ID: 1146583226

View in Genome Browser
Species Human (GRCh38)
Location 17:34058699-34058721
Sequence GCATTCCCACAAAGAAAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146583226_1146583237 23 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583237 17:34058745-34058767 GGGAGGAGAGCAGAGCTAGCTGG 0: 1
1: 1
2: 5
3: 51
4: 516
1146583226_1146583234 2 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583234 17:34058724-34058746 ATACTTAAGATAGGAGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 200
1146583226_1146583236 6 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583236 17:34058728-34058750 TTAAGATAGGAGGGGAGGGGAGG 0: 1
1: 1
2: 3
3: 77
4: 968
1146583226_1146583230 -4 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583230 17:34058718-34058740 ATGCAGATACTTAAGATAGGAGG 0: 1
1: 0
2: 1
3: 9
4: 126
1146583226_1146583233 1 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583233 17:34058723-34058745 GATACTTAAGATAGGAGGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 114
1146583226_1146583232 -2 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583232 17:34058720-34058742 GCAGATACTTAAGATAGGAGGGG 0: 1
1: 0
2: 2
3: 15
4: 150
1146583226_1146583235 3 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583235 17:34058725-34058747 TACTTAAGATAGGAGGGGAGGGG 0: 1
1: 0
2: 0
3: 9
4: 262
1146583226_1146583229 -7 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583229 17:34058715-34058737 GGAATGCAGATACTTAAGATAGG 0: 1
1: 0
2: 1
3: 12
4: 133
1146583226_1146583231 -3 Left 1146583226 17:34058699-34058721 CCCCGTTTTCTTTGTGGGAATGC 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1146583231 17:34058719-34058741 TGCAGATACTTAAGATAGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146583226 Original CRISPR GCATTCCCACAAAGAAAACG GGG (reversed) Intronic
907596626 1:55726304-55726326 GCACTCCAACATAGAAAATGGGG + Intergenic
907765183 1:57402956-57402978 GCTTTCCCAAGAAGAAAACTGGG + Intronic
908673736 1:66577803-66577825 GCATACCCAAAAAGAAGAGGAGG + Intronic
912260332 1:108105290-108105312 ACCTCCCCACAAAGAAAACTAGG + Intergenic
913964446 1:143363786-143363808 GGATTCCCATACAGAAAATGCGG - Intergenic
914058815 1:144189392-144189414 GGATTCCCATACAGAAAATGCGG - Intergenic
914120334 1:144776979-144777001 GGATTCCCATACAGAAAATGCGG + Intergenic
920082009 1:203381759-203381781 CCATTCCAAGAAAGCAAACGTGG + Intergenic
1064594094 10:16925773-16925795 GCCTTCCCACAAAGAAACAAAGG + Exonic
1067312750 10:45129889-45129911 GCCTTCCCACAAAGAAACAAAGG - Intergenic
1072922018 10:99584432-99584454 GCATTCCCCCAAAGCACAAGAGG - Intergenic
1074136368 10:110630389-110630411 GGGTTCCCACAAAGAGAACCTGG - Intergenic
1082211880 11:49514059-49514081 AATTTCCCACAAAGAAAACAGGG - Intergenic
1084679325 11:70656981-70657003 GCATTCTCACAAAGTTAACGAGG + Intronic
