ID: 1146584676

View in Genome Browser
Species Human (GRCh38)
Location 17:34071908-34071930
Sequence ATGTCTAAGTGGAAGGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146584676 Original CRISPR ATGTCTAAGTGGAAGGATGA AGG Intronic
900531870 1:3157883-3157905 AGGTTTAAGTGGGAGGAAGATGG - Intronic
901393380 1:8963030-8963052 ATGTCCAAGTGGTATGACGAGGG - Intronic
901700219 1:11041321-11041343 ATGGGTAGGTAGAAGGATGATGG + Intronic
903169157 1:21541479-21541501 GTCGCTAGGTGGAAGGATGATGG - Intronic
904929001 1:34071597-34071619 ATGACTTAGTGGAAGGTAGATGG - Intronic
908455247 1:64297086-64297108 AGGTCTCAGGGTAAGGATGAGGG - Intergenic
908742618 1:67344067-67344089 AGGTTCAGGTGGAAGGATGATGG + Intronic
909754263 1:79203797-79203819 ATGTCTAAAGAGAAGGATCAGGG + Intergenic
909864106 1:80644791-80644813 ATGATTAAGTGTAAGGATGTAGG - Intergenic
911030093 1:93478443-93478465 GAGCCTAAGTGGAATGATGAGGG + Intronic
911045963 1:93628564-93628586 ATGTCTAAGGGGAAGAAGAAGGG - Intronic
913275804 1:117136743-117136765 ATCACTAATTGGAAGTATGAAGG + Intergenic
913428144 1:118757851-118757873 ATGTTTGGGTGGATGGATGAAGG + Intergenic
913666166 1:121050814-121050836 TTGTCTAAGTGAAAGGAAGGTGG - Intergenic
914017566 1:143834090-143834112 TTGTCTAAGTGAAAGGAAGGTGG - Intergenic
914327220 1:146631122-146631144 TTCTCTACGTGGAAGGAGGAAGG + Intergenic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
914513218 1:148352591-148352613 AGTTCCAAGTGGAAGGATCATGG - Intergenic
914656177 1:149742622-149742644 TTGTCTAAGTGAAAGGAAGGTGG - Intergenic
915054958 1:153119749-153119771 TTGTCTAAGTGGAACAGTGAAGG - Intergenic
920503421 1:206499849-206499871 GGGCCTAACTGGAAGGATGAGGG + Intergenic
920526153 1:206668069-206668091 TTCTCTGAGTGGCAGGATGAAGG + Intronic
923546290 1:234925898-234925920 ATGTCTCAGTGGAAGAACTATGG + Intergenic
1063797957 10:9534353-9534375 ATTTCTAATTGGAATGAAGATGG + Intergenic
1063838370 10:10042448-10042470 TTGTCTGAGTGGAAGGAAGCTGG - Intergenic
1065017437 10:21475075-21475097 ATTTCTGAGTTAAAGGATGAGGG + Intergenic
1065275991 10:24086077-24086099 ATTTCTAAGTAGGAGGCTGAGGG - Intronic
1066477188 10:35759036-35759058 ATGTCTGAGTGAATAGATGAAGG + Intergenic
1067051489 10:43024059-43024081 ATGGATAAATGGATGGATGATGG + Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067758265 10:49023421-49023443 ATGTTTCAGTGGAAGGTTTAAGG + Intronic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1070624892 10:78043961-78043983 ATGCCTATGTGGAAGGGAGAGGG - Intronic
1071231951 10:83598225-83598247 ATAGCTAAGGGGAAGGATGTGGG - Intergenic
1071427877 10:85577473-85577495 TTTTCTAAGTGGACGGATGATGG + Intergenic
1072542508 10:96409174-96409196 ATGGATATGTGGATGGATGAGGG - Intronic
1073011251 10:100361492-100361514 ATGTATGAATGTAAGGATGAGGG + Exonic
1073216893 10:101841350-101841372 ATGCCTAAGCTGAAGCATGAAGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075412303 10:122237563-122237585 ATTTATAAGTGGCAGGAAGAGGG - Intronic
1078417970 11:11181141-11181163 ATTTCTTAGTGGAATGTTGAAGG - Intergenic
1078444512 11:11394199-11394221 TTGTCTCAATGGATGGATGAAGG + Intronic
1079316159 11:19409556-19409578 CTTTCTAAGTGGAATGGTGAAGG + Intronic
1080161644 11:29183795-29183817 ATATATAAGTGGAAGGATGTTGG + Intergenic
