ID: 1146588058

View in Genome Browser
Species Human (GRCh38)
Location 17:34100087-34100109
Sequence CCTGCAGACCACCAAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146588048_1146588058 27 Left 1146588048 17:34100037-34100059 CCTCTGACCAGGCCACATTCTCT 0: 1
1: 1
2: 2
3: 31
4: 280
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588055_1146588058 -7 Left 1146588055 17:34100071-34100093 CCGCAAACACATTGTCCCTGCAG 0: 1
1: 0
2: 0
3: 18
4: 183
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588054_1146588058 0 Left 1146588054 17:34100064-34100086 CCAGGAACCGCAAACACATTGTC 0: 1
1: 0
2: 1
3: 5
4: 81
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588049_1146588058 20 Left 1146588049 17:34100044-34100066 CCAGGCCACATTCTCTCACCCCA 0: 1
1: 0
2: 1
3: 37
4: 357
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588053_1146588058 1 Left 1146588053 17:34100063-34100085 CCCAGGAACCGCAAACACATTGT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588052_1146588058 2 Left 1146588052 17:34100062-34100084 CCCCAGGAACCGCAAACACATTG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228
1146588051_1146588058 15 Left 1146588051 17:34100049-34100071 CCACATTCTCTCACCCCAGGAAC 0: 1
1: 1
2: 1
3: 35
4: 498
Right 1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG 0: 1
1: 0
2: 2
3: 18
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146588058 Original CRISPR CCTGCAGACCACCAAAGAGC AGG Intronic
900889782 1:5441566-5441588 CCTGCAGACCCTCAAATACCAGG + Intergenic
902530505 1:17087753-17087775 CCTTCAGACCCCCAAAGTGCTGG + Intronic
906279395 1:44543048-44543070 CCTGGAGACCATCGGAGAGCTGG + Intronic
909587145 1:77302647-77302669 CCTGTATACCTCCAAACAGCAGG - Intronic
912136394 1:106664577-106664599 CATGAAAACCAACAAAGAGCAGG + Intergenic
912474616 1:109927681-109927703 CCTGGAGACCACCTTAGGGCTGG - Intronic
912769641 1:112451883-112451905 CTTGCAGAGCCCCAAAGAGATGG - Intronic
913479868 1:119277792-119277814 CATGCTGACCCCCACAGAGCTGG + Intergenic
916045495 1:160997194-160997216 CATGCAGACCACCCATGATCTGG + Exonic
918804491 1:189022028-189022050 CCAGCAGTCCACCAAAGAGATGG - Intergenic
920742684 1:208596456-208596478 CCTGCAGATCACCTAGGAGCAGG - Intergenic
1063219695 10:3955681-3955703 CCTGGAGAGCACCGGAGAGCTGG - Intergenic
1063459406 10:6205739-6205761 GCTGCAGACCTCCAATGAGAAGG - Intronic
1063555106 10:7071184-7071206 CCTGCAGATCACAAAACTGCAGG + Intergenic
1063817125 10:9788176-9788198 CATGCAGACCACCAGAGGCCAGG - Intergenic
1063925569 10:10973815-10973837 CCTGCAGCCTCCCAAAGTGCTGG + Intergenic
1068594898 10:58892137-58892159 CCTGCAGAGCACCAAAAGGTTGG - Intergenic
1068913081 10:62399683-62399705 TCTGCAGACCTCCAAAGAAAGGG + Intronic
1070739622 10:78894239-78894261 CCTGTAGACAAGCACAGAGCAGG + Intergenic
