X:49021071-49021093 AAAAAGAAGGGAAGGAAGGAAGG + Intergenic
1190504560 X:51113995-51114017 CAAAATAAAAGGATGGAGGAAGG + Intergenic
1190620316 X:52280913-52280935 CCAAATAAGGGAAGGGAAGGGGG + Intergenic
1191799013 X:65056944-65056966 CAAAATAAAGGGATGGAGGAAGG - Intergenic
1192054854 X:67762808-67762830 TATTATAAGGGAAGGGAGGAAGG + Intergenic
1192457343 X:71287851-71287873 AAAAAAAAGGGTAGGGGGGAGGG - Intronic
1193018036 X:76757841-76757863 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193234875 X:79094499-79094521 CAAAACAAAGGAAGGAAGGAAGG - Intergenic
1193542671 X:82790584-82790606 CAAAATAAAGGGATGGAGGAAGG + Intergenic
1193599144 X:83487747-83487769 AAAAATGGGGGGAGGGGGGAGGG + Intergenic
1193743171 X:85243524-85243546 AGAAATGAAGGGAGGGAGGAAGG + Intergenic
1193743448 X:85244884-85244906 CCAAGTGAGAGGAGGGAGGAGGG + Intronic
1194418231 X:93638920-93638942 CAAAATGAAGAGAGAGAGGAGGG - Intergenic
1194599694 X:95904962-95904984 CAACAGAAGGGGAGGAATGAAGG - Intergenic
1194626374 X:96230785-96230807 AAAAATAAAAGGAGGGAGAAAGG + Intergenic
1194736913 X:97523230-97523252 AAAAATACTGGGAGGGAGGGAGG - Intronic
1194858551 X:98965271-98965293 CAAAAAAAGAGAAGGAAGGAAGG - Intergenic
1195110142 X:101639946-101639968 GAAATTTAGGAGAGGGAGGAGGG + Intergenic
1195275665 X:103277954-103277976 GGAATTAGGGGGAGGGAGGAGGG - Intergenic
1195870536 X:109480908-109480930 AAAAAGAAGGGAAGGAAGGAAGG + Intronic
1196112819 X:111965108-111965130 CAAAATAAAGGGATGGAGGAAGG + Intronic
1196535278 X:116837059-116837081 TAAAATAGGGGGAGGGGGGAGGG - Intergenic
1196690329 X:118552044-118552066 AAAAAAAAAGGGAGGGAGGGAGG + Intronic
1196821548 X:119705294-119705316 CAAAAAGAGTGGAGGCAGGAAGG + Intergenic
1197196263 X:123704487-123704509 AAAAAAGCGGGGAGGGAGGAGGG - Intronic
1197248171 X:124187980-124188002 CAAATTAAGGGGTTGGAGGAAGG + Intronic
1197433371 X:126394410-126394432 GGAAATATGGGGTGGGAGGATGG + Intergenic
1197670514 X:129272650-129272672 GAAAGTAAGGGAAGGGAGCAAGG - Intergenic
1197710318 X:129661656-129661678 CACAATGAGGAGAGGGAAGATGG - Intergenic
1197799178 X:130331327-130331349 TAAAATAAGAGCAGAGAGGAAGG + Intergenic
1197886342 X:131222020-131222042 GAACATAATTGGAGGGAGGAGGG + Intergenic
1198042559 X:132868068-132868090 CAAAATAAAGGGATGGAGAAAGG + Intronic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199224750 X:145359262-145359284 AAAAATATGGGGTGGGGGGAGGG + Intergenic
1199344660 X:146724242-146724264 CAAAAAAAAGGAAGGAAGGAAGG + Intergenic
1199846718 X:151697024-151697046 GAAGGGAAGGGGAGGGAGGAAGG - Intronic
1200315218 X:155125118-155125140 CAAAATCATGGAAAGGAGGAAGG + Intronic
1200338060 X:155373167-155373189 CGAAACAAGGGCATGGAGGAAGG + Intergenic
1200348409 X:155467527-155467549 CGAAACAAGGGCATGGAGGAAGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200701235 Y:6404254-6404276 CAAAATAAAGGGAGGCAGTGAGG - Intergenic
1201032877 Y:9760444-9760466 CAAAATAAAGGGAGGCAGTGAGG + Intergenic
1201256454 Y:12112663-12112685 CGAAGGAGGGGGAGGGAGGAAGG - Intergenic
1201298448 Y:12485767-12485789 AAGAATAAGGTGAGGAAGGAGGG - Intergenic
1201615042 Y:15887581-15887603 TAAAATAAAAGGATGGAGGAAGG + Intergenic
1202176037 Y:22099708-22099730 CAAAATAAAGGGAGGCAGTGAGG - Intergenic
1202182454 Y:22151176-22151198 TAGAATAAAGGGAGGAAGGAAGG - Intergenic
1202208906 Y:22435226-22435248 TAGAATAAAGGGAGGAAGGAAGG + Intergenic
1202215324 Y:22486676-22486698 CAAAATAAAGGGAGGCAGTGAGG + Intergenic