1080399953 11:31924623-31924645 ATCTTTAGGTGGTAGGATGATGG - Intronic
1084494982 11:69498341-69498363 ATGTGTAGGTGGAAGGGTGCAGG + Intergenic
1084705120 11:70811622-70811644 ATGGATGAGTGGATGGATGATGG - Intronic
1084785637 11:71440319-71440341 ATGGGTAAATGGATGGATGACGG + Intronic
1085179415 11:74521020-74521042 ATGGCCAAGAGGCAGGATGAGGG + Intronic
1085861668 11:80243084-80243106 ATGTGTGAGTGGCATGATGATGG - Intergenic
1086145063 11:83542656-83542678 ATGTATGAGTGGCAGCATGAGGG + Intronic
1086221467 11:84449887-84449909 AAGTCTAATTGAAAAGATGATGG + Intronic
1089166396 11:116480576-116480598 ATGTATAGATGGATGGATGAAGG + Intergenic
1090393069 11:126402065-126402087 GTGTCTAGGTGGAAGGATTTGGG + Intronic
1090505903 11:127313136-127313158 ATTTCTAATTGGAAAGATGTAGG - Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091095653 11:132819700-132819722 ATTTCTGAGTTGTAGGATGAGGG + Intronic
1091096859 11:132831532-132831554 ATGTCTAAGTAGAGGGAAAATGG - Intronic
1092040790 12:5382443-5382465 ATGTGTAAGGGCAAGGATGGAGG + Intergenic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093634061 12:21443228-21443250 AATTCTAAGTGGAAGGAAAATGG - Intronic
1094077260 12:26491033-26491055 ATGCATAAGAGGAAGGATGGAGG + Intronic
1094122203 12:26986379-26986401 ATTTCTAAGAGGAAACATGAGGG - Intronic
1094680193 12:32660703-32660725 AGGTCCAAGTGGAACGATGATGG + Intergenic
1096127818 12:49132573-49132595 TTGTCTAAAATGAAGGATGAAGG - Intergenic
1097787934 12:63781317-63781339 TTGTCTAATTGGAAGGAGAAAGG - Intronic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1098205201 12:68101829-68101851 ATGACAGAGTGGATGGATGAAGG - Intergenic
1099080279 12:78170264-78170286 CTGGCTAAATGGAAGGATGGTGG - Intronic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1102988423 12:117297376-117297398 TTGGGTAAGTGGAAGGATGGTGG + Intronic
1103635322 12:122299942-122299964 ATTTCTAAGTGGAAGAATTGGGG - Intronic
1104896102 12:132164584-132164606 ATGGCTAGGTAGACGGATGATGG - Intergenic
1104896220 12:132166305-132166327 ATGGCTGGGTGGATGGATGATGG - Intergenic
1104896271 12:132166523-132166545 ATGGCTGGGTGGATGGATGATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107725116 13:43291532-43291554 ATGTCTAGGAGGAAGGACAAGGG - Intronic
1108241923 13:48474116-48474138 ATGTCTAAGTGCTAGGAAGGTGG - Intronic
1108375343 13:49808957-49808979 ATTTCTGTGTGGAAGGTTGAAGG + Intergenic
1110125066 13:71932381-71932403 AGGTTTCAGTGGAAAGATGATGG + Intergenic
1110509855 13:76336696-76336718 ATGTATAATTGGAAGAATGCTGG - Intergenic
1112484151 13:99804630-99804652 ATGCCTTAGTTGAAAGATGAGGG - Intronic
1112983750 13:105420484-105420506 ATGTCAATGTGTAAGGATGATGG - Intergenic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1116132855 14:40881010-40881032 ATTTCTAAGAGGAAACATGAGGG + Intergenic
1117960469 14:61156800-61156822 CTGTCTAGGTGAAAGGATTAGGG + Intergenic
1118712490 14:68533566-68533588 ATGTCACAGTGGAGGGATGAGGG + Intronic
1123831188 15:24139431-24139453 ATGTCTCAGTGGAGTAATGATGG + Intergenic
1123836138 15:24195157-24195179 ATGTCTCAGTGGAGTAATGATGG + Intergenic
1126683254 15:51224652-51224674 ATGACTAATTGGAAGGAAGCAGG - Intronic