1085130054 11:74030580-74030602 GCATGCCCACAAAGGAGATGAGG - Intronic
1086637702 11:89110451-89110473 AATTTCCCACAAAGAAAACAGGG + Intergenic
1086817787 11:91394598-91394620 CGATTCCCACAAAGTAAACTGGG - Intergenic
1088233378 11:107696970-107696992 GCATTGCCACGAACAAAACATGG + Intergenic
1093173512 12:15885002-15885024 ACATTCCCAAAAAGGCAACGAGG - Intronic
1095786241 12:46111164-46111186 GCATTCCTACAGATAAAAAGAGG + Intergenic
1097794996 12:63851868-63851890 GCAATCTCACAAAGACAACAAGG - Intronic
1099932913 12:89094140-89094162 GCATTCCCACTAACAATACAGGG + Intergenic
1100494169 12:95109470-95109492 GCATTCCCACTGAGAAAAACTGG + Intronic
1102388115 12:112527791-112527813 GAATTCCCCTAAAGAAAACAGGG + Intergenic
1109063113 13:57645936-57645958 GCATTTCCACAAATAAAACCAGG - Intronic
1109103432 13:58216667-58216689 GCATTTCTACTAAGAAAATGGGG + Intergenic
1110865292 13:80387170-80387192 GCATTCACAGAAAGATAATGAGG - Intergenic
1110957165 13:81568618-81568640 GCATTTCCAGAGAGAAAATGGGG + Intergenic
1118685579 14:68287224-68287246 GCCTTCCCACAAGGAAAAATAGG - Intronic
1126160038 15:45602721-45602743 ACATTCCCATAAAGGAAATGAGG - Intronic
1131202189 15:90408653-90408675 GGATGCCCACAAAGAATACAAGG - Intronic
1134349010 16:13418955-13418977 GCATTCCCAGAAATAAAGTGGGG + Intergenic
1139355707 16:66366151-66366173 CCATTCCCACAAAGACATCATGG + Intergenic
1141138708 16:81483322-81483344 GCATTCCTAGAAAAAAAACCAGG - Intronic
1146583226 17:34058699-34058721 GCATTCCCACAAAGAAAACGGGG - Intronic
1150300785 17:64045288-64045310 GCCTTTCCAAAAAGTAAACGTGG - Intronic
1150453732 17:65290539-65290561 GCATTGCCAAGAAGAAAACTAGG + Intergenic
1162084390 19:8239692-8239714 ACATTCCCATAAAGGAAACGTGG - Intronic
1167696163 19:51016743-51016765 GTATTACCACAGAGAAAATGTGG - Intronic
1202698218 1_KI270712v1_random:141277-141299 GGATTCCCATACAGAAAATGCGG - Intergenic
926736274 2:16075574-16075596 ACATTCCCACAAAGAATGCGTGG + Intergenic
928780366 2:34810474-34810496 GCATTCCCTGAAAGAAAGCTTGG - Intergenic
933409924 2:81912332-81912354 TCATTCCCATAAAGAAAAGAGGG + Intergenic
934303552 2:91800012-91800034 GAAATCCCAAAAAGAAAACAGGG - Intergenic
934329707 2:92052740-92052762 GAAATCCCAAAAAGAAAACAGGG + Intergenic
934467922 2:94282653-94282675 GAAATCCCAAAAAGAAAACAGGG + Intergenic
937113975 2:119390438-119390460 GCTTTCCCACTAAGGAAACAAGG + Intergenic
939305284 2:140402542-140402564 ACATTCCTACAGAGAAAAAGAGG + Intronic
940403620 2:153274686-153274708 GCATTTCCACATAGAAGACCAGG - Intergenic
941121289 2:161533219-161533241 GAATTACCACAAAGAATAAGGGG + Intronic
942436422 2:175982218-175982240 GCATACAGAGAAAGAAAACGGGG + Intronic
946035689 2:216740502-216740524 GCATTCCCACAGATAACACAGGG + Intergenic
947284005 2:228490217-228490239 GCATTGCCAAAAAGAAGACTCGG - Intergenic
