ID: 1146582760

View in Genome Browser
Species Human (GRCh38)
Location 17:34053763-34053785
Sequence CTGCATATGATTAAGCAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 242}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146582760_1146582770 30 Left 1146582760 17:34053763-34053785 CCCACCTGCTTAATCATATGCAG 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1146582770 17:34053816-34053838 AGGTGGAGGAAACCAAATATAGG 0: 1
1: 0
2: 1
3: 21
4: 208
1146582760_1146582765 -9 Left 1146582760 17:34053763-34053785 CCCACCTGCTTAATCATATGCAG 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1146582765 17:34053777-34053799 CATATGCAGGTACTGGCATTTGG 0: 1
1: 0
2: 4
3: 23
4: 216
1146582760_1146582768 16 Left 1146582760 17:34053763-34053785 CCCACCTGCTTAATCATATGCAG 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1146582768 17:34053802-34053824 GAAGTCCATCTTTAAGGTGGAGG 0: 1
1: 0
2: 1
3: 21
4: 259
1146582760_1146582766 10 Left 1146582760 17:34053763-34053785 CCCACCTGCTTAATCATATGCAG 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1146582766 17:34053796-34053818 TTGGAAGAAGTCCATCTTTAAGG 0: 1
1: 0
2: 0
3: 20
4: 155
1146582760_1146582767 13 Left 1146582760 17:34053763-34053785 CCCACCTGCTTAATCATATGCAG 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1146582767 17:34053799-34053821 GAAGAAGTCCATCTTTAAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146582760 Original CRISPR CTGCATATGATTAAGCAGGT GGG (reversed) Intronic
900738673 1:4316996-4317018 CAGCATATGTTTAGGCAGATGGG + Intergenic
903127746 1:21259210-21259232 CTCCACATGTTTAAGAAGGTTGG + Intronic
905263884 1:36738120-36738142 CTGCAGAGGATGGAGCAGGTGGG + Intergenic
908306257 1:62821287-62821309 CTGTAAATGATTATGAAGGTAGG + Intronic
908519537 1:64927843-64927865 CAGCATATGGTTGGGCAGGTTGG + Intronic
909311629 1:74157954-74157976 GTGTATATGAGAAAGCAGGTTGG - Intronic
909734278 1:78936290-78936312 CTGCATATGATTCAAATGGTAGG - Exonic
909760972 1:79286660-79286682 CTGAATATAATTCAGTAGGTGGG + Intergenic
912905143 1:113697597-113697619 GTGCATGTGAACAAGCAGGTGGG + Exonic
916869127 1:168893408-168893430 CTGGATAGGATTAAGCTGGCAGG - Intergenic
917275792 1:173330547-173330569 CAGGATATGACTAAGCAAGTTGG - Intergenic
918146391 1:181759643-181759665 CTGCACACAATGAAGCAGGTTGG - Intronic
918709055 1:187704283-187704305 CTGTATATGACTAATCTGGTGGG + Intergenic
919128080 1:193420864-193420886 CTGTTTATGATTAAGCTGGAAGG + Intergenic
1066785571 10:39000410-39000432 CTTCTTTTGATTCAGCAGGTTGG - Intergenic
1066787535 10:39021973-39021995 TTTCATTTGATTCAGCAGGTTGG - Intergenic
1066790303 10:39054955-39054977 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
1066792860 10:39085143-39085165 TTTCTTATGATTCAGCAGGTTGG + Intergenic
1066793038 10:39087300-39087322 CTTTATTTGATTCAGCAGGTTGG + Intergenic
1066794307 10:39102041-39102063 TTTCTTTTGATTAAGCAGGTGGG + Intergenic
1066794497 10:39104315-39104337 CTTTTTTTGATTAAGCAGGTTGG + Intergenic
1066795510 10:39115705-39115727 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
1068180167 10:53507542-53507564 CTGCATATTATTCAGTGGGTTGG + Intergenic
1068726574 10:60309617-60309639 CTGGAGATGAATAAGGAGGTTGG + Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1070261655 10:74862002-74862024 TTGCATTTGGTTAAGCAGTTTGG + Intronic
1070774095 10:79099817-79099839 GTGCATTTGAAAAAGCAGGTAGG + Intronic
1074946211 10:118283334-118283356 CTGCATATGGTCAAGCATTTGGG - Intergenic
