ID: 1146579781

View in Genome Browser
Species Human (GRCh38)
Location 17:34026695-34026717
Sequence CCCCAAATGCCAAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 222}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146579774_1146579781 4 Left 1146579774 17:34026668-34026690 CCAGCCATTTCCCAGCATTCATC 0: 1
1: 0
2: 0
3: 21
4: 275
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222
1146579772_1146579781 22 Left 1146579772 17:34026650-34026672 CCATGGCTCTTGCAGCCTCCAGC 0: 1
1: 0
2: 5
3: 52
4: 465
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222
1146579777_1146579781 -7 Left 1146579777 17:34026679-34026701 CCAGCATTCATCAACTCCCCAAA 0: 1
1: 0
2: 0
3: 22
4: 193
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222
1146579775_1146579781 0 Left 1146579775 17:34026672-34026694 CCATTTCCCAGCATTCATCAACT 0: 1
1: 0
2: 0
3: 19
4: 229
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222
1146579776_1146579781 -6 Left 1146579776 17:34026678-34026700 CCCAGCATTCATCAACTCCCCAA 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222
1146579773_1146579781 7 Left 1146579773 17:34026665-34026687 CCTCCAGCCATTTCCCAGCATTC 0: 1
1: 0
2: 2
3: 23
4: 301
Right 1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG 0: 1
1: 0
2: 0
3: 27
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146579781 Original CRISPR CCCCAAATGCCAAAGGTGGA TGG Intronic
900466529 1:2828324-2828346 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
902244382 1:15110715-15110737 CCCTAAATCCCAAAGTGGGAAGG + Intronic
905516323 1:38564635-38564657 TCCCAAGTGGCAGAGGTGGAGGG + Intergenic
907627449 1:56043923-56043945 ACCCAGCTGCCACAGGTGGAAGG + Intergenic
907798853 1:57744050-57744072 GCCCTAATGCCCAAGCTGGAAGG - Intronic
908760863 1:67510737-67510759 GCACAACTGCCCAAGGTGGACGG + Intergenic
910537013 1:88309928-88309950 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
913674153 1:121125719-121125741 CCCCAAATGCCAAAGTAGGGAGG - Intergenic
914025937 1:143913040-143913062 CCCCAAATGCCAAAGTAGGGAGG - Intergenic
914664374 1:149820760-149820782 CCCCAAATGCCAAAGTAGGGAGG - Intergenic
914671389 1:149873075-149873097 CCCCAAATGCCAAAGTAGGGAGG + Intronic
917894357 1:179473680-179473702 CCCCACATGTCAATGGAGGAAGG + Intronic
918951916 1:191151173-191151195 CCCCAAAAGCCAAAGGGGTTAGG - Intergenic
919991162 1:202709495-202709517 CCCCAAATGGGAAAGGTACATGG + Intronic
920286057 1:204880721-204880743 CCCCAAATCCCACAGCTGGAAGG - Intronic
921421795 1:214957244-214957266 CTCAAAATGGCCAAGGTGGAAGG - Intergenic
923278267 1:232417297-232417319 CCCCAACTTCTAAAGGTGGTAGG - Intronic
923708365 1:236364337-236364359 TGCCAAAGGACAAAGGTGGAGGG - Intronic
1065925070 10:30427895-30427917 CCCCATAGTCCTAAGGTGGATGG + Intergenic
1066506489 10:36049931-36049953 TCACAAATGGCAAAGTTGGATGG + Intergenic
1070225902 10:74505232-74505254 AACCAAAAGCAAAAGGTGGAAGG - Intronic
1070978228 10:80622833-80622855 CCCCAAATACAAATGGTGGTAGG - Intronic
1071014520 10:80979433-80979455 TCCCAAATGCCAAAGGAGCCAGG - Intergenic
1071445517 10:85742894-85742916 CCCCAAATGCCAATAGTGTCAGG - Intronic
1073070460 10:100790267-100790289 CCCCAATTTCCAGCGGTGGATGG - Intronic
