ID: 1146581827

View in Genome Browser
Species Human (GRCh38)
Location 17:34045224-34045246
Sequence GGGAATATTACTACCTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146581827_1146581839 30 Left 1146581827 17:34045224-34045246 CCAACACAGGTAGTAATATTCCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1146581839 17:34045277-34045299 CAAACTAAAATACTACCCATGGG 0: 1
1: 0
2: 0
3: 11
4: 193
1146581827_1146581838 29 Left 1146581827 17:34045224-34045246 CCAACACAGGTAGTAATATTCCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1146581838 17:34045276-34045298 GCAAACTAAAATACTACCCATGG 0: 1
1: 0
2: 1
3: 8
4: 157
1146581827_1146581830 7 Left 1146581827 17:34045224-34045246 CCAACACAGGTAGTAATATTCCC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1146581830 17:34045254-34045276 ATCCTCCCCATCCCCATGTAAGG 0: 1
1: 0
2: 1
3: 22
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146581827 Original CRISPR GGGAATATTACTACCTGTGT TGG (reversed) Intronic
901539636 1:9907561-9907583 GGGAACATTACTGCCACTGTTGG - Intronic
904672085 1:32173599-32173621 GATGATATTACTACCTCTGTGGG - Exonic
909284734 1:73800955-73800977 TGGAATATTAATACCTGCATTGG - Intergenic
916468259 1:165093689-165093711 GGGAATTTTTCTACCTGTGCAGG + Intergenic
916878075 1:168991775-168991797 GTGATTATTTCTACCTGAGTAGG + Intergenic
918295981 1:183157777-183157799 GGGTATATTTTTAGCTGTGTTGG + Intergenic
1073356861 10:102861942-102861964 GAGAATGTTACTATCTGTTTGGG + Intronic
1079783201 11:24636288-24636310 GGGAATGTTTTTACCAGTGTAGG - Intronic
1085096351 11:73763396-73763418 GGGAACAGTACCACCTGTCTAGG - Intergenic
1086920214 11:92578216-92578238 GTGAATATTATTATCAGTGTTGG - Intronic
1089910481 11:122094422-122094444 GAGAATATTAGTTCCTTTGTTGG - Intergenic
1090672831 11:128961656-128961678 GGGAATAATAGTACCTATGAAGG - Intergenic
1092964375 12:13627384-13627406 GGCAATATAACTATCTTTGTGGG + Intronic
1097529069 12:60776189-60776211 GGGAGTATAACTCTCTGTGTAGG + Intergenic
1104955403 12:132462579-132462601 TAGAATATTACTAGCAGTGTTGG - Intergenic
1111442245 13:88295045-88295067 TGAAATATGACTACCAGTGTTGG + Intergenic
1112669830 13:101622303-101622325 GGTGTTATTACTAGCTGTGTAGG - Intronic
1134263308 16:12671522-12671544 GGGACTATAGCTACCTGTGCTGG + Intronic
1137442769 16:48510625-48510647 GGGAATAATACCACCTATCTTGG - Intergenic
1137779093 16:51081965-51081987 GGAGAAAATACTACCTGTGTAGG + Intergenic
1138090646 16:54171117-54171139 GGGAACATTAATCCCTGTTTGGG - Intergenic
1141057469 16:80831987-80832009 GTGCATATCACTACCTGTATTGG - Intergenic
1142495471 17:304280-304302 GGGAATAATAATACCTATCTCGG - Intronic
1146581827 17:34045224-34045246 GGGAATATTACTACCTGTGTTGG - Intronic
1147015179 17:37486151-37486173 GGGAACATTACAACATGTCTAGG - Intergenic
1149725049 17:58884751-58884773 GGGGATAATACTTCCTTTGTAGG + Intronic
1151229852 17:72676652-72676674 GGGAATTTTTATATCTGTGTAGG - Intronic
1154948787 18:21187623-21187645 GGGAATTTTAGTACCTTTGGGGG - Intergenic
1156321654 18:36030794-36030816 GGTAAAATTTCTACCTGTGGTGG + Exonic
1156363345 18:36403739-36403761 GGGAATATTCGTAACTGTATTGG + Intronic
1156853311 18:41753684-41753706 GTAAAAATGACTACCTGTGTTGG - Intergenic
1158971323 18:62669449-62669471 GGGTGTATTACTACCACTGTTGG - Intergenic
1162732783 19:12728977-12728999 GGGCATCTTAAAACCTGTGTGGG + Intergenic
1167393594 19:49212544-49212566 GTGATTATTACTACTTGGGTTGG - Intergenic
926773212 2:16396661-16396683 GAGATTATTGCTATCTGTGTGGG + Intergenic
933746023 2:85571936-85571958 GGGAATATTACCACCTGAAAAGG - Intronic
935573916 2:104689559-104689581 GGGAATAGTCATACCTGTCTAGG - Intergenic
936791619 2:116159403-116159425 GGGAATATTGATGCTTGTGTGGG + Intergenic
944752633 2:202726732-202726754 GGGAATAATAATACCTGTCTCGG + Intronic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
945665069 2:212730890-212730912 GGTCATATTATTACTTGTGTTGG - Intergenic
947940268 2:234048065-234048087 GGGATTTGTATTACCTGTGTTGG + Intergenic
1178183621 21:30193577-30193599 AGGAATAGAAATACCTGTGTAGG - Intergenic