1126920171 15:53512542-53512564 ATGTCTTAGGGAAAGGATGAAGG + Intergenic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1128518954 15:68362821-68362843 ATGAATTAGTGGATGGATGATGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129241317 15:74253815-74253837 ATCTCTACATGGAAGAATGAGGG + Intronic
1130033691 15:80339414-80339436 CTGTCTACTTGGAAGGAAGAAGG + Intergenic
1131652728 15:94419414-94419436 AGGTATAAGTGGAAATATGAAGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133719805 16:8484256-8484278 TTGTCTTAGTGGAAGGAACAAGG + Intergenic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1135086494 16:19478794-19478816 ATGGGTAAATGGATGGATGATGG - Intronic
1135629368 16:24023780-24023802 ATGGGTAAGTGGAAGGTTGGGGG - Intronic
1135840292 16:25870059-25870081 ATGCATAAGTGGATGAATGATGG - Intronic
1137992375 16:53171916-53171938 ATTTCTAATTGGTGGGATGAGGG - Intronic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140006340 16:71079817-71079839 TTCTCTACGTGGAAGGAGGAAGG - Intronic
1140962590 16:79930901-79930923 AAGGCCAAGTGGATGGATGATGG - Intergenic
1143337636 17:6185241-6185263 AAATCCAAGGGGAAGGATGAAGG - Intergenic
1144318677 17:14090705-14090727 ATGTCAAAGTTGAAGACTGAAGG - Intronic
1144534604 17:16075881-16075903 GTGGCTGAGTTGAAGGATGAAGG - Intronic
1144993084 17:19247489-19247511 ATCCCTAAGTGGAAGGCAGATGG + Intronic
1145184984 17:20786286-20786308 ATGTATGAATGTAAGGATGAGGG + Intergenic
1145413847 17:22695962-22695984 ATAGCTAACTGGAAGGATGGAGG - Intergenic
1145414320 17:22702803-22702825 ATAGCTAACTGGAAGGATGGAGG + Intergenic
1146006282 17:29162740-29162762 ATGGGCAGGTGGAAGGATGATGG + Intronic
1146584676 17:34071908-34071930 ATGTCTAAGTGGAAGGATGAAGG + Intronic
1146657582 17:34644098-34644120 CTGTCCAAGAGGATGGATGAAGG - Intergenic
1146820913 17:35983033-35983055 ATGTGTGGATGGAAGGATGAAGG - Intergenic
1148235987 17:45969479-45969501 ATGTATAATTGGATGGATGATGG - Intronic
1148550380 17:48546766-48546788 AAGTCTGAGTAGAAGCATGAGGG + Intergenic
1152310324 17:79546007-79546029 TTGTCCAAGTGGTAGCATGATGG - Intergenic
1155926196 18:31658305-31658327 ATGTCTGTGTGCAAGGATAAGGG - Intronic
1156497398 18:37534993-37535015 ATGTCTACATGGCAGGCTGACGG + Intronic
1156544059 18:37946226-37946248 TTTTCTAAGTGGGAGGAAGAAGG - Intergenic
1158220007 18:55140653-55140675 ATGTCTAGCCGGAATGATGAGGG + Intergenic
1158276981 18:55779803-55779825 ATCTCTAAGTGGAAAAATCACGG + Intergenic
1158293947 18:55973052-55973074 GGGTTTATGTGGAAGGATGAAGG - Intergenic
1160254512 18:77236455-77236477 ATCTCTAAGTGGAAGGATTTAGG - Intergenic
1161347723 19:3776504-3776526 ATGGGTATGTGGATGGATGATGG + Intergenic
1161449122 19:4334806-4334828 ATGGATGAGTGGATGGATGATGG - Intronic
1161449198 19:4335151-4335173 ATGAGTAGGTGGATGGATGATGG - Intronic
1161449213 19:4335220-4335242 ATGAGTAGGTGGATGGATGATGG - Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161681420 19:5681551-5681573 ATGGATGAGTGGAAGGATGGGGG - Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1161934658 19:7364264-7364286 ATGGATAAATGAAAGGATGAAGG + Intronic
1162085825 19:8248597-8248619 ATGGGTAGGTGGATGGATGATGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1164678878 19:30120987-30121009 ATGGGTAGGTGGATGGATGATGG - Intergenic