1073873886 10:107899003-107899025 GCACAAAAGCCAAAGATGGAAGG - Intergenic
1074420565 10:113305197-113305219 CCCCAAGTTCCCAAGGTGGATGG + Intergenic
1075168456 10:120091165-120091187 CCCCAAAGGGCAAATGTGGGAGG + Intergenic
1075436579 10:122448658-122448680 CATCATATGCCAAAGATGGAGGG - Intergenic
1077467296 11:2739445-2739467 CCCCCACCCCCAAAGGTGGATGG + Intronic
1079888778 11:26023855-26023877 TCCCATAAGCCACAGGTGGAGGG - Intergenic
1081993631 11:47350494-47350516 CCCCAAGTCCCAAAGGTGAGAGG - Exonic
1082249834 11:49965845-49965867 GCCCTAATGCCCAAGCTGGAAGG + Intergenic
1082280350 11:50265210-50265232 GCCCTAATGCCCAAGCTGGAAGG + Intergenic
1082615336 11:55353454-55353476 GGCCAAAAGCCAAAAGTGGATGG - Intergenic
1083104410 11:60344323-60344345 ACCCACATGCCAAAGATGAAGGG - Intronic
1083333743 11:61911289-61911311 TCCCCAACGCCAAAGGTGGCAGG + Intronic
1083628418 11:64083774-64083796 CCCCAAATTCCCAAGGTCAAGGG + Intronic
1084004307 11:66315079-66315101 CCCCAAATCCCAAGGGAAGATGG - Exonic
1084536779 11:69762054-69762076 CCCCAAATGACAAAGGGGCAAGG - Intergenic
1086474417 11:87155625-87155647 CCCCAAATTCCACAGGGAGATGG - Intronic
1087153805 11:94882004-94882026 CTCCAAATGCCGAGGGTGGCGGG - Intergenic
1087307822 11:96505401-96505423 CCCCAACTGCCAAAGGTTGGGGG - Intronic
1088617123 11:111642124-111642146 CACCAAATGCGGAGGGTGGAGGG + Intronic
1088747498 11:112816726-112816748 CCCCAAAAGCCAAAACTGAACGG + Intergenic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1090958619 11:131536129-131536151 CCCCAACAGCCATAGGAGGAGGG + Intronic
1092347079 12:7724276-7724298 CCCCAAAAGCAAAAGGTTGTGGG + Intergenic
1092939001 12:13390263-13390285 CCCCAAATTCGGGAGGTGGAAGG + Intergenic
1095342967 12:41114015-41114037 CCCAAAAAACCAAAGGTGGGTGG - Intergenic
1095697730 12:45159461-45159483 CCCCAAATGCCAGGGGTCCATGG - Intergenic
1095843542 12:46721079-46721101 CCCAAAATACCAATGCTGGAAGG + Intergenic
1098501935 12:71202944-71202966 CCACAAATGCAAAAGCTGGGTGG + Intronic
1100930906 12:99608606-99608628 CCCCAAATGCCAAAGATATCAGG + Intronic
1103811203 12:123615302-123615324 CCGCAAATTGCAAAGGTGGGTGG + Exonic
1104809998 12:131614430-131614452 CCAGAAATGCCAAGGGAGGAGGG - Intergenic
1107310825 13:39075281-39075303 CCTCAAAAGCCAAAGATCGAGGG + Intergenic
1110022174 13:70489603-70489625 CCCCACATGTCAAAGGAGGGAGG + Intergenic
1110852879 13:80264463-80264485 CCCCACATGTCAAAGGAGGGAGG - Intergenic
1114006635 14:18320501-18320523 CCCCAAATGCAAAAGTGGCATGG - Intergenic
1114940802 14:27607836-27607858 CCAAAGATGGCAAAGGTGGAAGG - Intergenic
1118495679 14:66306120-66306142 CCTCAAATGTCTAAGTTGGAGGG - Intergenic
1118772719 14:68952839-68952861 CCCCAAATGGAAAGTGTGGATGG + Intronic
1119562378 14:75601315-75601337 GCCCTAATGCCCAAGCTGGAAGG - Intronic
1121556390 14:94840973-94840995 TACCAAATGACAGAGGTGGAAGG - Intergenic
1125245346 15:37630407-37630429 CCCTACATGGCAAAGGTGAAGGG + Intergenic
1125840524 15:42797005-42797027 CTCCAAATGTCAGAGGTAGAGGG + Intronic
1126660193 15:51025680-51025702 TCCCAGAGCCCAAAGGTGGAGGG + Intergenic
1126955452 15:53928456-53928478 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