1082265621 11:50114818-50114840 TTTCTTTTGATTAAGCAGGTTGG - Intergenic
1082290466 11:50363752-50363774 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1082293116 11:50404903-50404925 CTTCATTTGATTAATCAGTTTGG + Intergenic
1082547101 11:54345621-54345643 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082547250 11:54347668-54347690 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082547406 11:54349715-54349737 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082547556 11:54351764-54351786 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082547712 11:54353807-54353829 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082547875 11:54355855-54355877 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082548033 11:54357902-54357924 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082548340 11:54361996-54362018 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082548497 11:54364044-54364066 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082548658 11:54366090-54366112 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082548816 11:54368138-54368160 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549050 11:54371212-54371234 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549201 11:54373256-54373278 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549506 11:54377352-54377374 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549656 11:54379400-54379422 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549806 11:54381448-54381470 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082549958 11:54383495-54383517 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082550096 11:54385541-54385563 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082550411 11:54389636-54389658 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082550564 11:54391684-54391706 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082550718 11:54393732-54393754 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082550874 11:54395780-54395802 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551020 11:54397828-54397850 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551172 11:54399876-54399898 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551332 11:54401924-54401946 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551486 11:54403972-54403994 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551790 11:54408067-54408089 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082551948 11:54410115-54410137 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552113 11:54412164-54412186 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552265 11:54414210-54414232 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552414 11:54416257-54416279 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552563 11:54418301-54418323 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552715 11:54420350-54420372 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082552877 11:54422398-54422420 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553029 11:54424445-54424467 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553227 11:54527062-54527084 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553378 11:54529110-54529132 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553533 11:54531157-54531179 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553689 11:54533204-54533226 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553846 11:54535249-54535271 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082553998 11:54537296-54537318 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1082554141 11:54539338-54539360 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1086597320 11:88588543-88588565 CTGTATATGGGTAAGCAGGTAGG - Intronic