1070782551 10:79146137-79146159 GCTGCAGACCCCCATAGAGCTGG + Intronic
1072068640 10:91894889-91894911 CCTGCTGAGCCCCATAGAGCTGG + Intergenic
1074458418 10:113615122-113615144 CCTGCCTACCTCCAAAGAGGTGG - Intronic
1074974280 10:118567681-118567703 CCTGCAGGCCAGCTCAGAGCAGG - Intergenic
1075761824 10:124863380-124863402 TTTGCAGACCACCAAAGACCTGG + Intergenic
1075846990 10:125552663-125552685 CCTGCTGAGCACCTAAGAGCTGG + Intergenic
1076787968 10:132760463-132760485 CCTGGACAGCACCAAAGTGCAGG - Intronic
1077134080 11:990139-990161 ACTGCAGACCTGCAGAGAGCAGG + Intronic
1077480372 11:2811783-2811805 GGTGGAGACCACCAAAGAGGAGG + Intronic
1078951586 11:16140950-16140972 CATGCAGACCACAAATCAGCTGG + Intronic
1083233506 11:61337934-61337956 CTTGCAGACCTCCAAGAAGCTGG + Exonic
1085759158 11:79226979-79227001 CCTGCAGAGCACAGCAGAGCAGG - Intronic
1086801378 11:91180827-91180849 CCTGAAGACCACCAGATTGCTGG + Intergenic
1088032445 11:105267560-105267582 CATGCAGACCAGAAATGAGCAGG - Intergenic
1088253641 11:107883114-107883136 GCTTCAGACTCCCAAAGAGCTGG - Intronic
1089467085 11:118692324-118692346 CGGGCAGACCACCAAGGGGCAGG + Intergenic
1089493001 11:118895330-118895352 CCTGCAGACCACCCAGGATCCGG - Exonic
1089638971 11:119834439-119834461 CTTTCAGACCTCCAAAGTGCAGG + Intergenic
1091492118 12:941884-941906 GCTGCAGACTCCCAAAGTGCTGG + Intronic
1092297842 12:7215726-7215748 ACTGCAGACTACCAGAGAGGTGG + Intronic
1094177001 12:27551245-27551267 CCTGCAGACCCCCACAAGGCTGG - Intronic
1095568288 12:43651777-43651799 CCTGCCATCTACCAAAGAGCTGG - Intergenic
1095600999 12:44013274-44013296 CCTGCAGCCTCCCAAAGCGCTGG + Intronic
1097917783 12:65038940-65038962 CCTGCAGCTCCCCAGAGAGCTGG + Intergenic
1099049682 12:77767735-77767757 ACTGCAGAGCCCCAAAGAGGGGG + Intergenic
1102312572 12:111858152-111858174 CCTGCAGCCTCCCAAAGTGCTGG + Intronic
1105393061 13:20000045-20000067 GCTTCAGACCCCCAAAGTGCTGG + Intronic
1108670606 13:52684203-52684225 CCTGCAGACATCAAAAGAGTAGG - Intronic
1108933576 13:55861486-55861508 CCTGCAGACTCCCAAAGAACAGG - Intergenic
1109559584 13:64029549-64029571 CCGGCAGGCCACCGACGAGCAGG + Intergenic
1111285433 13:86085147-86085169 GCTGCAGACTCCCAAAGTGCTGG + Intergenic
1113542320 13:111118511-111118533 CCTGGAGAAAACCAAAGTGCAGG - Intronic
1113849085 13:113407838-113407860 CCTGGAGAAGACCAAGGAGCCGG - Intergenic
1118149006 14:63167679-63167701 CCTGCAGGCCAAGAAAGAGTGGG + Intergenic
1118206445 14:63727899-63727921 CCTGCAGACGGCCAACCAGCTGG + Exonic
1119257076 14:73208086-73208108 ACTGCAGAACCCCAAAGAGGGGG + Intronic
1119899384 14:78246970-78246992 CCTTCACACCATCAAATAGCAGG - Intronic
1122707003 14:103628220-103628242 CCTGCAGACGTCCCAAGTGCGGG - Intronic
1128718082 15:69924471-69924493 ACTGCAGAACACCAAAGACAAGG - Intergenic