1129385711 15:75195284-75195306 CCCCAGATGCAAAAGGGAGAAGG + Intergenic
1129971432 15:79780901-79780923 TCCCAAATAGCAAAGGTGGCAGG - Intergenic
1130031216 15:80316135-80316157 CCCTAAATGTCAGAGCTGGAAGG + Intergenic
1130944736 15:88542297-88542319 ACCCAAATTCCTCAGGTGGAAGG + Intronic
1131367314 15:91852530-91852552 CCCCCAATGGCCCAGGTGGAAGG + Intergenic
1134434343 16:14241940-14241962 TGCCCAATGCCAAAGGAGGATGG - Intronic
1134605812 16:15570385-15570407 CCCCAAATGTCAATAGTTGAAGG - Intronic
1135281441 16:21156845-21156867 CCAAAAATGCCAGAGGTGGAAGG + Intronic
1137291989 16:47058067-47058089 ACCCAATTCCCACAGGTGGAGGG + Intergenic
1137776193 16:51056327-51056349 CCCCAAATGCCCAAGAAGAAGGG - Intergenic
1138205160 16:55119160-55119182 CCCCAGCTGCCCAAGGTTGAGGG - Intergenic
1139660637 16:68418548-68418570 CCCCAAAAGGCAAATGGGGAAGG + Intronic
1140533227 16:75684584-75684606 GCCCAACTGCCAAAGGTTGGGGG + Intronic
1144844468 17:18209236-18209258 CCCCAAATGCTAGACTTGGAAGG - Exonic
1145973242 17:28969310-28969332 CCCCAAATGCAAGAGGGTGAAGG - Intronic
1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG + Intronic
1151835611 17:76581014-76581036 CCCCAGCAGCCACAGGTGGAGGG + Intronic
1155050184 18:22139831-22139853 CCCCAGATACCCATGGTGGAGGG + Intergenic
1156322638 18:36041682-36041704 CCCACAATGCCACAGGCGGAAGG - Intronic
1156402706 18:36755146-36755168 CCCGAATTGCATAAGGTGGATGG - Exonic
1158455157 18:57599615-57599637 ACACAAGTGCCAAAGGTGGAGGG + Intergenic
1158760023 18:60373892-60373914 TACCCAATTCCAAAGGTGGATGG - Intergenic
1165095394 19:33407220-33407242 CCCCACAGGGCAGAGGTGGAGGG - Intronic
1165218101 19:34291537-34291559 ACCCCAAGGCGAAAGGTGGAAGG + Intronic
1166252514 19:41581128-41581150 GCCCTAATGCCCAAGCTGGAAGG + Intronic
1166352534 19:42206827-42206849 GGCCGAATGCCAGAGGTGGAAGG - Intronic
1167295246 19:48645765-48645787 CCCCAAATGCCAAAGCAGCCAGG + Exonic
1168104803 19:54160188-54160210 CTCCAGATACCAAAGCTGGAAGG + Exonic
927711457 2:25328835-25328857 CCCCAGATCCCCAAGGTGAAGGG + Intronic
930574610 2:53130960-53130982 AGACAAATGCCAAAGGTGGAAGG - Intergenic
930745975 2:54884104-54884126 CCTCAGATGCCACAGGTTGAGGG + Intronic
930785541 2:55268540-55268562 ACCCAAATGTCAAAACTGGAAGG + Intronic
932288526 2:70555522-70555544 CCCCCAAAGTCAGAGGTGGAGGG + Intergenic
935059517 2:99595382-99595404 CCACGAATTCGAAAGGTGGAAGG - Intronic
936092082 2:109507939-109507961 TCCCAAATGCCAAGAGTGGTGGG + Intergenic
937472982 2:122189584-122189606 CCCCAAATAGAAAAGGTGGATGG - Intergenic
937610245 2:123852679-123852701 GCCCTAATGCCCAAGCTGGAAGG + Intergenic
938529927 2:132174973-132174995 CCCCAAATGCAAAAGTGGCATGG + Intronic
938745668 2:134275974-134275996 CCCCAAATGTCAATTGTGGCAGG + Intronic
940977162 2:159958870-159958892 CCCCAAATGTCAATAGTGTAAGG + Intronic
940989506 2:160083751-160083773 ACCCATATGCCAAAGATGAAGGG - Intergenic
941480531 2:166004000-166004022 CCAGTAATGACAAAGGTGGAGGG + Intronic
941777306 2:169407088-169407110 CCTGAAATTCCAAAGGCGGATGG - Intergenic
942316244 2:174699010-174699032 CACCATATGCCCAAGGTGGTTGG - Intergenic
942969731 2:181943463-181943485 CCCCAAATGCCAAATGCAAAAGG - Intergenic
944502120 2:200372542-200372564 GCAAAAATGCCAAAGGGGGAAGG - Intronic