1093107394 12:15105069-15105091 CTCCATATGTTCAAGAAGGTAGG - Intergenic
1094868306 12:34567100-34567122 CTTCATTTGGTTAAGCAGTTTGG - Intergenic
1094875397 12:34636187-34636209 CTGCATTTGATTGAGAAGTTTGG + Intergenic
1095060117 12:37676977-37676999 TTTCATTTGATTAAGCAGTTTGG - Intergenic
1095080496 12:37993959-37993981 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095454652 12:42370272-42370294 CTGCAAATGCTGAGGCAGGTAGG + Intronic
1099422195 12:82474512-82474534 CTGCAGATGATTAAGTCTGTGGG + Intronic
1099459752 12:82907762-82907784 TAGCATATGATTAAGCATGAAGG + Intronic
1099901922 12:88721781-88721803 ATGCATTTGAGTAAGAAGGTGGG - Intergenic
1101114877 12:101522311-101522333 TTGCATATGATGATGCAGTTTGG - Intergenic
1107094372 13:36518758-36518780 CAGCATATGAATTGGCAGGTGGG + Intergenic
1109081954 13:57914924-57914946 CTGAAATTGATTAAGCAGATTGG + Intergenic
1111887434 13:94039900-94039922 CTGCATTTAATTAAAGAGGTTGG - Intronic
1112036574 13:95502308-95502330 CTTCCTATAATTAAGCAGGTGGG - Intronic
1113516720 13:110908648-110908670 CTGGAGATGAGTCAGCAGGTAGG + Intronic
1114001516 14:18255194-18255216 TTTCTTATGATTAAGCAGTTTGG - Intergenic
1114967608 14:27982669-27982691 CTGCATATAATAAAGCAGTATGG - Intergenic
1115405514 14:33011264-33011286 CTGAATTTGAATAAGCGGGTTGG - Intronic
1117218534 14:53577686-53577708 CTGTATATTACTAAGCAGATGGG - Intergenic
1125647115 15:41282188-41282210 CTGCACATGAATGAGGAGGTGGG - Intergenic
1129513142 15:76139604-76139626 CTGCAAATGATGTAGCTGGTGGG + Intronic
1130003693 15:80071486-80071508 CTGCTTATGTTTTAGCAGCTTGG - Intronic
1130846094 15:87747478-87747500 CTAAATATGATAATGCAGGTTGG - Intergenic
1131588813 15:93725715-93725737 TTGCATATGATTACTCATGTAGG - Intergenic
1131995566 15:98129612-98129634 CTGCATTTTAATAGGCAGGTGGG + Intergenic
1136743389 16:32560451-32560473 TTTCTTATGATTCAGCAGGTTGG + Intergenic
1136746003 16:32591987-32592009 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1137073409 16:35930558-35930580 TTGCTTTTGATTAATCAGGTTGG - Intergenic
1137073643 16:35934136-35934158 GTTCTTATGATTCAGCAGGTTGG - Intergenic
1139141199 16:64264624-64264646 CTGCATATGATTTTTCAGTTGGG + Intergenic
1203026210 16_KI270728v1_random:514778-514800 TTTCTTATGATTCAGCAGGTTGG - Intergenic
1203045511 16_KI270728v1_random:819653-819675 TTTCTTATGATTCAGCAGGTTGG + Intergenic
1203048131 16_KI270728v1_random:851192-851214 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1144115444 17:12085319-12085341 CTGAATAATATTGAGCAGGTAGG + Intronic
1145417581 17:22733620-22733642 CTTCTTTTGATTGAGCAGGTTGG + Intergenic
1145737850 17:27245557-27245579 CTGCCTATGACCAGGCAGGTGGG + Intergenic
1145972894 17:28967425-28967447 CTTCAAATGAGGAAGCAGGTGGG - Intronic
1146147037 17:30428184-30428206 CTCCATATAATTTAGCAGGATGG + Intronic
1146582760 17:34053763-34053785 CTGCATATGATTAAGCAGGTGGG - Intronic
1147014485 17:37480404-37480426 CTGCATTTGGCTAAGCACGTTGG - Intergenic
