ID: 1146583860

View in Genome Browser
Species Human (GRCh38)
Location 17:34065020-34065042
Sequence CTCTGGATAGATACCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 13, 2: 42, 3: 173, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146583860 Original CRISPR CTCTGGATAGATACCCAGTA GGG (reversed) Intronic
906572168 1:46852118-46852140 CTTTGGGTATATACCCAGTAAGG - Intergenic
907607937 1:55838225-55838247 CTTTGGATATATACCAAGTCAGG + Intergenic
908610677 1:65856680-65856702 CTTTGGGTATATACTCAGTAAGG + Intronic
909245986 1:73285057-73285079 CTCTGGGTATATACCCAGTAAGG - Intergenic
909987129 1:82174724-82174746 CTTTGGATACATATCAAGTAGGG - Intergenic
910387250 1:86698469-86698491 CTCTGGGTGGATACCCAATAGGG + Intergenic
910496761 1:87838315-87838337 CTTTGGGTATATACCCAGTAAGG - Intergenic
910600693 1:89029019-89029041 CTTTAGGTATATACCCAGTAAGG + Intergenic
910811941 1:91247084-91247106 CTTTGGGTATATACCTAGTAAGG + Intergenic
910816227 1:91293690-91293712 CTTTGGGTATATACCTAGTAAGG - Intronic
910941139 1:92535399-92535421 CTTTGGGTATATACCCAGTAAGG - Intronic
911136124 1:94442966-94442988 CTTTGGATGTATACCCAATAGGG + Intronic
911338761 1:96612230-96612252 CTTTGGGTATATACCCAGTAAGG + Intergenic
911724808 1:101232202-101232224 CTTTGGGTATATACCCAGTAAGG - Intergenic
912034228 1:105291151-105291173 CTTTGGATATATACCCAGTAAGG + Intergenic
912190725 1:107337101-107337123 TTTTGGATATATACCCAGAATGG - Intronic
912743736 1:112226916-112226938 CTTTGGGTATATACCCAGTATGG - Intergenic
913373405 1:118125873-118125895 CTTTGGATAAATACCTAATAGGG + Intronic
915767481 1:158378650-158378672 CTCTGGGTAGATACCCATAGTGG - Intergenic
915843298 1:159235235-159235257 CTTTGGGTATATACCCCGTAAGG + Intergenic
916277590 1:163011981-163012003 GGGTAGATAGATACCCAGTAGGG + Intergenic
916635748 1:166666810-166666832 CTTTGGGTATATACCCAGTAAGG - Intergenic
916857869 1:168769891-168769913 CTTTGGGTATATACTCAGTAAGG - Intergenic
917065969 1:171093687-171093709 CTTTGGATAGATATCTACTAGGG + Intronic
917323648 1:173810001-173810023 CTTTGGGTATATACCCAGTAAGG - Intronic
917399769 1:174634524-174634546 ATTTGGGTATATACCCAGTAAGG - Intronic
918832044 1:189411135-189411157 CTTTGGGTATATACCCAGTAAGG + Intergenic
919290287 1:195621602-195621624 CTTTAGGTATATACCCAGTAAGG + Intergenic
919361115 1:196596231-196596253 CTTTGAGTAGGTACCCAGTATGG + Intronic
919435603 1:197555845-197555867 CTTTGGCTATATACCCAATATGG - Intronic
920185621 1:204157355-204157377 CTCTGCAGAGATTCCGAGTAAGG - Exonic
920642874 1:207770902-207770924 CTTTGGGTATATACCCAGTAAGG + Intronic
922737140 1:227992811-227992833 CTCTGGATCTATACCCAGAGTGG - Intergenic
923066449 1:230521686-230521708 CTTTGGCTATATACCCAGTATGG + Intergenic
923962042 1:239096723-239096745 GTCTGGAAAGTTCCCCAGTATGG + Intergenic
924575216 1:245274729-245274751 CTTTGGGTATATACCCAGTAAGG + Intronic
924575229 1:245274824-245274846 CTTTGGGTATATACCCAGTAAGG + Intronic
1062869361 10:886438-886460 CTTTGGATAAATACTCAGAAAGG - Intronic
1063175808 10:3550037-3550059 CTCTGGGTAGACACACAGTAGGG - Intergenic
1063250995 10:4274688-4274710 CTTTGGGTATATACCCAGTAAGG - Intergenic
1064627175 10:17273296-17273318 CTTTGGATAGACAACCAGGAGGG + Intergenic
1064975083 10:21105686-21105708 CTTTGGGTATATACCCAATAAGG + Intronic
1065561263 10:26966123-26966145 CTTTGGATATATACCCAGAAAGG - Intergenic
1065757935 10:28951385-28951407 CTCTGGGTGGATATCCAGGAGGG + Intergenic
1066784656 10:38990093-38990115 CCTTGGGTATATACCCAGTAAGG + Intergenic
1068050296 10:51941951-51941973 CTTTGGGTATATACCCAGTAAGG + Intronic
1068127734 10:52862259-52862281 CTTTGGGTATATACCCCGTAAGG + Intergenic
1068412494 10:56675203-56675225 CTTTGAGTATATACCCAGTATGG + Intergenic
1069016564 10:63435945-63435967 CTCTAAATAAATACCCAATATGG + Intronic
1071105892 10:82094482-82094504 CTTTGGGTAGATACCCAGCAGGG - Intronic
1071144905 10:82557140-82557162 CTCTGGGTATATACCCATAATGG + Intronic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1072384661 10:94912289-94912311 CTTTGGCTATATACCCAGTAAGG - Intergenic
1073821828 10:107273040-107273062 CTTTGGATATATACTCAGTAGGG + Intergenic
1075814101 10:125251195-125251217 CTTTGGGTATCTACCCAGTAAGG + Intergenic
1076069663 10:127477572-127477594 CTTTCGGTATATACCCAGTAGGG + Intergenic
1076564789 10:131390760-131390782 CTCTGGGTAGATACCCATAGTGG - Intergenic
1077449939 11:2634679-2634701 CTTTGGGTATATACCCAGTAAGG + Intronic
1077817792 11:5704132-5704154 CTTTGGGTATATACCCAGCAGGG - Intronic
1078825695 11:14928187-14928209 TTTTGGATATATACTCAGTAAGG + Intronic
1079357442 11:19741854-19741876 CTTTGGGTATATACCCAGAAGGG + Intronic
1079665688 11:23102735-23102757 CTTTGGGCATATACCCAGTATGG - Intergenic
1079766692 11:24402782-24402804 CTTTGGGTGGATACCTAGTAGGG + Intergenic
1080985696 11:37461596-37461618 CTTTGGGTATATACCCTGTATGG + Intergenic