945266157 2:207893309-207893331 CCCCAAAACCCAAAGAAGGAAGG - Intronic
946380763 2:219347200-219347222 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
947165828 2:227261009-227261031 CCCAAGATTCCAAAAGTGGATGG + Intronic
947303815 2:228720882-228720904 TCCCAACTGCCAAATGTGAAAGG - Intergenic
1168867325 20:1098689-1098711 CCCCAGATGACAGAGGTAGATGG + Intergenic
1168898267 20:1338668-1338690 CCCCAAAGGCCATACCTGGAAGG - Intronic
1171022907 20:21602842-21602864 CCCCAAATTCCCAAGCTGGAAGG + Intergenic
1171379644 20:24724686-24724708 CCCCAAATGCCAAAAGTGCCAGG - Intergenic
1172330885 20:34075391-34075413 CCCCATATGCCAAATGAGGATGG - Intronic
1172567961 20:35945730-35945752 CCCCAAATGCCAGAGCTTTAGGG + Intronic
1172842967 20:37913133-37913155 GACCAAATGGCAAAGCTGGAGGG + Intronic
1174904105 20:54532083-54532105 CTCCAACTTCCAGAGGTGGAGGG - Intronic
1175549305 20:59806324-59806346 CCCCAAACGTCAACGGTGGCGGG - Intronic
1176259392 20:64171654-64171676 CTCCAGATGCCAGAGGTGTAGGG - Intronic
1176259413 20:64171732-64171754 CTCCAGATGCCAGAGGTGTAGGG - Intronic
1176259446 20:64171848-64171870 CTCCAGATGCCAGAGGTGTAGGG - Intronic
1176259458 20:64171888-64171910 CTCCAGATGCCAGAGGTGTAGGG - Intronic
1178180133 21:30150518-30150540 CCCAAAATGGCCAAGATGGAAGG + Intergenic
1178321577 21:31610166-31610188 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
1179041392 21:37805434-37805456 CACCAAACGCCAAATGGGGAAGG - Intronic
1180431144 22:15251312-15251334 CCCCAAATGCAAAAGTGGCATGG - Intergenic
1182980439 22:34665697-34665719 CCCCGCATGGCAAAGCTGGAGGG + Intergenic
1183220945 22:36512638-36512660 CTCCAAATGCCCAAGGTGCTGGG + Intronic
1183378850 22:37480601-37480623 CTCCACATGCCAAGGGTGGGCGG + Intronic
1183510347 22:38230911-38230933 CCGCACATGCCATAGGCGGAGGG + Intronic
1184233186 22:43169310-43169332 CCACAAATGCCCAGGGTGGAAGG + Intronic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
950130880 3:10546016-10546038 CCCCAAATGTCAATGTTGGTGGG + Intronic
950600630 3:14032199-14032221 CTACAGATGGCAAAGGTGGAAGG + Intronic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
952281366 3:31926441-31926463 CCCCAAATGCCAATAGTGCTGGG + Intronic
952878512 3:37968355-37968377 CCCCAAAAGAAAAAGGGGGAAGG + Intronic
953260570 3:41334911-41334933 CCCCAAATGTCATAGCTAGAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954828938 3:53401618-53401640 CCCTAAATTCCAAAGCTGCAAGG - Intergenic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
959980120 3:112506751-112506773 CCCAAAATGTCAACGGTGCAAGG + Intergenic
961265396 3:125637584-125637606 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
962425634 3:135266851-135266873 CCCCAAATGCCAGTGGAGTATGG + Intergenic
963511411 3:146252520-146252542 GCCCTAATGCCCAAGCTGGAAGG + Intergenic
966119867 3:176509529-176509551 ACCCACATGCCAAAGATGAAGGG - Intergenic
967512416 3:190326860-190326882 CCCCAAATGACACAAGTGAAAGG - Intronic
971715639 4:30172089-30172111 ACCCACATGACAAAGGAGGAAGG - Intergenic
977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG + Intergenic
978011552 4:103691665-103691687 GCCCTAATGCCCAAGCTGGAAGG + Intronic