1164797309 19:31044515-31044537 ATGGCTGAATGGATGGATGAAGG + Intergenic
1165973950 19:39658047-39658069 ATGTCTAATTGGCAGGATGGAGG + Intronic
1167703011 19:51061673-51061695 ATGTAAAAGTGGAAGGATTTAGG - Intronic
1168084316 19:54034299-54034321 AGGTCAAAGTGGGAGGATCATGG - Intergenic
1168259550 19:55185814-55185836 ATGTCACAGGGGAAGGCTGAGGG + Intronic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925738571 2:6985469-6985491 ATGAGTAAGTGGAAGGATTAGGG + Intronic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927581098 2:24248514-24248536 ACCTCTAAGTGGAATGATTATGG + Intronic
927670126 2:25061904-25061926 ATTTCTAGGTGGAAGGATCATGG + Intronic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929331698 2:40690112-40690134 GTGTCTATGTGTATGGATGAAGG + Intergenic
930031764 2:47062481-47062503 ATGTCTAAATTGAGGGAGGAAGG - Intronic
931957783 2:67447393-67447415 GTGTCTAAGTGGAAGGGAGATGG - Intergenic
932122663 2:69115851-69115873 ATGTCTAAGGAAAAGGATGGTGG + Intronic
932397158 2:71456073-71456095 ATGTGTAAATGGGAGGATGCAGG - Intronic
932450514 2:71807744-71807766 GGGTATAAGTGGAAGGATGAAGG + Intergenic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
934575344 2:95397105-95397127 TTGTTTCAGTGGAAGGATGGGGG + Intergenic
934890938 2:98068550-98068572 ATCTCCAAATGGAAGGATAATGG - Intergenic
936613926 2:114029160-114029182 ATGTCTCAGTGGTAGAAGGAAGG + Intergenic
939430489 2:142099681-142099703 ATGTCTAAGCCTAAGAATGAAGG - Intronic
940137977 2:150460765-150460787 ATATCTAAGTTGAACCATGAAGG + Intergenic
940160739 2:150710613-150710635 AGCTCTAATTGGAAGGTTGATGG - Intergenic
940673422 2:156698678-156698700 AAGTCTGGGTGGAAGGATGAGGG - Intergenic
942180801 2:173378738-173378760 ACTTGTAAGTGGAAGGATTATGG - Intergenic
944880608 2:204009100-204009122 AAATCTATGTGGGAGGATGAGGG - Intergenic
946592138 2:221262462-221262484 TTGCATAAGGGGAAGGATGAAGG - Intergenic
946952364 2:224891056-224891078 ATGTCTAGAAGGATGGATGATGG + Intronic
947777458 2:232724952-232724974 ACTTCTAAGTGGTAGGATTATGG - Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948532004 2:238614926-238614948 ATGGATAAGTGGATGGATGGGGG - Intergenic
1169000826 20:2166748-2166770 TCGTCTGAGTGGAATGATGAAGG - Intronic
1169149640 20:3279165-3279187 AATTCTAAGTGGAATGCTGAAGG + Intronic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1175131324 20:56791834-56791856 GTGTCTTAATGGGAGGATGAAGG - Intergenic
1176991198 21:15498217-15498239 ATATCCAAGTGGAAGTTTGAAGG - Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1179429104 21:41306899-41306921 ATGTCAAATGGGAAGGAGGAAGG - Intronic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1181537129 22:23552219-23552241 ATGAATAAGAGGATGGATGACGG - Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181857376 22:25791753-25791775 GTGCCCAAATGGAAGGATGAGGG + Intronic
1184258456 22:43300871-43300893 ATGTCTAAGTTGGAGGGTGGTGG - Intronic
1185053601 22:48566514-48566536 ATGGGTGAGTGGAAAGATGAAGG + Intronic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
949131256 3:503699-503721 ATGTCCAAGAGGAAGCATTAAGG - Intergenic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
951093485 3:18601507-18601529 ATATCAAATTGGAAGGAAGAGGG + Intergenic