1082151084 11:48739512-48739534 CTTTGGGTATATACCCAGTACGG - Intergenic
1082793226 11:57361789-57361811 CTTTGGGTATATACCCAGTAAGG + Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1087085705 11:94216438-94216460 CTTTGAGTATATACCCAGTATGG + Intergenic
1087201964 11:95354668-95354690 CTTTGGATAAATAACAAGTATGG + Intergenic
1087387144 11:97486033-97486055 CTTTTGGTATATACCCAGTATGG - Intergenic
1087694855 11:101364978-101365000 CTTTGGGTATATGCCCAGTAAGG + Intergenic
1088403850 11:109450251-109450273 CTTTGGGTACATACCCAGTAAGG - Intergenic
1088541133 11:110915022-110915044 CTTTGGAAATATACCCAGTTGGG - Intergenic
1088703379 11:112435144-112435166 CTTTGGGTATATACCCAGCAGGG - Intergenic
1092303383 12:7274261-7274283 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1092639410 12:10487298-10487320 CTTTGGGTATATACCCAGTAAGG - Intergenic
1093052910 12:14523795-14523817 CTTTGGATAAATACCCAGCAAGG - Intronic
1093064071 12:14638357-14638379 CTTTGGATAAATACTCAGCAGGG - Intronic
1093076617 12:14765455-14765477 CTCTGAGTATATACCCAGTATGG - Intergenic
1093604083 12:21068536-21068558 CTCTGGCTATATACCTAGTATGG + Intronic
1093606664 12:21098668-21098690 CTTTGGATAAATTCCCAGTAGGG + Intronic
1093965039 12:25315433-25315455 CTCTGGGTAGGTACCCAGTAGGG - Intergenic
1094362386 12:29643283-29643305 TTCTGGGTAGATACCCAGTGTGG - Intronic
1094690704 12:32765599-32765621 CTTTGGGTAGATACTCAGTAAGG + Intergenic
1094742108 12:33301715-33301737 CTTTGGGTATATACCCAGTAGGG + Intergenic
1094758583 12:33500836-33500858 TTCTGGATAAATTCCCAGAAGGG + Intergenic
1094812562 12:34153111-34153133 CTCTGGTTTTATACCCACTAGGG - Intergenic
1095258986 12:40076653-40076675 CTTTGGGTATATACCCAGTAAGG + Intronic
1095836352 12:46643526-46643548 CACTGGGTATATATCCAGTAAGG - Intergenic
1096028724 12:48391861-48391883 CTTTGGGTATATACTCAGTAAGG + Intergenic
1097579220 12:61433053-61433075 CTCTGAATATATCACCAGTATGG - Intergenic
1097634706 12:62108486-62108508 CTTTGGGTACATACCCAGTAAGG + Intronic
1099006518 12:77240574-77240596 CTCAGGTGAGATACCCTGTAGGG + Intergenic
1099398125 12:82167444-82167466 CTTTGAATATATACCCAGTAAGG - Intergenic
1099500944 12:83413769-83413791 CTGTGGGTATATACCTAGTAAGG + Intergenic
1099506442 12:83482218-83482240 CTTTGGGTATATACCCAGAAAGG + Intergenic
1099892769 12:88610048-88610070 CTTTGGGTATATATCCAGTATGG - Intergenic
1099937963 12:89150701-89150723 CTTTGGGTAGATATCCAGTAGGG - Intergenic
1100173213 12:92000962-92000984 CTTTGGATAATTGCCCAGTAGGG - Intronic
1100549827 12:95636786-95636808 CTCTGGGTATATACCCATAATGG - Intergenic
1101459293 12:104873528-104873550 CTTTGGATACATACCCAAAAGGG + Intronic
1102316575 12:111892890-111892912 CTCTTGACAGAGACCCAATAAGG - Intronic
1102658358 12:114502772-114502794 CTCTGGATAGAAACAGACTAAGG + Intergenic
1103289984 12:119837639-119837661 CTCTTCAGAGATGCCCAGTAAGG + Intronic
1104147220 12:126046729-126046751 CTCTGGGTGTATACCCAGTAGGG - Intergenic
1104543747 12:129692479-129692501 CTTTGGGTATATACCCAGAATGG - Intronic
1104564335 12:129866760-129866782 CTTTGGATATATACCCAGAGTGG - Intronic
1105442303 13:20425543-20425565 CTCTGCATGAATACCCAGGAAGG - Intronic
1106362139 13:29040462-29040484 CTCTGGGTAGATACCCAGTAGGG + Intronic
1106433157 13:29701514-29701536 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1106905229 13:34400838-34400860 CTTTGGATACATGCCCAGTAGGG - Intergenic
1107632146 13:42353276-42353298 CTTTGGAAATATACCCAGAAAGG + Intergenic
1108469010 13:50749437-50749459 CTCTGTGTAGATACCCAGTAGGG + Intronic
1109361988 13:61305106-61305128 CTTTGGGTATATACCCAGAAAGG - Intergenic
1109485604 13:63015293-63015315 CTCTGGGTGTATACACAGTAAGG + Intergenic
1109580106 13:64319324-64319346 CTTCAGATATATACCCAGTATGG + Intergenic
1109584477 13:64380630-64380652 CTTTGGATAAATACTCAGTAAGG + Intergenic
1109897043 13:68706407-68706429 CTTTGGATATATACCCAGTAAGG + Intergenic
1111032366 13:82620006-82620028 TTCTGGATAGATACCCAGTAGGG - Intergenic
1111327682 13:86720731-86720753 CTTTGGGTATATACACAGTAAGG - Intergenic
1111348951 13:87000521-87000543 CTTTTCATAGATACCCAGTAGGG - Intergenic
1111433721 13:88179105-88179127 CTCTGTCTACATACCCAGTTAGG - Intergenic
1111776709 13:92672523-92672545 CTTTGAGTATATACCCAGTATGG - Intronic
1111922799 13:94430301-94430323 CTTTGGGTAGATGCCGAGTAGGG - Intergenic
1112713557 13:102158161-102158183 CTTTGGGTATATACCCAGTAAGG - Intronic
1114760620 14:25309800-25309822 CTCTTGGTAGATACCTAGTGTGG - Intergenic
1115669108 14:35588744-35588766 CTCTGGATATATACCCAGTAGGG - Intronic
1115724982 14:36203936-36203958 TTTTGGATAAATACCCAGAATGG - Intergenic
1116281211 14:42910467-42910489 CTTTAGGTATATACCCAGTAAGG + Intergenic
1116672740 14:47864088-47864110 CTTTGTAAAGATGCCCAGTAAGG + Intergenic