980367925 4:131830569-131830591 CACCAAATGCAAAAGGTACATGG + Intergenic
981917831 4:150053945-150053967 GCCCCAATGCCCAAGCTGGAAGG + Intergenic
984363414 4:178767608-178767630 TCCCTAATGCCCAAGCTGGAAGG + Intergenic
984955889 4:185045191-185045213 CCCCTAATGCCCAAGCTGGAAGG - Intergenic
985050008 4:185980602-185980624 CCCCTAATGCCTAAGCTGGAAGG + Intergenic
985319087 4:188688824-188688846 CCTCAGATCCCACAGGTGGAGGG - Intergenic
986650568 5:9959489-9959511 TCCCTATTGCCAAAGATGGAGGG + Intergenic
986675048 5:10176861-10176883 CCCTAAATGTGGAAGGTGGAGGG + Intergenic
988128239 5:27071613-27071635 CCCCAAATCCCAGAAGTGGGGGG - Intronic
988337177 5:29921983-29922005 ACCCACATGGCAAAGGTGAAGGG - Intergenic
990104265 5:52237141-52237163 GCCATAAAGCCAAAGGTGGAGGG - Intergenic
990248130 5:53883902-53883924 TCCCAAATGCTAAAGTTGAAAGG + Intergenic
990307232 5:54505314-54505336 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
991570474 5:68048373-68048395 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
992542833 5:77781430-77781452 CCCTAAATCTCAAAGGTGGATGG - Intronic
995038481 5:107562006-107562028 CCTCAACTGCCAAGGGTGGCAGG - Intronic
995715604 5:115079386-115079408 ACCCACATGCCAAAGATGAAGGG - Intergenic
997029240 5:130104524-130104546 CACCAAAAGCCAAAGGTTCAGGG + Intronic
997712663 5:136018917-136018939 TCCCAAAAGTCAAAGGAGGATGG + Intergenic
998163614 5:139827847-139827869 CCCCACATGTCAAGGGAGGAAGG - Intronic
1000599886 5:163259796-163259818 CCCCAAATGCCAATAGTGCCAGG + Intergenic
1001420896 5:171586518-171586540 CCTCAAATGACAGAGGAGGAGGG - Intergenic
1001671653 5:173478692-173478714 CCCTAGATGCAAAAGATGGAAGG - Intergenic
1002637663 5:180616168-180616190 CCCAAGATGCCTAAGGTGGGGGG + Intronic
1005427477 6:25717657-25717679 CCCCAAATGCTAAAAGTGCCAGG - Intergenic
1006404161 6:33834400-33834422 CCCCACATGGCTAAGGGGGAGGG - Intergenic
1006569730 6:34992289-34992311 CATCAAATGCCAGAGCTGGAAGG - Intronic
1007177856 6:39909009-39909031 CCCCAAATGACAAGGGTGAGTGG + Intronic
1007386283 6:41522381-41522403 CCCCAAATCTCAAAGCTGGAAGG - Intergenic
1007650538 6:43417747-43417769 CCCCAATTCCCCAAAGTGGAAGG + Intergenic
1011886590 6:92104047-92104069 CCCCACATGTCAAGGGAGGAAGG + Intergenic
1013370494 6:109466542-109466564 CCACAAATGCCACAGGAGTATGG + Exonic
1013600523 6:111700033-111700055 TCCCAAACACCAAAGATGGAAGG - Intronic
1015347614 6:132178551-132178573 TCCCTAATGCCCAAGCTGGAAGG + Intergenic
1016685689 6:146879913-146879935 CCTCAAATTCCAAAGGTAGTTGG - Intergenic
1017102846 6:150863921-150863943 CCCCAGTTTCCAAAGGTTGAAGG + Intergenic
1018428247 6:163702337-163702359 TCCCAAATTCCCATGGTGGATGG - Intergenic
1019558784 7:1645625-1645647 CCCCAAAGCTCAAGGGTGGAGGG + Intergenic
1022344287 7:29499311-29499333 CCCAAACTGCCCAAGGAGGAAGG + Intronic
1024167402 7:46748648-46748670 CCCCAAATGCCAAGAATGCAAGG - Intronic
1024328606 7:48133963-48133985 CCCCAACTGTTAATGGTGGAGGG + Intergenic
1025035137 7:55589086-55589108 CCTCAAATGCCAAAGCTGTCTGG + Intergenic
1026639216 7:72109737-72109759 CCCCAATTGCCAAGGATGGGAGG + Intronic
1028309994 7:89319135-89319157 GCCCTAATGCCCAAGCTGGAAGG - Intronic
1029695721 7:102211939-102211961 CCCCAAGAGCCACAGGAGGAAGG + Intronic