952688648 3:36177776-36177798 ATGTCTAAGTGGGAGGTTCCTGG - Intergenic
953531157 3:43740830-43740852 ATGGTTAAGTGGATTGATGATGG - Intergenic
954745781 3:52786878-52786900 ATGGATAGGTGAAAGGATGAGGG + Intronic
955619035 3:60841735-60841757 ATGCCTAAGGGAAAGGATGCAGG + Intronic
957154629 3:76532128-76532150 AGGTCTAATTGGGAGGAGGAAGG - Intronic
958033635 3:88146040-88146062 ATTTCAAAGTCAAAGGATGAAGG + Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
959144091 3:102523339-102523361 ATGTCTAAGTGGTAAGAAAAGGG - Intergenic
959821383 3:110739250-110739272 AGGTCTCGGGGGAAGGATGATGG - Intergenic
960211167 3:114968440-114968462 ATGTCCAAGTGGACAGCTGATGG + Intronic
961785111 3:129342962-129342984 TTGTCCAAGTGGACAGATGAAGG - Intergenic
963944969 3:151135706-151135728 ATCTCTAGGTGGAAAGATGCTGG + Intronic
965485489 3:169273411-169273433 ATTTCTATGTGGAAGCATGATGG - Intronic
967226826 3:187299818-187299840 ATGTCTAAGTCCAAGGCTGAAGG - Intergenic
967374755 3:188788413-188788435 ATGTCTAAATGGAGGCCTGAAGG - Intronic
968320857 3:197766974-197766996 ATCTCTAGGTGGTAGGCTGATGG + Intronic
968779620 4:2570656-2570678 ATGTCTAGGTGCAAGGCTGTGGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
969612280 4:8234121-8234143 ATGGATAAATGGATGGATGATGG - Intronic
969624393 4:8294959-8294981 ATGGGTAAATGGATGGATGATGG - Intronic
971607421 4:28676047-28676069 ATGTGGTAGTGTAAGGATGAAGG + Intergenic
971802953 4:31316586-31316608 ATGTCCGAGAGGAAGGATAATGG + Intergenic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974604446 4:64132788-64132810 ATGTCTGAGTTCAAGGATTAAGG + Intergenic
975245281 4:72113403-72113425 ATGGCTAAATGGATTGATGAAGG - Intronic
975663907 4:76715049-76715071 ATGTTGAAGTGGGAGGTTGATGG + Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
977722564 4:100257071-100257093 ATCTGTAAGTGAAAGGATTATGG - Intergenic
977784265 4:101014930-101014952 AGGTCAAAGAGAAAGGATGAAGG - Intergenic
977993648 4:103476209-103476231 ATGACTAAGAGGAAGCATCAGGG + Intergenic
978927037 4:114259333-114259355 ATGGGTAAGTGCAATGATGAGGG + Intergenic
981497149 4:145407008-145407030 TTGGCTAAGTGGAAAGCTGAGGG + Intergenic
981935760 4:150238153-150238175 ATCTCTAAGTGGTAGCATGAAGG - Intronic
982629633 4:157815778-157815800 ATATCTAAGTAGTAGGATTATGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
983369397 4:166839820-166839842 GTGTCTGAGTGACAGGATGATGG - Intronic
984290399 4:177787206-177787228 AGTTCTAAGTGGAAGGAGTAGGG + Intronic
985263208 4:188134463-188134485 ATGTCTATGTAGTAAGATGAAGG + Intergenic
987158502 5:15115283-15115305 ATTTCTCATTGAAAGGATGATGG - Intergenic
987191247 5:15480648-15480670 AGGACTAAGAGGAAGGATGTGGG - Intergenic
987517523 5:18932408-18932430 ATGGCTAAGAGAGAGGATGATGG + Intergenic
989295842 5:39825642-39825664 AAGAGTAAGTGGAAGGATAAAGG + Intergenic
992436999 5:76763933-76763955 AAGTCTGAGTGGAAGCATGGAGG - Intergenic
992459101 5:76943747-76943769 ATCTCTAAGGTGAAGGATGTGGG - Intergenic
992887769 5:81176102-81176124 ATGTCTGATTGGAAGCATGTTGG - Intronic
993633216 5:90313059-90313081 AAGTCCCAGTGGAAGGCTGAAGG + Intergenic
993759384 5:91774232-91774254 ATCCATAAGAGGAAGGATGATGG - Intergenic
994800688 5:104370500-104370522 ATGACTAAGCTGAAGCATGAAGG - Intergenic