1117030392 14:51663254-51663276 CTTTGGGTATATACCCAGTAGGG - Intronic
1117627469 14:57654593-57654615 CTCTGGGTAGATACCCATAGTGG + Intronic
1119077391 14:71655470-71655492 CTTTGAGTAGATACCCAGTAGGG + Intronic
1120318637 14:82930457-82930479 CTTTGGGTATATACTCAGTACGG - Intergenic
1120742420 14:88122705-88122727 CTTTGGGTATATACCTAGTAAGG + Intergenic
1121575876 14:94986871-94986893 CTGTAGGTGGATACCCAGTATGG - Intergenic
1123228705 15:17079186-17079208 CTTTGGGTATATACCCAGTAAGG - Intergenic
1123508190 15:20967220-20967242 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123565410 15:21540967-21540989 CTTTGGATATATGCCCAGAAGGG + Intergenic
1123601675 15:21978257-21978279 CTTTGGATATATGCCCAGAAGGG + Intergenic
1124066647 15:26350515-26350537 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1124117681 15:26862577-26862599 CTTTAGATAGATACACAGTATGG - Intronic
1125456485 15:39865190-39865212 CTTTGGGTAGATACCTAGTAGGG - Intronic
1126233890 15:46359387-46359409 CTTTGGATATATACCCTATAAGG - Intergenic
1127090824 15:55465246-55465268 CTCTAGATAGATACCCAGTAGGG - Intronic
1127369391 15:58323261-58323283 TTTTGGATATATACCCAGTAAGG + Intronic
1128408067 15:67364057-67364079 CTTTGGGTATATACCCAATAAGG + Intronic
1128926914 15:71664994-71665016 CTTTGGGTATATACCCAGTAAGG + Intronic
1130363918 15:83215673-83215695 CTTTGGGTATATACCCAGTAAGG + Intergenic
1202973782 15_KI270727v1_random:268057-268079 CTTTGGATATATGCCCAGAAGGG + Intergenic
1134753404 16:16645161-16645183 TTTTGGATATATACCCAGCATGG + Intergenic
1134769262 16:16792107-16792129 CTTTGGGTATATACCCAGTAGGG - Intergenic
1134992654 16:18713920-18713942 TTTTGGATATATACCCAGCATGG - Intergenic
1136127878 16:28198006-28198028 CTTAGGATAGATTCCCAGAAGGG - Intronic
1137082431 16:36077432-36077454 CTTTGGGTATATACCCAGTAAGG - Intergenic
1138721159 16:59082025-59082047 CTTTGGGTATATACCCAGGAAGG - Intergenic
1138725231 16:59130079-59130101 CTTTGGATATAAACCCAGTAGGG + Intergenic
1138938990 16:61766490-61766512 CCTTGGGTAGATACCCAGCATGG + Intronic
1139149342 16:64361774-64361796 TTGTGGATGCATACCCAGTAGGG - Intergenic
1141037086 16:80636694-80636716 CTTTGGGTATATACCCAGGATGG - Intronic
1142931339 17:3286415-3286437 CTTTGGGTATATACTCAGTAAGG + Intergenic
1143815807 17:9513662-9513684 CTTTGGATAAGTGCCCAGTAGGG - Intronic
1144231334 17:13207234-13207256 CTTTGGGTATACACCCAGTAAGG + Intergenic
1144612083 17:16729091-16729113 CTTTGGGTAGATGCCCAGTAGGG + Intronic
1144900651 17:18586291-18586313 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1145131800 17:20359448-20359470 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1146089254 17:29859793-29859815 CTTTGGGTATATATCCAGTAAGG + Intronic
1146423724 17:32715303-32715325 CTTTGGGTATATACCCAGTAAGG - Intronic
1146583860 17:34065020-34065042 CTCTGGATAGATACCCAGTAGGG - Intronic
1147471946 17:40670577-40670599 CTTTGGGTGGATACCCAGAAGGG - Intergenic
1149090693 17:52774648-52774670 CTTTGGGTATATACCTAGTAAGG + Intergenic
1149719969 17:58833730-58833752 TTTTGGGTATATACCCAGTATGG + Intronic
1150021738 17:61622021-61622043 CTATTGATACATACCCAGTTTGG - Intergenic
1151098135 17:71522773-71522795 TTTTGGATATATACCCAGAATGG - Intergenic
1152244142 17:79176468-79176490 CTCTGGAAGGAGACCCAGTTGGG - Intronic
1154396148 18:13991221-13991243 ATTTGGATAAATACCCAGTATGG - Intergenic
1155335485 18:24760381-24760403 CTTTGGTTACATACCCAGTAAGG - Intergenic
1156934415 18:42685832-42685854 CTTTAGGTATATACCCAGTAGGG - Intergenic
1157018578 18:43750433-43750455 CTTTGGGTATATACCCAGTAAGG + Intergenic
1157357337 18:46947792-46947814 CTCTGGCTTCATACCCATTATGG + Intronic
1157473268 18:48006033-48006055 ATTTGGATATATACCCAGTAAGG + Intergenic
1158793969 18:60818763-60818785 CTTTGGGTATATACCCAGTAAGG + Intergenic
1159613360 18:70550801-70550823 CTTTGGGTATATACCCACTAGGG - Intergenic
1159613489 18:70552308-70552330 CTTTGGGTAGATACTCAGTAAGG - Intergenic
1160252471 18:77215188-77215210 CGCCGGATAAATACCAAGTATGG - Intergenic
1163548658 19:17953078-17953100 CTCTGGCTAGAGACCCAGACAGG + Intronic
1163952203 19:20599135-20599157 CTCTGTGTAGATACCCAGTAGGG + Intronic
1164331629 19:24264273-24264295 CTTTGGGTATATATCCAGTAAGG + Intergenic
1167853417 19:52219327-52219349 TTGTGGATTGATACCCAGAAAGG + Intronic
1168012853 19:53547533-53547555 CTTTGGATATATACCCAGAGTGG + Intronic
1168628703 19:57939696-57939718 CTTTGGATAAATTCCCAGTAGGG - Intergenic
925037392 2:700035-700057 CTTTGGGTATATACTCAGTAAGG + Intergenic
925354208 2:3226140-3226162 CTTTGGATATATACCCAGAATGG + Intronic
925376912 2:3392822-3392844 CTTTGGATACATACCCAGAATGG - Intronic
925550304 2:5066663-5066685 CTCTGGGTATATACCCAGTGAGG - Intergenic
925720778 2:6824547-6824569 CTTTGGGTATATACCCAGTAAGG - Intergenic
926074188 2:9927370-9927392 CTTTGGGTATATACTCAGTAAGG + Intronic