1031688948 7:124765162-124765184 CACAAGATGCCAAAGGAGGAAGG - Exonic
1033783709 7:144704127-144704149 CCCCATGTGTCAAAGGTGGGAGG + Intronic
1034942346 7:155238590-155238612 CCCCTAATGCCCAGGCTGGAAGG - Intergenic
1035588403 8:794660-794682 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
1037588704 8:20295506-20295528 TCCCAAATGGCAGAGATGGATGG - Intronic
1040109022 8:43557950-43557972 ACCCAAATTCCTCAGGTGGAAGG - Intergenic
1040396740 8:47007800-47007822 ACCCACATGCCAAAGGTGAAGGG - Intergenic
1040608807 8:48962381-48962403 GCCCTAATGCCGAAGCTGGAAGG + Intergenic
1040709487 8:50171057-50171079 CATCAGATGACAAAGGTGGAAGG - Intronic
1042383884 8:68150885-68150907 CACCAAAGGCCAAAAGAGGAAGG - Intronic
1043165130 8:76893880-76893902 CTCCAAATGCCAAACCTGGAAGG - Intergenic
1043175189 8:77016441-77016463 CCCCAGATGCCAAAAGTGCCTGG - Intergenic
1045394178 8:101744144-101744166 CCCTGAATGCCAAAGATGGTAGG - Intronic
1046182998 8:110676932-110676954 CCATAAATGCCAAGGGAGGACGG + Intergenic
1049328297 8:142035631-142035653 CCCCAGATGTCAAAGGTCAAAGG + Intergenic
1050908927 9:11041339-11041361 ACCCATTGGCCAAAGGTGGACGG - Intergenic
1051707596 9:19896952-19896974 CGCCAAATGAGAAAAGTGGATGG - Intergenic
1053632276 9:39956277-39956299 CACCAAATGCAAAAGGTACATGG + Intergenic
1053773484 9:41507253-41507275 CACCAAATGCAAAAGGTACATGG - Intergenic
1054211612 9:62294420-62294442 CACCAAATGCAAAAGGTACATGG - Intergenic
1054313375 9:63554427-63554449 CACCAAATGCAAAAGGTACATGG + Intergenic
1055368329 9:75570176-75570198 CCCCAAAAGCCAGAGGCAGAAGG - Intergenic
1055609201 9:78004144-78004166 CCCGAGAAGCCAAAGGTGGCAGG + Intronic
1055778583 9:79794205-79794227 ACCCAAATGACAATGGTGTAGGG + Intergenic
1056911463 9:90704693-90704715 CCCCAAATGTCTAAACTGGAGGG + Intergenic
1057266667 9:93621991-93622013 CCCCAAATGCCCCAGGTGGTTGG - Intronic
1058176760 9:101744644-101744666 CCCCAAATGAAAAAGGTACAGGG - Intergenic
1058383876 9:104410128-104410150 CCGCATATGGCAAAGGGGGAAGG - Intergenic
1059175780 9:112169048-112169070 CACCAAATTCCAGAGGTGGAAGG + Intronic
1059212658 9:112528312-112528334 CCCCAAATGACTGAGGTGGAGGG - Intronic
1059590857 9:115659964-115659986 CCCCAAATGTCAGAGTTGAAAGG - Intergenic
1061642679 9:131971599-131971621 CCCCAAGTGCCAAAAGAGGGTGG + Intronic
1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG + Exonic
1186461505 X:9751983-9752005 CCCCAGAGGCCATAGCTGGATGG + Intronic
1188839253 X:34994964-34994986 CCCCACATGCCAAGGGAGAAAGG + Intergenic
1190614875 X:52220146-52220168 GCCCTAATGCCCAAGCTGGAAGG + Intergenic
1191069305 X:56382986-56383008 CCCCAAAAGCCAAAGATGTCAGG + Intergenic
1191613713 X:63145400-63145422 CAGAAAATGCCAAATGTGGACGG + Intergenic
1191622583 X:63233527-63233549 CAGAAAATGCCAAATGTGGACGG - Intergenic
1192687806 X:73325023-73325045 GCCCTAATGCCCAAGCTGGAAGG - Intergenic
1193140198 X:78018988-78019010 CCCCACATGCCAAGGGAGGGAGG - Intronic
1194841063 X:98742708-98742730 CACAAAATTCCCAAGGTGGAAGG - Intergenic
1197042670 X:121958336-121958358 CTCCAGATGGCAAAGGGGGAAGG - Intergenic
1199347174 X:146755250-146755272 CACAAAATGCCAAAGCTGGAAGG + Intergenic
1202019439 Y:20449595-20449617 CCCCTAACGCCCAAGCTGGAAGG - Intergenic