ID: 1146583307

View in Genome Browser
Species Human (GRCh38)
Location 17:34059344-34059366
Sequence ATGGGCTGCTTAGAGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146583307_1146583315 7 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583315 17:34059374-34059396 TGGCATTACAGGGAACCATCAGG 0: 1
1: 0
2: 7
3: 92
4: 302
1146583307_1146583317 11 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583317 17:34059378-34059400 ATTACAGGGAACCATCAGGAGGG 0: 1
1: 0
2: 6
3: 72
4: 249
1146583307_1146583312 -4 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583312 17:34059363-34059385 CCATTCTTGCCTGGCATTACAGG 0: 2
1: 5
2: 24
3: 191
4: 282
1146583307_1146583313 -3 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583313 17:34059364-34059386 CATTCTTGCCTGGCATTACAGGG 0: 1
1: 6
2: 23
3: 193
4: 276
1146583307_1146583319 21 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583319 17:34059388-34059410 ACCATCAGGAGGGTGGCGAGAGG 0: 1
1: 0
2: 37
3: 79
4: 270
1146583307_1146583322 30 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583322 17:34059397-34059419 AGGGTGGCGAGAGGAGCAGAGGG 0: 1
1: 4
2: 54
3: 142
4: 782
1146583307_1146583321 29 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583321 17:34059396-34059418 GAGGGTGGCGAGAGGAGCAGAGG 0: 1
1: 48
2: 76
3: 152
4: 805
1146583307_1146583318 14 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583318 17:34059381-34059403 ACAGGGAACCATCAGGAGGGTGG 0: 1
1: 43
2: 66
3: 82
4: 307
1146583307_1146583316 10 Left 1146583307 17:34059344-34059366 CCCTGGGTCTCTAAGCAGCCCAT 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1146583316 17:34059377-34059399 CATTACAGGGAACCATCAGGAGG 0: 1
1: 0
2: 5
3: 64
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146583307 Original CRISPR ATGGGCTGCTTAGAGACCCA GGG (reversed) Intronic