928346919 2:30507810-30507832 CTTTGGGTATATATCCAGTAAGG + Intronic
929643026 2:43600658-43600680 CTCTGGGTAGATACCCAGTAGGG - Intergenic
930239185 2:48918260-48918282 CTTTGGGTATATACCCAGTATGG + Intergenic
931307092 2:61040227-61040249 CTTTGGATATATACCCAGTAAGG - Intronic
931420880 2:62126271-62126293 CTTTGGGTATATACCCAGTAAGG + Intronic
932946787 2:76243246-76243268 CTTTGGATAAATACTCAGTATGG + Intergenic
933001919 2:76936079-76936101 CTTTGGGTATATACCCAGTATGG - Intronic
933095431 2:78172662-78172684 AACTGGATAGATACTTAGTAAGG - Intergenic
935439853 2:103079937-103079959 CTTTGGGTAAATTCCCAGTAGGG - Intergenic
936897838 2:117447889-117447911 CTATGGATGTATACCCAGTAAGG - Intergenic
937424040 2:121782615-121782637 CTCTGGGTAGATACCTAGTAGGG + Intergenic
937731387 2:125234935-125234957 CTCTCGGTATATACCCAGGATGG + Intergenic
938622425 2:133070235-133070257 GTCAGGATAATTACCCAGTAAGG + Intronic
939090973 2:137780023-137780045 CTGTGGATAGGCACCCAGGAGGG - Intergenic
939370766 2:141297206-141297228 CTTTGGGTATATACCTAGTAAGG + Intronic
939837351 2:147147163-147147185 CTTTGGGTATATACCCAGTAAGG + Intergenic
939975645 2:148714412-148714434 CTTTGGGTATATACCAAGTAAGG + Intronic
940644690 2:156378444-156378466 TTTTGGATATATACACAGTAAGG + Intergenic
940669170 2:156646563-156646585 CTTTGGGTAAATATCCAGTATGG - Intergenic
941239923 2:163024654-163024676 CTTTGGGTATATACCCAGAATGG - Intergenic
941478937 2:165982371-165982393 CTTTAAGTAGATACCCAGTAGGG + Intergenic
942254385 2:174080684-174080706 CTCTTCATAGATACACAGTTGGG - Intronic
942373684 2:175313316-175313338 CTCTTGATAGATGTTCAGTATGG + Intergenic
942400505 2:175596923-175596945 TTTTGGATATGTACCCAGTAAGG + Intergenic
942529886 2:176898258-176898280 CTTTGGGTAGAAACCCAGTAGGG + Intergenic
943138261 2:183943557-183943579 TTTTGAATAAATACCCAGTAGGG - Intergenic
943322595 2:186464104-186464126 CTTTGGGTAGATACCCAATAGGG - Intergenic
943592786 2:189819381-189819403 CTTTGGGTAGATACCCAGTAGGG + Intronic
945227304 2:207545064-207545086 CTTTGGGTATATATCCAGTAAGG + Intronic
945304376 2:208244874-208244896 CACAGGATAAATACCCAGAAGGG + Intronic
945347375 2:208733836-208733858 CTTTGGCTATATACCCATTAAGG + Intronic
945578121 2:211557758-211557780 CTGTGGGTATATACCCAGGAAGG - Intronic
945838615 2:214861740-214861762 CCCTGGGTAGATACCCAGTAGGG + Intergenic
945981191 2:216312459-216312481 CTTTGGGTAGATACACAGTGTGG + Intronic
946712621 2:222521930-222521952 CTATGGACAGATACCAGGTAAGG + Exonic
947376368 2:229500522-229500544 CTTTGGATATATATCCAGTAGGG - Intronic
947957788 2:234209100-234209122 CTTTGGGTATATACCCAATAAGG + Intergenic
948493328 2:238328086-238328108 TTTTGGATAAATACCCAGAAGGG + Intronic
1169610157 20:7370237-7370259 CTTTGGGTTTATACCCAGTAAGG - Intergenic
1170093551 20:12619703-12619725 CTTTGGGTAAATACCCATTAAGG - Intergenic
1170107999 20:12772848-12772870 CTCTGGGTAGATGCCTAATACGG + Intergenic
1170923733 20:20703732-20703754 CTCTGGAGTCATACCCAGCAGGG + Intronic
1171051274 20:21861529-21861551 CTCTGGGTAGATCCCCAGTAGGG - Intergenic
1171999480 20:31761755-31761777 TTTTGGATATATACCCAGTAGGG + Intronic
1173707969 20:45127022-45127044 TTTTGGATAAATACCCAGAAGGG + Intergenic
1174653133 20:52146220-52146242 CTTTGGGTATATACCCAGCATGG - Intronic
1176318974 21:5288692-5288714 CTTTGGGCATATACCCAGTAAGG + Intergenic
1176476957 21:7228201-7228223 CTTTGGGCATATACCCAGTAAGG + Intergenic
1177348401 21:19901776-19901798 CTTTGGGTATATACCCAGTAAGG + Intergenic
1178761725 21:35409491-35409513 CTCTGGGTATATACCCAGTATGG + Intronic
1178812834 21:35899136-35899158 CTTTGGGTATATACCCAGTGAGG - Intronic
1179083695 21:38197284-38197306 CTGCGGGTAGATACCCAGTGTGG + Intronic
1179326943 21:40356130-40356152 CTTTGGATATATACCCAGAGTGG + Intronic
1179581160 21:42344882-42344904 CTTTGGATAGATACTCAGTGGGG - Intergenic
1180203948 21:46245375-46245397 CTCTGGAGACATGTCCAGTAGGG + Intronic
1182713721 22:32338830-32338852 CTCTGGATAGATGCCAGGCAGGG - Intergenic
949151478 3:773058-773080 CTTTGGGTATATACCCAGTAAGG + Intergenic
949401729 3:3671833-3671855 CTTTGGGTATATACCCAGTAAGG + Intergenic
950476152 3:13216128-13216150 CTTTGGATAGATTCCTAGAATGG - Intergenic
950848473 3:16038397-16038419 CTTTGGGTATATACTCAGTAAGG + Intergenic
951030183 3:17872843-17872865 CTTTGGGTAGATGCCCAGTAGGG + Intronic
951545203 3:23817937-23817959 ATCTGGATAGAGACAGAGTAAGG + Intronic
952810074 3:37394217-37394239 CTTTGGGTATATACCCAATAAGG + Intronic
953408516 3:42673283-42673305 CTCTGGAGAGACAGCCACTATGG - Intergenic
954949272 3:54455094-54455116 CTTTGGATATATACCCAGTAGGG + Intronic
955595542 3:60586482-60586504 CTCTGGGTTTATATCCAGTAAGG - Intronic
955834352 3:63038211-63038233 CTTTGGGTAGATACACAATAAGG + Intergenic
956357767 3:68412876-68412898 CTTTGGGTATATACCCAGTAAGG + Intronic
956775379 3:72561042-72561064 CTCTGGAAAGTTCCCCAGGAAGG - Intergenic