1151160628 17:72162217-72162239 TTACATATGTTAAAGCAGGTAGG + Intergenic
1151371113 17:73646709-73646731 CTGGGCATCATTAAGCAGGTGGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1157166217 18:45360426-45360448 CTGCAGAAGATTTAGGAGGTAGG - Intronic
1164361910 19:27522228-27522250 CTTCTTTTGATTAAGCAGGTTGG + Intergenic
1164367978 19:27608247-27608269 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1165372231 19:35416036-35416058 CTGCCTCTGATGAAGAAGGTAGG - Intergenic
925600267 2:5601607-5601629 CTGCATATAATGGAGTAGGTAGG - Intergenic
931883569 2:66591678-66591700 CTGCAGAGAATTAACCAGGTAGG - Intergenic
932113727 2:69025435-69025457 CTGCATATCATTAAGCATCAGGG - Intronic
937862228 2:126720192-126720214 CTGCACAAGATTCAGCAGCTGGG - Intergenic
939871396 2:147529944-147529966 CTGCAAATGATAAATCAGGCAGG + Intergenic
941752349 2:169146572-169146594 CTGCATTTAATTCAGCAGGTGGG + Intronic
943426213 2:187737774-187737796 CAGCATTTGCTTAAGTAGGTGGG + Intergenic
946096848 2:217281838-217281860 CTGCAAATGCATAAGCAAGTGGG - Intergenic
946387996 2:219397498-219397520 CTCCATATGATCAAGAATGTGGG + Intronic
1172289680 20:33767024-33767046 CAGCATAAGAATGAGCAGGTAGG + Exonic
1173806940 20:45932305-45932327 CTGCACATGAGCAAACAGGTTGG - Intergenic
1180426026 22:15185991-15186013 TTTCTTATGATTAAGCAGTTTGG - Intergenic
1180426690 22:15198613-15198635 TTTCTTATGATTAAGCAGTTTGG - Intergenic
1182341573 22:29626062-29626084 ATCAATATGATTAAGCAAGTAGG - Intronic
949616780 3:5762302-5762324 CTGGAAGTGTTTAAGCAGGTAGG - Intergenic
952358202 3:32604300-32604322 CTGTACTTGAATAAGCAGGTTGG - Intergenic
953182274 3:40607056-40607078 AGGCATAGGATTAAGCTGGTTGG + Intergenic
954958720 3:54545927-54545949 CTTAATAGGTTTAAGCAGGTTGG + Intronic
955290291 3:57686014-57686036 CTGATTCTGATTAAGCAGATGGG + Intronic
957270131 3:78019620-78019642 GTGAATACTATTAAGCAGGTGGG - Intergenic
958529204 3:95303874-95303896 CTGCAAATAATTAAGTAAGTTGG - Intergenic
959768681 3:110066492-110066514 CTGTATAGTATTAAGCAAGTCGG - Intergenic
963500049 3:146114568-146114590 ATGCTTATGATTATGCAGTTTGG - Intronic
967099739 3:186206598-186206620 TTTCACCTGATTAAGCAGGTGGG - Intronic
967475326 3:189909818-189909840 CTGTCTATGATTCAGCAGGTAGG + Intergenic
968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG + Intronic
973108564 4:46372067-46372089 GTGCATATGAATAACCTGGTTGG - Intronic
973348893 4:49086703-49086725 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
973529596 4:51821994-51822016 TTTCATTTGATTCAGCAGGTTGG + Intergenic
974548448 4:63342791-63342813 TTCCATTTGATTCAGCAGGTTGG - Intergenic
977146716 4:93451488-93451510 ATGAATATGTTGAAGCAGGTTGG + Intronic
977300990 4:95267529-95267551 CTGAATATCATTAAGCATTTAGG + Intronic
979138701 4:117145615-117145637 CTGCCTATGAATAAGAAGGCAGG + Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980491069 4:133530464-133530486 ATGCAGATGATTAAGCTGGCAGG - Intergenic
980915022 4:139025905-139025927 TTGCATATCATTGGGCAGGTTGG - Intronic
985148454 4:186919565-186919587 CTGCACATGATTCAGTGGGTTGG + Intergenic
985935764 5:3096628-3096650 ATGGATTTGATTAAGCAGCTCGG + Intergenic
988234457 5:28523030-28523052 CTGAACTTGAGTAAGCAGGTTGG + Intergenic
989836353 5:45998454-45998476 TTTCTTATGATTAAGCAGTTTGG + Intergenic
989854077 5:46257127-46257149 CTTTATTTGATTTAGCAGGTTGG - Intergenic
991412487 5:66358740-66358762 CAGCATTTGCTGAAGCAGGTTGG + Intergenic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