996581289 5:125034913-125034935 ATCTCTAAGTGGGAGGAGAAGGG - Intergenic
996929426 5:128868554-128868576 ATGGCTAAGGTGAAGGATGAAGG + Intronic
998756779 5:145390182-145390204 ATATCTCAGTTGAAGCATGAAGG + Intergenic
998826490 5:146106817-146106839 TTGTCTAAGTGCAATGAAGATGG + Intergenic
998961113 5:147488094-147488116 CTATCTAAGTGGCAGGATGTGGG + Intronic
999864694 5:155687963-155687985 ATATATTATTGGAAGGATGAGGG + Intergenic
1001672556 5:173486254-173486276 ATGTATACATGGTAGGATGATGG + Intergenic
1001987868 5:176091018-176091040 ATGTGTATGTGGAAGTATGTTGG + Intronic
1002118041 5:176980135-176980157 ATGGCTCAGTGGAAGTCTGAAGG - Intronic
1002229004 5:177747123-177747145 ATGTGTATGTGGAAGTATGTTGG - Intronic
1002266342 5:178036660-178036682 ATGTGTATGTGGAAGTATGTTGG + Intronic
1003062429 6:2874217-2874239 ATTTGTAAGTGGCAGAATGAGGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003945949 6:11076025-11076047 TTGTTTAAATGGAAGGATGCAGG + Intergenic
1008155391 6:48008089-48008111 ATTTCTAAGTGGCAGCAGGAAGG + Intronic
1008695246 6:54028457-54028479 ATGTCATAGTGGGAGGCTGAAGG + Intronic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1010732164 6:79402843-79402865 GTGTCTGAGTGGAAGAAGGAAGG - Intergenic
1010942404 6:81934138-81934160 TTGTGTAAGTGGACAGATGAAGG - Intergenic
1011755220 6:90491917-90491939 AAGTCTAAGTTTAAGGAGGAAGG - Intergenic
1014002475 6:116380259-116380281 ATGTCTAGGTGGAGGGAAGAGGG + Intronic
1017117222 6:150989235-150989257 GTATCTAAGTGGAATGATAAAGG + Intronic
1017679674 6:156850920-156850942 ATCTGTGAGTGGAAAGATGATGG - Intronic
1018452299 6:163920257-163920279 ATGGCAAAACGGAAGGATGATGG - Intergenic
1019567286 7:1690608-1690630 ATGGATAAATGGATGGATGAAGG + Intronic
1019715849 7:2538964-2538986 ATGTCTAAGTGGAGGGGTGCTGG + Intronic
1019950932 7:4371874-4371896 ATCTTTAAGTGAAAAGATGAGGG + Intergenic
1021275755 7:18648755-18648777 GTGTCTAAGAGGAATGTTGATGG + Intronic
1021644192 7:22771877-22771899 ATCTCAAGGTGGAACGATGAGGG + Intergenic
1021862577 7:24921683-24921705 ATGTCTCAGTGGGAGTAGGATGG - Intronic
1022920970 7:35014435-35014457 GAGTCTAAGTGGCAGTATGAGGG + Intronic
1026159302 7:67854514-67854536 CTGACTAAGTGAAAGGAGGAAGG - Intergenic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1028720973 7:94031162-94031184 GTGTGCAACTGGAAGGATGAAGG - Intergenic
1030494564 7:110282571-110282593 ATGTCTAAATGGGGAGATGATGG - Intergenic
1030564234 7:111132818-111132840 ATGTCTGAGTGAAAGAAAGAAGG + Intronic
1030665306 7:112271336-112271358 ACTTCAAAGAGGAAGGATGAGGG - Intronic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032667279 7:134049296-134049318 ATGGGTGAGTGGAAGGATGAAGG - Intronic
1032872397 7:136000391-136000413 ATGAATGAGTGAAAGGATGAAGG - Intergenic
1033580084 7:142724967-142724989 ATTTTGAAGTAGAAGGATGAAGG + Intergenic
1034069476 7:148169413-148169435 AAGTCTAATTGCTAGGATGAAGG - Intronic
1034864287 7:154627680-154627702 ATGCGGAAGTTGAAGGATGATGG - Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035288593 7:157822487-157822509 ATATATAGGTGGATGGATGATGG - Intronic
1036658872 8:10694980-10695002 ATGGATAAGTGGAAGGATGATGG + Intronic