957111702 3:75969312-75969334 CTTTGGGTATATACCCAGCAGGG + Intronic
957530203 3:81431169-81431191 CTTTGGGTATATACCCAGTAAGG - Intergenic
957693651 3:83604023-83604045 CTTTGGATATATACACAGAAGGG + Intergenic
957931568 3:86885132-86885154 CTCTGGGTAGATACCCAGTAGGG + Intergenic
958079975 3:88735247-88735269 CTCTGGGTAGACACCCAGTAGGG - Intergenic
958423547 3:93955217-93955239 CTTTGGGTATATACCCAGTAAGG - Intronic
958510121 3:95037277-95037299 CTCAGGATAGTCACCCAGCAGGG + Intergenic
958593049 3:96184652-96184674 TTTTGGATAAATACCCAGAATGG - Intergenic
958775205 3:98474219-98474241 CTCTGGGTGGATACACAGTAGGG + Intergenic
959166048 3:102779728-102779750 CTCTGGAAGAATACCCAGGAAGG + Intergenic
959494363 3:107032188-107032210 CTTTGGGTATATACCCAGTAAGG - Intergenic
960017054 3:112903079-112903101 CTTTGAGTATATACCCAGTAAGG + Intergenic
960251760 3:115463421-115463443 CTTTGGGTATATACCCAGTAAGG - Intergenic
960492107 3:118329851-118329873 CTTTGGATATATACCCAGAATGG - Intergenic
960607482 3:119522048-119522070 CTTTGGATAAATACCTAGTAGGG - Intronic
960772273 3:121207974-121207996 CTTTGGGTATATACCCAGTAAGG - Intronic
962553567 3:136523068-136523090 CTTTGGATAGATACCCAGTAAGG + Intronic
962911052 3:139850035-139850057 CTTTGGATATATACCCAGTAAGG + Intergenic
962965089 3:140346001-140346023 CTCTGGATGGAGACCCAGCATGG - Intronic
963695269 3:148559416-148559438 CTTTGGGTATATACCCAGTAAGG + Intergenic
963717358 3:148819146-148819168 CTTTGGGTATATCCCCAGTAAGG + Intronic
964145758 3:153461011-153461033 TTCTGGATAGACACCCATAAGGG + Intergenic
964555870 3:157937734-157937756 CTCTTGATAGATTTCCAGGAGGG - Intergenic
964677931 3:159304381-159304403 CCCAGGATAGATACCCAACACGG - Intronic
964689946 3:159438990-159439012 CTTTGGATATATACCCAGTAAGG + Intronic
964773201 3:160246245-160246267 CTCTGGGTAGATACCCAGTTTGG - Intronic
965241639 3:166207821-166207843 CTTTGGATATATACCCAGTTAGG + Intergenic
965378214 3:167953780-167953802 CTCTGGCTAGATACCCATTACGG + Intergenic
965383323 3:168016533-168016555 CTTTGGGTATATACCCAGTAAGG - Intronic
965477642 3:169177107-169177129 CTTTGGGTATATACCCAGTAAGG - Intronic
965714998 3:171593672-171593694 CTTTGGATATATACCCAGAGTGG + Intergenic
965891153 3:173515005-173515027 TTTTGGATAAATACCCAGAATGG + Intronic
966010356 3:175067730-175067752 TTTTGGATATATACCTAGTAGGG - Intronic
966339710 3:178912160-178912182 CTTTGGGTATATACCTAGTAAGG - Intergenic
966340496 3:178920486-178920508 CTTTGGGTAGGTGCCCAGTAGGG - Intergenic
966486166 3:180472943-180472965 CTTTGGATATATAACCAGTGTGG - Intergenic
966552857 3:181224435-181224457 CTTTGGGTAGATACCCGATAGGG + Intergenic
966654998 3:182346257-182346279 CTTTGGGTATATACCCAGTATGG - Intergenic
967398680 3:189035911-189035933 CTCTGGGTATAGACCCAGTAAGG - Intronic
967479383 3:189956528-189956550 CTCTGGATCAATGCCCAGTTTGG + Intergenic
969165205 4:5303181-5303203 CTCAGGGTAGATACCCAGGAGGG + Intronic
969883803 4:10197486-10197508 CTTTGGGTATATACCCAGTTAGG + Intergenic
971656420 4:29351871-29351893 CTTTGGGTATATAGCCAGTAGGG + Intergenic
972222381 4:36970573-36970595 TTTTGGATATATACCCAGGATGG - Intergenic
972963044 4:44476872-44476894 CTCTGGGTATATGCCCAGTAAGG - Intergenic
973922264 4:55700002-55700024 CTTTGGGTATATACCCAGTAAGG - Intergenic
974458152 4:62155173-62155195 CTCTGGGTAGATACCCAGTAGGG - Intergenic
975163357 4:71148891-71148913 CTCTGCATATATACCTAGTAAGG + Intergenic
975304566 4:72834649-72834671 CTCTGGGTATATACCCACTGAGG - Intergenic
975896618 4:79100163-79100185 CTTTGGATACATACCCAACATGG + Intergenic
976105240 4:81610244-81610266 CTTTGGATATAGACTCAGTAAGG - Intronic
976328907 4:83805164-83805186 CTGTGGATATATACCCAGAATGG - Intergenic
976572482 4:86629002-86629024 CTTTGGGTATATACCCAGTCAGG + Intronic
976680894 4:87754595-87754617 CTTTGGGTATATACCCAGTATGG + Intergenic
977063589 4:92286490-92286512 CTTTGGATATATACCCAGTAGGG + Intergenic
977516935 4:98032205-98032227 CTCTGGGTAGATACCAATAATGG - Intronic
977547416 4:98400204-98400226 CTTTTGATAAATACCCAGTAAGG - Intronic
977733615 4:100383666-100383688 CTCTGTGTAGGTATCCAGTAGGG - Intergenic
977777663 4:100940128-100940150 CTCTGGATAGATACCTAGTGTGG - Intergenic
978052305 4:104216667-104216689 CTTTGGGTATATTCCCAGTATGG - Intergenic
978252107 4:106643582-106643604 CTTTGGATAAATACCCAGTATGG + Intergenic
978686884 4:111455869-111455891 CTGTAGATAGATGCCCACTAGGG + Intergenic
980514526 4:133837675-133837697 CTTTGGGTATATACCCAGAAGGG + Intergenic
981397069 4:144264200-144264222 CTTTGGATATATAACCAGCAGGG - Intergenic
981699466 4:147593217-147593239 CTCTGGGCAGATACCCAATAGGG - Intergenic
981738517 4:147978174-147978196 TTTTGGATATATACCCAGTAAGG + Intronic
981838968 4:149089093-149089115 CTTTGGGTATATACCCAGTAAGG + Intergenic
982177378 4:152718704-152718726 CTGAGGATAGATACACAGCAAGG + Intronic