992461429 5:76964345-76964367 CTGCAGATCATTAACCAGCTAGG + Intronic
993853988 5:93049378-93049400 CTGCCTATGATTAAGGGGGTTGG + Intergenic
996702464 5:126464207-126464229 CTGCATATGACTGTGCAGGCAGG - Intronic
1000576659 5:162983184-162983206 CTGCATATGTGTAAGGGGGTGGG + Intergenic
1000772239 5:165369134-165369156 CTGCATATGATGAAGCAGTTTGG - Intergenic
1001917058 5:175570569-175570591 CTGCATTTGAATAAGTAAGTGGG + Intergenic
1004941053 6:20556434-20556456 ATACTTATGATTAAGGAGGTAGG - Intronic
1007906300 6:45464681-45464703 CTGTATATGATTGAGCAGCTAGG + Intronic
1008086161 6:47246720-47246742 CTTAATATGAAAAAGCAGGTGGG + Intronic
1013839648 6:114375712-114375734 CTGCATATGATTCATTATGTGGG - Intergenic
1014874304 6:126637884-126637906 TTAAATATGACTAAGCAGGTTGG - Intergenic
1015113875 6:129624010-129624032 TTGAATATAATTAAGAAGGTAGG + Intronic
1016785748 6:148009347-148009369 CTACATATGAGTTAGCAGGTAGG - Intergenic
1017277590 6:152588152-152588174 CTGTATCTGATGAAGCAGCTGGG - Intronic
1017767643 6:157619973-157619995 CTTCATACAATTAAGCAGATAGG + Intronic
1018959685 6:168439738-168439760 CTGCAAATGATTAAGTAAATAGG - Intergenic
1022037755 7:26550240-26550262 CTTCTTATTATTAAGCAGATTGG - Intergenic
1023230631 7:38024272-38024294 CTGGAGATGAGTAAGCAGGAGGG + Intronic
1024382903 7:48720056-48720078 CTGCATATGATACAGTAGGAAGG + Intergenic
1025532959 7:61913027-61913049 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
1025533325 7:61917463-61917485 TTCCTTTTGATTAAGCAGGTTGG + Intergenic
1025533463 7:61919000-61919022 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1025533678 7:61921528-61921550 CTTCCTCTGATTGAGCAGGTTGG + Intergenic
1025533979 7:61925158-61925180 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1032465779 7:132143913-132143935 CTGAATATGAAAAACCAGGTAGG - Intronic
1040114375 8:43598703-43598725 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040115694 8:43616166-43616188 ATTCTTTTGATTAAGCAGGTTGG + Intergenic
1040115992 8:43619980-43620002 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
1040118257 8:43650080-43650102 TTGCTTTTGATTCAGCAGGTTGG + Intergenic
1040118416 8:43651978-43652000 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040120787 8:43683185-43683207 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1040120989 8:43685758-43685780 TTGCTTTTGATTCAGCAGGTTGG + Intergenic
1040123015 8:43702990-43703012 TTTCCTATGATTGAGCAGGTTGG + Intergenic
1040124039 8:43716072-43716094 TTGCTTTTGGTTAAGCAGGTTGG + Intergenic
1040125400 8:43731917-43731939 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040125630 8:43734373-43734395 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1040125919 8:43737639-43737661 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1040126006 8:43738663-43738685 CTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040127389 8:43753522-43753544 ATTCATTTGATTCAGCAGGTTGG + Intergenic
1040127841 8:43758728-43758750 TTTCTTATGATTCAGCAGGTTGG + Intergenic
1040128769 8:43769769-43769791 CTTCTTTTGATTCAGCAGGTTGG + Intergenic
1040128891 8:43771309-43771331 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040130335 8:43788419-43788441 TTTCATTTGATTCAGCAGGTTGG + Intergenic
1040131094 8:43797579-43797601 CTTCATTTGATTCAGCAGGTTGG + Intergenic
1040132397 8:43812568-43812590 TTCCTTTTGATTAAGCAGGTTGG + Intergenic
1040132769 8:43816484-43816506 TTTCTTTTGATTAAGCAGGTGGG + Intergenic