1169354424 20:4895599-4895621 TCATTTTCACAAAGGAAACGGGG + Intronic
1178503107 21:33141896-33141918 GCATTCCCCCAAATTAAAGGGGG - Intergenic
1181442906 22:22946681-22946703 ATATTCCCACAAACAAAACTGGG - Intergenic
1181484456 22:23221744-23221766 GCTGTCCCACAAAGAAAAGTGGG - Intronic
1181987840 22:26813430-26813452 GCAGTCCCACAAAGAAAGTGTGG + Intergenic
1182047080 22:27283814-27283836 GCATTCTCACACAGAAACCACGG - Intergenic
951290032 3:20863711-20863733 GAATTTCCCCAAAGAAAATGGGG + Intergenic
951481701 3:23168459-23168481 GAATTCCCAAAAAGAAAAATCGG + Intergenic
951635955 3:24777554-24777576 ACCTTCCAACAAAGAAAACTTGG - Intergenic
951857977 3:27219022-27219044 GCATACGCACTAAGAAAAGGTGG - Intronic
953527543 3:43706082-43706104 GCATTCCCACTAAGCAGATGGGG + Intronic
953881704 3:46694295-46694317 GCCTTCGCACAAAGCACACGCGG - Intergenic
958098835 3:88982696-88982718 GCCTTCCCAGAAAGAAAATAAGG - Intergenic
960428462 3:117538452-117538474 GCATTGCCACAGAGAATATGAGG - Intergenic
962941672 3:140130239-140130261 CCATTCCCACAAGGCAAAGGAGG - Intronic
968480857 4:832509-832531 TCAGCCCCACAAAGGAAACGGGG + Intergenic
968680841 4:1918394-1918416 GCATTCCCATGAAGAGAAGGCGG + Exonic
969031280 4:4216837-4216859 GGATTCCCATACAGAAAATGCGG + Intronic
969504088 4:7573360-7573382 GCATTGCCACACAGTAACCGAGG - Intronic
970280739 4:14452184-14452206 GCATTCGCACAAAGTAAGCCGGG + Intergenic
973203742 4:47535512-47535534 ACATTCCAACAAAGAACGCGTGG + Exonic
976770602 4:88648233-88648255 GCATGCCTACAAAGCAAAGGTGG - Intronic
976970636 4:91097747-91097769 GCAATCCCACAAACAAAAGTGGG - Intronic
979530034 4:121760412-121760434 GGAAGCCCACAGAGAAAACGGGG - Exonic
982742420 4:159071847-159071869 GCTTTCCCACAAAAACAACAGGG + Intergenic
984683856 4:182643961-182643983 ACATTCTCACAAAGACAAAGAGG - Intronic
985639254 5:1055965-1055987 GCCTGCCCACAAGGAAAACATGG + Intronic
994632390 5:102302153-102302175 ACCTTCCCATAAAGAAAAAGTGG + Intergenic
996974991 5:129421610-129421632 GCCATCCCAAAAAGAAAATGAGG + Intergenic
999452713 5:151690332-151690354 TCACTCCCAGAAAGAAAACTTGG + Intergenic
1001285144 5:170417631-170417653 GTATACCCACAAAAAAAACAGGG - Intronic
1003367265 6:5486757-5486779 GCATTCCCATGATGGAAACGTGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005520914 6:26599554-26599576 TCATTCCTACAAAGTAAACTGGG + Exonic
1007601680 6:43086041-43086063 GAATTCCCACCAGGAAAATGTGG - Intronic
1010268138 6:73890883-73890905 GCATCCCTATAAAGAAAACGTGG + Intergenic
1012015866 6:93850682-93850704 TCATTTCCATAAAGAAAACCTGG + Intergenic
1013350338 6:109300103-109300125 GTATACCCACAAACAAAACAAGG + Intergenic
1015250138 6:131118796-131118818 ACATTTCCACAGAGAAAATGAGG + Intergenic
1016630954 6:146230549-146230571 GCATTCCCACCAATAAAACATGG - Intronic
1018044511 6:159953850-159953872 GTTTTCTCACAAAGATAACGAGG + Intergenic