982507186 4:156234115-156234137 CTTTGGGTATATACCCAGTAAGG - Intergenic
982643950 4:157998522-157998544 CTTCAGGTAGATACCCAGTAAGG + Intergenic
984010185 4:174361275-174361297 TTTTGGATATATATCCAGTAAGG - Intergenic
984481354 4:180306985-180307007 CTTTGGGTATATACTCAGTATGG + Intergenic
984592054 4:181627836-181627858 CTTTGGGTATATGCCCAGTAAGG + Intergenic
984625615 4:182004574-182004596 CTTTGGGTATATACCCAGTAAGG + Intergenic
985051291 4:185994780-185994802 TTTTGGGTAGATACCCAATAGGG - Intergenic
985091744 4:186370197-186370219 CTTTGGGTATATACCCAGTAAGG - Intergenic
985109287 4:186532721-186532743 CTTTGGGTATATACCCAGTAAGG + Intronic
985436263 4:189932066-189932088 CTTTGAATATACACCCAGTAGGG - Intergenic
985793132 5:1942529-1942551 TTTTGGATATATACCCAGGAGGG + Intergenic
986359045 5:6957758-6957780 CTTTGGGTATATACCCAGTAAGG - Intergenic
986373535 5:7106369-7106391 CTTTGAGTATATACCCAGTAAGG + Intergenic
987199515 5:15561563-15561585 CTTTGGATATATACCCAGCAGGG + Intronic
987520775 5:18980546-18980568 CTTTGGATATATAGCCAGAATGG + Intergenic
987565325 5:19576728-19576750 CTTTGGCTATATACCCAGTCAGG - Intronic
987669313 5:20986678-20986700 CTTTGGGTATATACCCAGTAAGG + Intergenic
987752098 5:22053522-22053544 CCCTGGATAGAAAGCCAGAATGG - Intronic
988316648 5:29639667-29639689 CTTTGGATGTATACCCTGTAGGG - Intergenic
988324416 5:29743425-29743447 CTTTGGGTATATGCCCAGTATGG - Intergenic
988412871 5:30909721-30909743 CTTTGGGTATATACCCAGTAAGG - Intergenic
988637372 5:32999595-32999617 CTCTGGGTAGATACCTAGCAGGG + Intergenic
989304736 5:39940337-39940359 CTCTGGGTTGATACCCAGTATGG + Intergenic
989392628 5:40917627-40917649 CTTTGGCTATATACCCTGTAGGG + Intronic
989607575 5:43259254-43259276 CTTTGGGGAGATACCCAGTAGGG + Intronic
990067065 5:51729872-51729894 CTCTGGAAAGATACCCTTTGGGG - Intergenic
990090157 5:52035080-52035102 CTCTGGATATGTACTCAGGAAGG - Intronic
990770001 5:59232660-59232682 CTTTAGATAAACACCCAGTAGGG - Intronic
990859871 5:60314986-60315008 CTTTGGGTATATACCCAGTAAGG + Intronic
991172220 5:63641739-63641761 CTTTGGGTAGATACCCAGTAGGG + Intergenic
991239359 5:64439867-64439889 CTTTGGATATATTCCCAGAAAGG - Intergenic
991484987 5:67125752-67125774 CTTTGAGTATATACCCAGTAAGG + Intronic
992183361 5:74220085-74220107 CTTTTGGTATATACCCAGTATGG - Intergenic
992899122 5:81275714-81275736 CTCTGGGTAGATGCCCAATAGGG - Intergenic
993173825 5:84455966-84455988 ATCTAGATAGAAAACCAGTAAGG + Intergenic
993212658 5:84974259-84974281 CTTTGGCTAGATACCCAGGAGGG + Intergenic
994357356 5:98808825-98808847 CTCTGGATAAATGCCCATAATGG - Intergenic
994777708 5:104055868-104055890 CTCTGGGTCAATACCTAGTAGGG + Intergenic
995535667 5:113133626-113133648 TTTTGGATATATACCCAGTAAGG + Intronic
995668353 5:114570551-114570573 CTTAGAGTAGATACCCAGTAGGG + Intergenic
995816232 5:116171469-116171491 ATCTGGGTATATACCCAGTAAGG - Intronic
995974944 5:118023070-118023092 CTTTGGGTATATACCCAGAAGGG - Intergenic
996005364 5:118414599-118414621 CTTTGGATATATACCCTGCAAGG - Intergenic
996429378 5:123355285-123355307 CTTTGGGTATATACCCAGTAAGG + Intronic
996632252 5:125647875-125647897 CTCTGAATAGATACCCATAGAGG - Intergenic
996928596 5:128858958-128858980 ATTTGGGTATATACCCAGTATGG + Intronic
997140675 5:131376991-131377013 CTTTGGGTATATACTCAGTAAGG + Intronic
997186540 5:131887340-131887362 CTTTGGGTATATACCCAGTAAGG + Intronic
997887601 5:137644520-137644542 CTTTGGATGCATACCCAGTATGG + Intronic
999214549 5:149921166-149921188 CTGTGGAAAGAGACCCAGAAAGG - Intronic
999346292 5:150822770-150822792 CTTTGGGTATATACCCAATAAGG - Intergenic
1000215154 5:159148112-159148134 CTTTGGATATATACCCAGATAGG - Intergenic
1002681142 5:180965881-180965903 CTTTTGATATTTACCCAGTAGGG - Intergenic
1002935957 6:1672676-1672698 TTCTGGAAAGGTACCCAGTCTGG - Intronic
1003621657 6:7706064-7706086 CTGAGGAAAAATACCCAGTACGG - Intergenic
1003962104 6:11218441-11218463 CTTTGAATAGATACCCATTCTGG - Intronic
1004095979 6:12554824-12554846 CTTTGGGTATATACCCAGTAAGG - Intergenic
1005770879 6:29069804-29069826 CTCTGAGTAGATACCCAGTAAGG - Intronic
1005877878 6:30027802-30027824 CTCTGGGCAGATACCCATTGTGG - Intergenic
1006916661 6:37599041-37599063 CTTTGGGTATATACCTAGTAAGG + Intergenic
1008171781 6:48216664-48216686 CTCTGGGTTGATATCCAGTAGGG + Intergenic
1008463609 6:51805020-51805042 CTTTGGATATATACCCAGTAAGG - Intronic
1009232209 6:61076764-61076786 ATCTTGATGGATAACCAGTAAGG - Intergenic
1010079369 6:71841107-71841129 ATCTGGATAAATACCAAGCAAGG + Intergenic
1010195169 6:73232290-73232312 TTCTGGGTATATACCCAGTAAGG - Intronic
1011229654 6:85146102-85146124 CTTTGGATATATACCCAGTATGG + Intergenic
1011571461 6:88741087-88741109 CTTTAGATATATACCCAGTAAGG - Intronic
1011994266 6:93565600-93565622 CTTGGGGTATATACCCAGTATGG + Intergenic
