ID: 1146579659

View in Genome Browser
Species Human (GRCh38)
Location 17:34025459-34025481
Sequence CCGACCTTGCATAAACATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146579655_1146579659 8 Left 1146579655 17:34025428-34025450 CCCTGAGTGAAGCACTTACACAC 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1146579659 17:34025459-34025481 CCGACCTTGCATAAACATTCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1146579656_1146579659 7 Left 1146579656 17:34025429-34025451 CCTGAGTGAAGCACTTACACACA 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1146579659 17:34025459-34025481 CCGACCTTGCATAAACATTCAGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146579659 Original CRISPR CCGACCTTGCATAAACATTC AGG Intronic
922533101 1:226359423-226359445 CCAACCTTGCATAGAAACTCGGG - Intergenic
923954203 1:238996019-238996041 CCCACCTTCTACAAACATTCTGG - Intergenic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1075216679 10:120542511-120542533 CCCATCTTTCATAAACATTTTGG - Intronic
1091132211 11:133155955-133155977 CCGACCTTGCAAAAAGACACAGG - Intronic
1099237633 12:80100733-80100755 CTTCCTTTGCATAAACATTCTGG - Intergenic
1110868564 13:80423992-80424014 CCACCCCTGCATTAACATTCAGG + Intergenic
1111845920 13:93508399-93508421 CTCACCTTGCTTAAACATGCTGG - Intronic
1117229666 14:53703030-53703052 TTGACCTTGGATAAACATGCTGG - Intergenic
1125782589 15:42283165-42283187 CCGACCTTGCAACAACACACAGG - Intronic
1131660761 15:94512932-94512954 CTGCCCTTTCATAAACTTTCAGG + Intergenic
1146579659 17:34025459-34025481 CCGACCTTGCATAAACATTCAGG + Intronic
1155455046 18:26003178-26003200 GGGACTTTGTATAAACATTCAGG - Intergenic
1156723047 18:40093743-40093765 CTGACCTTCCAAAAACAGTCTGG - Intergenic
1158512377 18:58102092-58102114 CAGAGCTTAAATAAACATTCAGG - Intronic
934921757 2:98349453-98349475 ACTACCTTTCATAAAGATTCTGG + Intronic
939526458 2:143300954-143300976 CAGACATTGCATACACATTAAGG - Intronic
940940359 2:159553022-159553044 CCTACCTTGGATACACATTTTGG - Intronic
946534591 2:220612463-220612485 CAGACCCTGCATAAACAATTTGG + Intergenic
946639014 2:221763189-221763211 CCGATCCCACATAAACATTCAGG + Intergenic
947421124 2:229942403-229942425 CCTACCCTGCATAAAAATGCTGG + Intronic
970914544 4:21317635-21317657 CTGGCCTTGCAGAAACATTTTGG + Intronic
985477421 5:86020-86042 CTGAGTTTGCATAAACATTCTGG - Intergenic
986184204 5:5421540-5421562 CTGACCTTGCTTACACACTCTGG - Intronic
1000060183 5:157648083-157648105 CCCACCTTGCACAGACATGCTGG + Intronic
1014270604 6:119331821-119331843 CCCACCTTGAATAAAGAATCAGG - Intronic
1018717810 6:166547399-166547421 CCGACCTTTCAGAACCATTTTGG - Intronic
1021895917 7:25235608-25235630 CCGACCTTGCATGAACACACTGG + Intergenic
1031315145 7:120247380-120247402 CCAACATTTCATAAACATTTTGG + Intergenic
1033390976 7:140927024-140927046 CTGACCTTGCCTTAAAATTCTGG + Intergenic
1041536378 8:58930554-58930576 CCTACCTTGAATAATCATGCTGG - Intronic
1045343472 8:101274173-101274195 CCCACCTTAGATAAACGTTCAGG + Intergenic
1051754474 9:20382767-20382789 CTGACTTTACAAAAACATTCTGG - Intronic
1052986600 9:34492449-34492471 CGGACATGGCATAAACATACTGG - Intronic
1055981408 9:82006136-82006158 CAGACCCTTCATAAACAATCTGG - Intergenic
1057884290 9:98818180-98818202 CCGATATTGGATAAATATTCTGG - Intronic
1058325357 9:103689816-103689838 CATACCATGTATAAACATTCAGG + Intergenic
1060277893 9:122195884-122195906 AAGACCTTGCATAAAGATACTGG - Intronic
1187534063 X:20122074-20122096 CCGGCCTAGCATAAACAATAAGG - Intergenic
1189066709 X:37817722-37817744 CCTATTTTGCATAAACATTTAGG - Intronic
1189845236 X:45130241-45130263 CACACCTTACATAAACACTCTGG - Intergenic