1018255913 6:161918923-161918945 GCATTCCCACCAGCAAAAGGTGG - Intronic
1018441520 6:163818101-163818123 TCATTGCCACAATGAAAATGTGG + Intergenic
1019182382 6:170198521-170198543 GCATTCCCACCCACAATACGTGG - Intergenic
1019186967 6:170226331-170226353 GCATGTCAACAAAGAACACGCGG - Intergenic
1020926100 7:14326644-14326666 CCATTCCCGCAAAGGAAAGGAGG - Intronic
1021273941 7:18626134-18626156 TCATTCCCACAAAGAAGAGAGGG + Intronic
1021769628 7:23985327-23985349 GCATTCCTACAGATAAAAAGAGG + Intergenic
1023713280 7:43017308-43017330 GCATTCCTGCGAAGAAAATGGGG + Intergenic
1025243393 7:57296940-57296962 CAACTCCCTCAAAGAAAACGAGG - Intergenic
1030212371 7:107008982-107009004 TTATTACCACAAAGAAAACTAGG + Intergenic
1030289727 7:107859938-107859960 GGATTCCCCCAGAGAAAACCAGG + Intergenic
1030370894 7:108697971-108697993 GCATTCCCATTTAGAAAATGGGG + Intergenic
1031556741 7:123186260-123186282 ACATGCACACAAAGAATACGAGG + Intronic
1031978987 7:128112298-128112320 GCTTTCCCATAAAGAGAACATGG + Intergenic
1035210685 7:157325921-157325943 GCATTCATTCAAAGAAAACGAGG + Intergenic
1036741129 8:11362564-11362586 GCATTCCCACAAGCAGCACGGGG - Intergenic
1037190915 8:16124204-16124226 GCATTCCCACAGTGAGAATGGGG + Intronic
1037637208 8:20710815-20710837 GCATAACCACAAAAAAAACAGGG - Intergenic
1037818081 8:22122400-22122422 TCATCCCCACCAAGAAAAGGGGG + Intronic
1039304321 8:36244646-36244668 GCATCCCCCCAAAAAAAACGAGG + Intergenic
1040366285 8:46720570-46720592 GCATTCCAACATAGAAAAGAAGG + Intergenic
1042148395 8:65756345-65756367 GGAGTCCCAGAAAGAAAAAGGGG - Intronic
1046297447 8:112239565-112239587 TTATTTCCACAAAGAAAATGAGG - Intronic
1047417885 8:124680482-124680504 GCATTACCCCAAGGAAAAGGTGG + Intronic
1054752081 9:68917607-68917629 CCATTCCCTCAAAGAGAAAGAGG + Exonic
1056827665 9:89887951-89887973 TCATTACCACAAAGAAATCCAGG - Intergenic
1058146298 9:101415567-101415589 TCATTCACACAAATAAAACATGG + Intergenic
1062257505 9:135634932-135634954 GCTTTCTTATAAAGAAAACGGGG - Intronic
1187255777 X:17640660-17640682 GCATTAACACAAAGACAAGGTGG - Intronic
1190573239 X:51806280-51806302 GCATTCTCACAAAGTGAACTCGG + Intronic
1190735275 X:53251533-53251555 GAATTCCCACAGAGGAAACTGGG - Intronic
1194268768 X:91783719-91783741 TCTTTCCCACTAAGAAAACGTGG - Intronic
1195034994 X:100964346-100964368 GCATTGCTATAAAGAAAACATGG + Intergenic
1195149832 X:102055708-102055730 GCATTTACACAAAGACAATGCGG - Intergenic
1196386188 X:115154743-115154765 GCATTCCCACAAGTAACACATGG - Intronic
1197007886 X:121524950-121524972 GCATTCCCAAGAAAAAAATGTGG + Intergenic
1197050563 X:122053167-122053189 GCAGTCTCACAAAGCAAACAAGG + Intergenic
1200054494 X:153452203-153452225 ACATTCCCACATAAAAAATGAGG + Intronic
1200585971 Y:5004641-5004663 TCTTTCCCACTAAGAAAACGTGG - Intronic
1200959864 Y:8986754-8986776 CCATTCCCACAAAAAAAACTAGG + Intergenic