1012454086 6:99385243-99385265 CACTGGATAGAAAACCAGCAGGG + Intronic
1012688835 6:102288126-102288148 CTTTTGATAAATACCCAGTAGGG - Intergenic
1014348689 6:120310583-120310605 CTTTAGATAGATACCCAGTAGGG + Intergenic
1014355393 6:120402547-120402569 TTTTGGATATATACCCAGCAGGG + Intergenic
1014423456 6:121272750-121272772 CTTTGGGTATATACCCAGTAAGG - Intronic
1014511781 6:122331434-122331456 CTTTGGGTATATACCCAGTATGG - Intergenic
1014581813 6:123147148-123147170 TTCTGGGTAGATACCCAGTAGGG - Intergenic
1014636312 6:123851195-123851217 CTTTGGATATATACTCAGTAGGG + Intronic
1015153706 6:130066426-130066448 CTCTGGATATCCACCCAGTTGGG + Exonic
1015281473 6:131439446-131439468 CTTTGGATATACACCCAGTAAGG - Intergenic
1020817028 7:12918173-12918195 TTTTGGGTAGATACTCAGTAAGG + Intergenic
1021057839 7:16072656-16072678 CTTTGGATATATACCCAGAGTGG - Intergenic
1021351288 7:19596980-19597002 CTTTGTATATATACCCAGTAAGG + Intergenic
1021365584 7:19773587-19773609 CGCTGGATAGAAGCCCAGAAAGG - Intronic
1021367412 7:19796906-19796928 CTTTGGATAAATATACAGTATGG + Intergenic
1023236438 7:38095166-38095188 CTTTGGGTATATACCCAGAAAGG - Intergenic
1023505280 7:40893264-40893286 ATCTGGAGAGAAAACCAGTAAGG + Intergenic
1024171592 7:46793234-46793256 CTTTGGATATATACCCAGAAGGG + Intergenic
1024742337 7:52367919-52367941 CTTTGGGTGTATACCCAGTAAGG + Intergenic
1024929120 7:54651342-54651364 CTCAGGATATAAACCAAGTAGGG + Intergenic
1024949951 7:54850197-54850219 CTTTGGGTATATACCCAGTATGG + Intergenic
1025966674 7:66279430-66279452 CTGTGGGTATATATCCAGTAAGG + Intronic
1026974951 7:74491828-74491850 CTTTGGGTATATACCCAGTAAGG + Intronic
1027349485 7:77296098-77296120 CTCTGGATAAATTTCCAGTAGGG + Intronic
1028045496 7:86112434-86112456 CTTTGGATATATAACCAGTAGGG + Intergenic
1028064800 7:86370111-86370133 CTTTGGATAAATATTCAGTAGGG + Intergenic
1028208654 7:88046066-88046088 CTTTGGATGCATACCCAGAAGGG + Intronic
1028348275 7:89811220-89811242 CTCTGGGTAGATACCCAGTAGGG - Intergenic
1028402401 7:90438299-90438321 CTCTGGGTAGATACCCAGCAGGG - Intronic
1028969572 7:96842726-96842748 CTTTGGATATATACCCAGTAAGG + Intergenic
1030522457 7:110615076-110615098 CTTTGGATATAAACCTAGTAGGG + Intergenic
1030813480 7:114005270-114005292 CCCTGGGTATATACTCAGTAAGG - Intronic
1031325474 7:120391416-120391438 TTCTGGGTATATACCCAGTAAGG + Intronic
1033626641 7:143116933-143116955 CTTTGGGTATATACCCAGTAAGG - Intergenic
1037159084 8:15745309-15745331 CTTTGGGTGTATACCCAGTAAGG + Intronic
1037257765 8:16974351-16974373 CTTTGGGTATATACCCAGTATGG + Intergenic
1037577444 8:20221106-20221128 CTCTGCTTGGAAACCCAGTAAGG - Exonic
1039173603 8:34778926-34778948 CTTTGGATATATACCCAGTATGG - Intergenic
1039400387 8:37264093-37264115 TTTTGGATAAATACCCAGTAGGG - Intergenic
1039807990 8:41018798-41018820 CTTTGGGTATATACCCAGTGAGG + Intergenic
1039809528 8:41033989-41034011 CTTTGGGTATATACCCAGTGAGG - Intergenic
1040357059 8:46628877-46628899 CTTTGGGTATATACCCAATAAGG - Intergenic
1040809842 8:51439881-51439903 CTCTGGGTAAATATCCAGTAGGG - Intronic
1041577586 8:59417671-59417693 CTTTTGGTAGACACCCAGTAGGG - Intergenic
1041763104 8:61387976-61387998 CTGTGGGTAGATACCGAGGAGGG + Intronic
1041900126 8:62973171-62973193 CTTTGGGTATACACCCAGTAGGG + Intronic
1042000466 8:64118025-64118047 CTTTAGATGAATACCCAGTAGGG - Intergenic
1043252003 8:78086712-78086734 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1043629793 8:82315521-82315543 TTTTGGGTATATACCCAGTAAGG + Intergenic
1043788414 8:84431890-84431912 CTTTGGTTATATACCCAGTGGGG + Intronic
1043816431 8:84807516-84807538 CTCTGGGTGGATACCCAGAGTGG + Intronic
1043840764 8:85101054-85101076 CTATAGATAATTACCCAGTAGGG + Intergenic
1044221732 8:89677754-89677776 CTTTGGGTGTATACCCAGTAAGG - Intergenic
1044440230 8:92215409-92215431 CTTTGGGTATATCCCCAGTAAGG + Intergenic
1046151066 8:110226760-110226782 CTTTGGATATATACCTAGAAAGG + Intergenic
1046188116 8:110749417-110749439 CTTTGGACATATACCCAGAAGGG - Intergenic
1046266796 8:111841051-111841073 ATTTGAATATATACCCAGTAGGG - Intergenic
1046751873 8:117934851-117934873 CTCAGGATAGAAAACCAGTTAGG + Intronic
1047383733 8:124388905-124388927 CTTTGGGTAGATACCCAGTAGGG + Intergenic
1048435878 8:134417064-134417086 CTTTGGGTATATACCCAGTATGG - Intergenic
1048860275 8:138719783-138719805 CACTGCTTAGATACACAGTACGG - Intronic
1049077823 8:140414010-140414032 CTTTGGGTATATACCCAGTAAGG + Intronic
1050368509 9:4896578-4896600 CTTTGGGTATATACCCAGTAAGG + Intergenic
1050761642 9:9079498-9079520 CTTTGGATAGATTCTCAGTAGGG + Intronic
1051567653 9:18518649-18518671 CTTTGGTTAGATACCCAGTGTGG + Intronic
1052694901 9:31865241-31865263 CTTTGGGTATATACCCAGTATGG + Intergenic
1052696308 9:31883661-31883683 CTTTGGGTATATATCCAGTATGG + Intergenic
1053879416 9:42576920-42576942 CTTTGGATATATACCCAGATGGG - Intergenic