1036918059 8:12823971-12823993 TTGTTTTAGTGGAAGGATCATGG + Intergenic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038528944 8:28301307-28301329 ATTTTTAAATGGAAGAATGATGG - Intergenic
1038679426 8:29653070-29653092 ATGAGTAAATGGATGGATGATGG - Intergenic
1041517821 8:58721195-58721217 ATGGCTTAGTGGAAGGAGCAAGG + Intergenic
1043437640 8:80250076-80250098 ATGAATAAGTGGATGAATGAAGG - Intergenic
1043487870 8:80716192-80716214 GTGTCTATGATGAAGGATGAAGG - Intronic
1044211714 8:89558442-89558464 ATATCCAGGTGGATGGATGATGG + Intergenic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045467149 8:102480792-102480814 CTCTCTAAGTGGAATGATGACGG + Intergenic
1046548547 8:115682919-115682941 ATGTTCCAGTGGAATGATGAGGG + Intronic
1046631750 8:116628701-116628723 GAGCCTAAGTGGAAGGCTGATGG - Intergenic
1046701720 8:117408153-117408175 ATATATAAGTGGAAGGAAAAAGG + Intergenic
1048995657 8:139792287-139792309 ATGCCTAAGTGGCATGCTGAGGG + Intronic
1049348396 8:142151241-142151263 ATGGATAAGTGGATGGGTGATGG + Intergenic
1049371963 8:142272265-142272287 GTGGCTAGGTGGAAGGAGGAAGG - Intronic
1050691745 9:8234913-8234935 ATGTTTAGGAGGTAGGATGAAGG - Intergenic
1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG + Intronic
1051746680 9:20301400-20301422 ATGTCTAGGTGGTAGGGTTATGG - Intergenic
1052357696 9:27522357-27522379 ATCTCTAACTGGAAGAATAATGG - Intronic
1052795873 9:32922985-32923007 ATTTCTGGGTGGAGGGATGATGG - Intergenic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1056180575 9:84078584-84078606 ATGCCCAAGAGGAAGGCTGAAGG + Intergenic
1057009236 9:91586983-91587005 TAGTCTAAGTGGGAGCATGAGGG - Intronic
1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG + Intronic
1057908132 9:98998197-98998219 ATCTCTGAGTGGTAGGATTATGG + Intronic
1059931200 9:119262831-119262853 AAGTCTAAGTAAAAGCATGAAGG - Intronic
1060040925 9:120300282-120300304 ATGAGTCAGTGGATGGATGATGG + Intergenic
1060274068 9:122169020-122169042 ATGTCCAAGGGCAAGGAAGATGG + Intronic
1061846718 9:133392448-133392470 GTGGGTAAGTGGATGGATGATGG + Intronic
1062520725 9:136956815-136956837 ATGGATAAATGGATGGATGAAGG + Intronic
1185497532 X:566589-566611 ATGGATAAATGGATGGATGATGG + Intergenic
1185611452 X:1395783-1395805 ATGTATAGATGGATGGATGATGG + Intergenic
1186335477 X:8582472-8582494 AAGTCTAAGAGGAAGGAGAAAGG + Intronic
1186615085 X:11177759-11177781 ATGTAAAAGTGGAATGATGGGGG - Intronic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1187404104 X:18986843-18986865 AAGTCTCTGTGGCAGGATGATGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188136318 X:26498815-26498837 TGGTCTAAGTGGAAAGGTGAGGG + Intergenic
1190618238 X:52260676-52260698 AGTGCTAAGTGGAAGGGTGAGGG + Intergenic
1190792816 X:53715849-53715871 ATGGCTAAGTGGTAGGACCAAGG - Intergenic
1192630254 X:72772077-72772099 ATGTGTAAGTTGAAAGATTAAGG - Intergenic
1192651456 X:72948727-72948749 ATGTGTAAGTTGAAAGATTAAGG + Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1195476120 X:105287766-105287788 TTGTCTAATTGGAAGGATTGTGG + Intronic
1196369965 X:114966546-114966568 ATGTCTCTGTTGAAGCATGATGG + Intergenic
1198013494 X:132584629-132584651 ATGTCCATGTGGATAGATGAAGG - Intergenic
1201428075 Y:13875822-13875844 AAGTCTAAGAGGAAGGAGAAAGG - Intergenic