1128769817 15:70273505-70273527 CCTGCAGACCCTCTAAGAGGAGG - Intergenic
1129091820 15:73158921-73158943 ACTGCAGACCTCAAAAAAGCTGG - Intronic
1129426162 15:75464606-75464628 CCTCAAAACCACAAAAGAGCTGG + Exonic
1129733102 15:77942939-77942961 CCTGGAGTAGACCAAAGAGCAGG - Intergenic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1131054790 15:89368831-89368853 CCTGCATACAAACCAAGAGCCGG + Intergenic
1132102713 15:99036337-99036359 CCTGCAGTCAAGGAAAGAGCTGG + Intergenic
1132235399 15:100216421-100216443 GCTGAAGAACAGCAAAGAGCTGG + Intronic
1132611992 16:821824-821846 CCTGCCGACCAGCCAGGAGCTGG + Intergenic
1132796711 16:1728037-1728059 CCTGCAGCCCACCAATGGGGAGG - Intronic
1133455476 16:5938764-5938786 CCTGCAGCTCACCACAAAGCAGG + Intergenic
1135059110 16:19255811-19255833 CCTGCAGACCACGACAAAGAGGG + Intronic
1136537813 16:30910622-30910644 CCTGCAGAACAGCAGGGAGCGGG - Intergenic
1136755144 16:32675771-32675793 CTTGCAGATCAACAAAGGGCCGG - Exonic
1136812969 16:33194598-33194620 CTTGCAGATCAACAAAGGGCCGG + Exonic
1136819445 16:33304678-33304700 CTTGCAGATCAACAAAGGGCCGG + Intronic
1136826008 16:33361213-33361235 CTTGCAGATCAACAAAGGGCCGG + Exonic
1136831074 16:33459984-33460006 CTTGCAGATCAACAAAGGGCCGG + Intronic
1136860015 16:33693448-33693470 CCTGCAGTCTCCCAAAGTGCTGG - Intergenic
1137586143 16:49664892-49664914 CGTTCAGAGCACAAAAGAGCAGG - Intronic
1137773714 16:51039072-51039094 CCTGAGGACCCCCACAGAGCTGG - Intergenic
1139761622 16:69188186-69188208 CGGGCAAACCACCAAAGCGCTGG + Intronic
1140716337 16:77728766-77728788 CCTGGTGCCCAGCAAAGAGCTGG + Intronic
1202991546 16_KI270728v1_random:17568-17590 CTTGCAGATCAACAAAGGGCCGG + Intergenic
1203121519 16_KI270728v1_random:1541615-1541637 CCTGCAGTCTCCCAAAGTGCTGG - Intergenic
1142476969 17:194362-194384 CTTGCAGACCAGAAATGAGCAGG - Intergenic
1142972304 17:3621158-3621180 CCTGCAGACTCGCACAGAGCTGG + Intronic
1143125237 17:4637658-4637680 CCTGCAGCCTCCCAAAGTGCTGG + Intronic
1144492777 17:15729121-15729143 CATGCAGAGCACCACCGAGCAGG + Intergenic
1144907476 17:18647538-18647560 CATGCAGAGCACCACTGAGCAGG - Intronic
1146336601 17:31977639-31977661 ACTGCAGCCTCCCAAAGAGCTGG - Intronic
1146343364 17:32041033-32041055 CCTGGAGACCAACATTGAGCAGG + Intronic
1146588058 17:34100087-34100109 CCTGCAGACCACCAAAGAGCAGG + Intronic
1147150436 17:38510843-38510865 CCTGGAGTCCACCAAGGCGCGGG + Exonic
1148674727 17:49438723-49438745 CCTGACGGCCCCCAAAGAGCAGG + Intronic
1151867210 17:76811924-76811946 ACTGCAGACTCCCAAAGTGCTGG + Intergenic
1152364518 17:79847668-79847690 CCTGCAGCCTCCCAAAGTGCTGG + Intergenic
1152737153 17:82003073-82003095 CCGGCAGACCACCTAAGGTCAGG - Intronic
1152793011 17:82292466-82292488 CCTGCAGGCGTCCACAGAGCTGG + Intergenic
1153514381 18:5890978-5891000 CCTGCAGCCCACCCGAGAGCTGG - Exonic