1054232274 9:62524777-62524799 CTTTGGATATATACCCAGATGGG + Intergenic
1054995939 9:71389472-71389494 CTCTGGGTAGATACCCAGGAGGG - Intronic
1055283627 9:74703785-74703807 CTCTGGGTAGATACCTAATAGGG + Intergenic
1055585471 9:77754798-77754820 CTATGGAGATATAACCAGTATGG + Intronic
1055903009 9:81262703-81262725 CTTTGGCTATATACCCAGTATGG - Intergenic
1057238672 9:93389200-93389222 CTTAGGATAAATACCCAGAAAGG + Intergenic
1057752113 9:97801595-97801617 CTCTCAATACATTCCCAGTATGG + Intergenic
1058307955 9:103466252-103466274 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1059288228 9:113196721-113196743 CTCTGAATAGAGAGCCAGGAAGG + Intronic
1203412390 Un_KI270579v1:30882-30904 CTTTGGGCATATACCCAGTAAGG + Intergenic
1185686393 X:1932358-1932380 CTTTGGATAAATTCCCAGCAGGG + Intergenic
1186135018 X:6510400-6510422 CTTTGGGTATATACCCAGCAAGG - Intergenic
1186920901 X:14279122-14279144 CTTTGGATGAATACCCAATAGGG - Intergenic
1186941556 X:14513906-14513928 CTCTGGGTAGATGCCCAGTAAGG - Intergenic
1188194921 X:27221813-27221835 CTTTGAGTATATACCCAGTAAGG + Intergenic
1188289409 X:28369229-28369251 CTTTAAGTAGATACCCAGTAGGG + Intergenic
1188863275 X:35284429-35284451 CTTTGGATATATGCCCAGGAAGG - Intergenic
1189017960 X:37303714-37303736 CTCTGGGTATATAACCAGTATGG + Intergenic
1189573631 X:42326357-42326379 CTCTGGGTATATGCCCAGTAAGG - Intergenic
1189660781 X:43295987-43296009 CTTTGGGTATATACCCAGAATGG - Intergenic
1190505602 X:51123049-51123071 CTTTGGATATATATCCAGAAGGG + Intergenic
1190587352 X:51959865-51959887 CTTTGGGTATATACCCAGTAAGG + Intergenic
1190591609 X:52008238-52008260 CTTTGGGTATATACCCAGTAAGG + Intergenic
1191058425 X:56268304-56268326 CTTTGGATATATACCCAGAAGGG + Intronic
1191072254 X:56412856-56412878 CTTTGGGTATATATCCAGTAAGG + Intergenic
1191205780 X:57832917-57832939 CTTTGGGTATATACCCAGTAAGG - Intergenic
1191597469 X:62961260-62961282 CTTTGAGTATATACCCAGTAAGG + Intergenic
1191789469 X:64953809-64953831 CTTTGGGTATATACCCAGTAAGG - Intronic
1192015903 X:67330599-67330621 CTTTGGGTACATACCCAGTAGGG - Intergenic
1192075266 X:67988648-67988670 CTTTGGATAGATATCCAGTGGGG - Intergenic
1192812459 X:74559417-74559439 CTCTGGATTGATTGCCAGTGAGG - Intergenic
1192987339 X:76414453-76414475 CTGTGGGTAGATACCTAGTAGGG - Intergenic
1193190683 X:78566546-78566568 CTTTTGGTAGATACCCAGTGAGG + Intergenic
1193299170 X:79868469-79868491 CTCTTGATAGATAACCAGTGTGG - Intergenic
1193303060 X:79915744-79915766 CTCTGGGTAGATACCCATAGTGG + Intergenic
1193446521 X:81611578-81611600 CTCTGGATAGATACCCAGAGTGG + Intergenic
1193616791 X:83698482-83698504 CCCTGGGTAGATTTCCAGTAGGG + Intergenic
1194009506 X:88542727-88542749 CCCTGCAAAGATAACCAGTATGG - Intergenic
1194096450 X:89645425-89645447 TTTTGGATATATACCCAGTAAGG - Intergenic
1194264146 X:91734532-91734554 CTCTGGGTAGATACCCAGTAGGG + Intergenic
1194588795 X:95771217-95771239 CTTTGGATATATACCCAGTAAGG - Intergenic
1194990062 X:100537626-100537648 CTTTGGGTATATACCCAGTAAGG + Intergenic
1195173157 X:102288689-102288711 TTTTGGGTAGATACCCGGTAGGG + Intergenic
1195185709 X:102398406-102398428 TTTTGGGTAGATACCCGGTAGGG - Intronic
1195223680 X:102770437-102770459 CTTTGGATATATACTCAGAAGGG + Intergenic
1195501530 X:105606542-105606564 CTTTGGATATATATCCTGTAGGG - Intronic
1195641450 X:107179722-107179744 CTTTGTATAGATACCCAGCGTGG + Intronic
1196531370 X:116790838-116790860 CTTTGGGTATATACCCAGTAAGG - Intergenic
1196887870 X:120264511-120264533 CACTGGACAGCTACCCAATAAGG + Intronic
1197102944 X:122678148-122678170 CTCTGGGTAGATACCTGGTAGGG - Intergenic
1197274285 X:124460219-124460241 CTTTGAGTATATACCCAGTAAGG - Intronic
1197615831 X:128690554-128690576 CTTTGGGTATATACCCAATAAGG + Intergenic
1197958153 X:131975165-131975187 CTCTGGGTAGATACCCAGTATGG + Intergenic
1198585100 X:138111672-138111694 CTTTGTATAAATACTCAGTAGGG - Intergenic
1198672683 X:139098362-139098384 CCTTGGGTATATACCCAGTAGGG - Intronic
1199090191 X:143682121-143682143 ATCTGGGTATATAACCAGTAAGG + Intergenic
1199490477 X:148393438-148393460 CTTTGGATAGGTACCTAGTAGGG - Intergenic
1199588841 X:149446638-149446660 CTGTGGCTATATACCCAGTAAGG + Intergenic
1199673302 X:150164362-150164384 CTCTGCAAAGATCCCCAGTTAGG + Intergenic
1200449462 Y:3306807-3306829 TTTTGGATATATACCCAGTAAGG - Intergenic
1200538255 Y:4425735-4425757 CTCTGGGTGGATACACAGCAGGG + Intergenic
1200717258 Y:6562251-6562273 CTTTGGGTAGATACCCAGTAGGG - Intergenic
1201192257 Y:11454978-11455000 TTTTGGATATATATCCAGTAAGG + Intergenic
1201244439 Y:11989113-11989135 CTTTGGGTATATACCCAGTAAGG + Intergenic
1201364643 Y:13190172-13190194 CTTTTGGTATATACCCAGTAAGG + Intergenic
1201535356 Y:15041947-15041969 CTTGGGGTATATACCCAGTAAGG + Intergenic
1201535925 Y:15048209-15048231 CTTTGGCTATATACCCAGTAAGG + Intergenic