1040132784 8:43816655-43816677 TTTCTTATGATTCAGCAGGTTGG + Intergenic
1040133474 8:43825313-43825335 TTACATTTGATTCAGCAGGTTGG + Intergenic
1040133646 8:43827143-43827165 CTTTCTTTGATTAAGCAGGTTGG + Intergenic
1040133702 8:43827829-43827851 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040133774 8:43828646-43828668 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040134090 8:43832309-43832331 CTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040136557 8:43861173-43861195 TTTCTTTTGATTAAGCAGGTTGG + Intergenic
1040138374 8:43881974-43881996 ATTCTTTTGATTAAGCAGGTTGG - Intergenic
1040281443 8:46050753-46050775 TTGCATTTGATTCAGCAGTTTGG + Intergenic
1040297330 8:46162220-46162242 TTGCTTTTGATTCAGCAGGTTGG - Intergenic
1040320161 8:46289568-46289590 CTTCTTTTGATTCAGCAGGTTGG - Intergenic
1040321483 8:46309888-46309910 TTTCTTTTGATTAAGCAGGTTGG - Intergenic
1040321714 8:46312808-46312830 CTTCTTTTGATTCAGCAGGTTGG - Intergenic
1040327184 8:46354824-46354846 ATTCATTTGATTCAGCAGGTTGG - Intergenic
1040327722 8:46363978-46364000 TTTCATTTGATTAAGCGGGTTGG - Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1043814792 8:84788929-84788951 CTGCAGATTAGTGAGCAGGTAGG + Intronic
1046164900 8:110419800-110419822 CTGCATTTCATTTAGCAGGGAGG + Intergenic
1046539569 8:115561917-115561939 CTGCACATGATTAAGGTGCTTGG - Intronic
1049678486 8:143904195-143904217 CTGCATATGATCCAGTAGGGAGG + Intergenic
1058316789 9:103578331-103578353 CTGCATATGGTTATGCAGTTTGG - Intergenic
1203341455 Un_KI270420v1:1062-1084 CTCCATTTGATTGAGCAGTTTGG - Intergenic
1203341966 Un_KI270425v1:764-786 CTCCATTTGATTGAGCAGTTTGG + Intergenic
1203398387 Un_KI270519v1:50757-50779 TTTCATTTGATTAAGCAGTTTGG + Intergenic
1189699208 X:43699386-43699408 CTGCACATCATAATGCAGGTAGG + Intronic
1190394908 X:49972084-49972106 ATGCATATGATAAAGCAAATAGG - Intronic
1190894440 X:54602884-54602906 CTCCAGATGATAAGGCAGGTTGG + Intergenic
1191228730 X:58076173-58076195 CTGTCTTTGATTCAGCAGGTTGG - Intergenic
1191259281 X:58296012-58296034 GTTCTTATGATTCAGCAGGTTGG + Intergenic
1191574765 X:62688087-62688109 TTTCATTTGATTAAGCAGTTTGG + Intergenic
1191578804 X:62737402-62737424 TTTCTTATGATTCAGCAGGTTGG - Intergenic
1191578888 X:62738252-62738274 TTTCTTTTGATTAAGCAGGTTGG - Intergenic
1191579935 X:62749583-62749605 TTTCCTTTGATTAAGCAGGTTGG - Intergenic
1191581173 X:62762918-62762940 CTTCTTTTGATTCAGCAGGTTGG - Intergenic
1197328406 X:125122543-125122565 GTGCATATAATTAAGCAATTTGG - Intergenic
1198974189 X:142317224-142317246 CTGTATATGGTTATGCAGCTAGG - Intergenic
1199007507 X:142719188-142719210 CTTCATATAATTAATTAGGTTGG - Intergenic
1200705821 Y:6441605-6441627 CTGCCTATGCTCAAGGAGGTGGG - Intergenic
1200882610 Y:8233448-8233470 GGGCATATGATTGAGAAGGTGGG + Intergenic
1201028290 Y:9723103-9723125 CTGCCTATGCTCAAGGAGGTGGG + Intergenic
1201775241 Y:17655600-17655622 CTGCTTTTGATTCAGCAGCTTGG - Intergenic
1201777059 Y:17677417-17677439 TTGTTTTTGATTAAGCAGGTTGG - Intergenic
1201777382 Y:17681031-17681053 TTGCTTTTGATTCAGCAGGTTGG - Intergenic
1201778881 Y:17696470-17696492 CTTCCTTTGATTCAGCAGGTTGG - Intergenic
1201822675 Y:18209522-18209544 CTTCCTTTGATTCAGCAGGTTGG + Intergenic
1201824175 Y:18224961-18224983 TTGCTTTTGATTCAGCAGGTTGG + Intergenic
1201824498 Y:18228575-18228597 TTGTTTTTGATTAAGCAGGTTGG + Intergenic
1201826315 Y:18250389-18250411 CTGCTTTTGATTCAGCAGCTTGG + Intergenic