1155176113 18:23302688-23302710 CGTGCATTCCACCAAAGGGCTGG - Intronic
1156099762 18:33578806-33578828 CCCGCAGAATAACAAAGAGCAGG - Intronic
1156269937 18:35521345-35521367 CCCTGAGACCACCAAACAGCTGG + Intergenic
1158222488 18:55164067-55164089 CCTGTAGAGCACCAAGGAACAGG - Intergenic
1160180827 18:76634837-76634859 AGTTCAGACCACCAAGGAGCAGG - Intergenic
1162123021 19:8484008-8484030 CCTGCATACCTCCAGAGTGCTGG + Intronic
1163100058 19:15090103-15090125 CCTGCAGACCACCAGAAGCCAGG + Intergenic
1163127686 19:15253136-15253158 GCTGCAGACCACCTGAGAGCTGG - Intronic
1163144870 19:15373449-15373471 CCTGCATCCCACCTAAGTGCTGG + Intronic
1166039390 19:40192469-40192491 GCTGCAGGGCTCCAAAGAGCCGG - Exonic
1166143264 19:40817276-40817298 GCTTCAGATCACCAAATAGCTGG - Intronic
1166184303 19:41129538-41129560 GTTTCAGACCACCAAATAGCTGG + Intergenic
929601528 2:43207603-43207625 CCTGCACAGCCCCAAGGAGCTGG + Intergenic
929904709 2:46035853-46035875 CCAGCAGAGAACAAAAGAGCTGG + Intronic
931745522 2:65288514-65288536 CCTTCAGCCTCCCAAAGAGCTGG + Intergenic
932030893 2:68183357-68183379 TCTGCAGATTTCCAAAGAGCTGG - Intronic
934676827 2:96255131-96255153 CCTGCAGACCACCCAGGAGCAGG - Intronic
937252273 2:120532506-120532528 CCTGCAGACCAGAAAAGCCCAGG + Intergenic
937458935 2:122068856-122068878 CCAGCAGACCACCAATCAGTAGG - Intergenic
939029713 2:137056907-137056929 ATTGCAAACCACCAAAGAGAGGG - Exonic
939040339 2:137181591-137181613 CCTGCAGAAACCCTAAGAGCTGG - Intronic
939381847 2:141446738-141446760 CCTGCAAACCAGCAGAGAGTGGG - Intronic
941838707 2:170055045-170055067 ACTGCAGCCTCCCAAAGAGCTGG - Intronic
943787231 2:191891599-191891621 CTTGGAGACCACAAAAGACCAGG - Intergenic
944440033 2:199733008-199733030 CCTACAAAGCACCATAGAGCTGG + Intergenic
1169111787 20:3038821-3038843 CCTGGAGATCACCTAAGAACTGG - Intronic
1169978094 20:11353265-11353287 CCAGCAGACCACCAGAGAGATGG + Intergenic
1170774325 20:19362652-19362674 CCTGCAGACCACCAACCATGTGG + Intronic
1171014294 20:21525800-21525822 CCTGCAGAGAACCAGAGAACTGG + Intergenic
1171026871 20:21638812-21638834 CCTCCAGACCAGCACACAGCAGG - Intergenic
1171849621 20:30299249-30299271 CCCAAACACCACCAAAGAGCAGG - Intergenic
1172092614 20:32444885-32444907 CTTGGAGGGCACCAAAGAGCTGG - Exonic
1172613481 20:36268050-36268072 CCTGCAGACCTCCAATGGGCGGG - Intronic
1172807289 20:37621498-37621520 CCTTCAGCCCCCCAAAGTGCTGG + Intergenic
1175767742 20:61602965-61602987 CCTGCAGATCACGCAGGAGCTGG - Intronic
1180761960 22:18217333-18217355 CCTCCAGACCACAGTAGAGCAGG - Intergenic
1180773707 22:18407277-18407299 CCTCCAGACCACAGTAGAGCAGG + Intergenic
1180805056 22:18656821-18656843 CCTCCAGACCACAGTAGAGCAGG + Intergenic
1180805687 22:18712587-18712609 CCTCCAGACCACAGTAGAGCAGG - Intergenic