1181879794 22:25969076-25969098 GGGGAAATTACTACCTCTGTGGG + Intronic
949715995 3:6931976-6931998 GGGAATATTGCTGCGTGGGTAGG + Intronic
949777108 3:7645794-7645816 GGGAAGATGACCACCTGTGGGGG - Intronic
951335844 3:21420738-21420760 GTGAATAGTACTACCCGTGCTGG - Exonic
952530274 3:34255959-34255981 CTGAATAACACTACCTGTGTGGG + Intergenic
953345797 3:42174306-42174328 TGTAATTTTATTACCTGTGTTGG - Intronic
955550370 3:60078339-60078361 GGATATAATACTACCTCTGTAGG + Intronic
956435067 3:69227043-69227065 GAGAAAAATACCACCTGTGTTGG + Intronic
957460135 3:80506491-80506513 GGGAATACTATTATCTGTTTAGG + Intergenic
957837291 3:85612492-85612514 GCAAATATTACTAACTGTATTGG - Intronic
960122003 3:113956568-113956590 GGGACTATTACTACTTGGTTAGG + Intronic
964365587 3:155947761-155947783 AGGAATAATACTGCCTCTGTGGG + Intergenic
965349961 3:167599658-167599680 TGGAATATTACTATCTCTGGTGG - Intronic
965349972 3:167599823-167599845 TGGAATATTACTATCTGTGGTGG - Intronic
967671053 3:192235673-192235695 GGGAATTTTTGTACCTCTGTGGG + Intronic
974808512 4:66915252-66915274 GTGAATAGCACTCCCTGTGTTGG + Intergenic
974859525 4:67502749-67502771 GGCAATATTACTACCTGATCTGG - Intronic
975836327 4:78425943-78425965 AGGAATATTACTATGTGCGTGGG - Intronic
978535867 4:109761861-109761883 GGGAATATAACTACCTCACTGGG + Intronic
978652283 4:111020384-111020406 GTGAATATTACTTCTTCTGTAGG + Intergenic
979447926 4:120836814-120836836 GGGAATATTACTACTACTTTAGG + Intronic
979997550 4:127450203-127450225 GGGAATATTATTAAATATGTAGG - Intergenic
981418400 4:144520172-144520194 GGGAACACCACTACCTGTATTGG - Intergenic
986627069 5:9732168-9732190 GGGAATATTCCTCCCTGGTTTGG - Intergenic
989366503 5:40661963-40661985 TAGAATATTACTACATATGTGGG - Intergenic
990758984 5:59107728-59107750 TGTAATATTACTACTTGTGTAGG + Intronic
994600669 5:101900247-101900269 GGAAACATAACTACCTTTGTTGG - Intergenic
996429909 5:123362547-123362569 GGGAATATTACCTGCTATGTAGG + Intronic
996877989 5:128261046-128261068 GGGAATAATAATACCTCTGAAGG - Intronic
1000166356 5:158652973-158652995 GGAAATATAACTACCTATGCTGG + Intergenic
1000646891 5:163770049-163770071 GAGAGTATTTCTCCCTGTGTGGG + Intergenic
1008154635 6:47998619-47998641 AGGAAAATTACTAGCAGTGTTGG + Intronic
1009227923 6:61034694-61034716 GAGAATATTACTCCCATTGTCGG - Intergenic
1012712348 6:102623492-102623514 GGGCATATTGCTATTTGTGTAGG - Intergenic
1019177661 6:170168537-170168559 GGGATTGTTACTGCCTGTTTTGG + Intergenic
1022014234 7:26335365-26335387 GGAAATATTACTACATTTGGTGG - Intronic
1022198228 7:28090606-28090628 GGGAGTACTAGTACCTGTGTTGG - Intronic
1023014741 7:35955881-35955903 GGAAATATTACTCCCTGTCCAGG - Intergenic
1026063753 7:67050267-67050289 TGGGATATTACTATCAGTGTGGG + Intronic
1026714594 7:72777193-72777215 TGGGATATTACTATCAGTGTGGG - Intronic
1027731901 7:81885028-81885050 CAGGAAATTACTACCTGTGTGGG + Intergenic
1028718933 7:94006956-94006978 GGGAATATTACTAGCACTGATGG + Intergenic
1031689937 7:124775189-124775211 ATGAATATTAGTACCAGTGTTGG - Intergenic
1033609887 7:142954735-142954757 GTGAGTATTACAACCAGTGTGGG + Intronic
1035857021 8:2986470-2986492 GAAAATATTAATATCTGTGTAGG - Intronic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1039948195 8:42147900-42147922 GGAAACATTACTCCCAGTGTGGG + Intergenic
1058401360 9:104623937-104623959 GGGAATAGTATTATCTGTTTAGG - Intergenic
1059150473 9:111945090-111945112 GGGAAAATGACAACCTGTATTGG + Intergenic
1059916973 9:119114820-119114842 GGGAATTTGAATACCTGTGCTGG + Intergenic
1192027144 X:67465937-67465959 CAGAATATTACCACCTGTGGTGG + Intergenic
1193512469 X:82420711-82420733 GTAAATATTACTACATTTGTTGG - Intergenic
1194105911 X:89766951-89766973 AGGAATAAGACTACCTGTGATGG + Intergenic
1194687331 X:96938095-96938117 GGGAATATTACTTCCAGCTTTGG - Intronic
1195732458 X:107980896-107980918 GGGAAAATTGCTTCCTCTGTGGG - Exonic
1196120648 X:112046753-112046775 GTGAATAATAATAACTGTGTAGG + Intronic
1198831109 X:140751741-140751763 GTGAATATTACTAAATGTCTTGG + Intergenic
1200457867 Y:3414810-3414832 AGGAATAAGACTACCTGTGATGG + Intergenic