1181069763 22:20325994-20326016 CCTCCAGACCACAGTAGAGCAGG + Intergenic
1181192806 22:21154202-21154224 CCTCCAGACCACAGTAGAGCAGG + Intergenic
1181216636 22:21338372-21338394 CCTCCAGACCACAGTAGAGCAGG - Intergenic
1181881301 22:25982361-25982383 CCTGCAGACAACCAAAGCCCTGG + Intronic
1182481255 22:30610389-30610411 TCAGCAGGGCACCAAAGAGCGGG + Intronic
1182994569 22:34800697-34800719 CCTGTAGACCACCCAGGACCAGG + Intergenic
1203235537 22_KI270731v1_random:148251-148273 CCTCCAGACCACAGTAGAGCAGG + Intergenic
950771030 3:15311314-15311336 CCTGCAGCCTCCCAAAGTGCTGG - Intronic
950894261 3:16433906-16433928 CGTGCAGCCCACCCATGAGCGGG - Exonic
952372811 3:32739670-32739692 TCTGCAGCCCACCAATGTGCTGG - Intronic
952563051 3:34618384-34618406 ACTGGAAACCACTAAAGAGCAGG - Intergenic
953463722 3:43102021-43102043 CCTGCAGGCCAGCAGAGAGGAGG + Intronic
953751537 3:45612042-45612064 CCTGCAAACCATGACAGAGCTGG - Intronic
954305006 3:49721013-49721035 CCTGCAGCCCACCAGTGAGGAGG + Exonic
954395143 3:50289505-50289527 CCTGCAGGGCAGCAGAGAGCAGG + Exonic
955323431 3:57991435-57991457 GCTTCAGCCTACCAAAGAGCTGG + Intergenic
955973026 3:64454765-64454787 CCTGCAGACAAGAAAAGAGAAGG + Intergenic
956023050 3:64952540-64952562 CTTGCAAACCAGCAAAGACCGGG + Intergenic
960240071 3:115330590-115330612 CCTGCAGACAGGCAAAGAGGGGG - Intergenic
960308357 3:116090097-116090119 CCTCCAGCCTCCCAAAGAGCTGG - Intronic
961563489 3:127747141-127747163 CCAACAGCCCATCAAAGAGCAGG - Intronic
963778898 3:149466973-149466995 TGTGAAGACCACCAAAGACCTGG + Intergenic
968573203 4:1353257-1353279 TCTGCAGGCCACCCCAGAGCGGG + Exonic
969099144 4:4755773-4755795 CCCGCAGTGCCCCAAAGAGCCGG - Intergenic
970252872 4:14134903-14134925 GCAGCAGGCCACCTAAGAGCGGG + Intergenic
970343559 4:15131238-15131260 CCTGAACATCACCAATGAGCTGG - Intergenic
972305154 4:37823789-37823811 CCTGCAGACCACCTAACATTTGG + Intergenic
973914287 4:55617756-55617778 CCTGCACACCATAAAAGAGTAGG - Intronic
980315182 4:131190190-131190212 CTTGCAAACCCCCAAAAAGCTGG + Intergenic
982159596 4:152554571-152554593 CTTGCTGGCCAACAAAGAGCAGG - Intergenic
982275057 4:153629825-153629847 CCTGGAGCCCTCCAGAGAGCAGG + Intronic
982841604 4:160194823-160194845 CTTGCCGACCTCCACAGAGCTGG - Intergenic
984927599 4:184820130-184820152 CCTGCAGACTCCCAAGTAGCTGG + Intronic
986469183 5:8057558-8057580 CCTGCAGGGCACCGATGAGCAGG + Intergenic
987062863 5:14258909-14258931 CCTGCAGCCCACCACCCAGCAGG - Intronic
988439505 5:31216336-31216358 CCTGCAGGCCACACAAAAGCAGG - Intronic
989111028 5:37906844-37906866 CCAGGACACCACCAAGGAGCCGG - Intergenic
990954191 5:61327819-61327841 CCTGCAGGCCTCCTAAGCGCAGG + Intergenic
990977024 5:61569320-61569342 CCTGCAGCACACCCAACAGCTGG - Intergenic
992674671 5:79093975-79093997 AATGCAGACCAGCAAATAGCTGG + Intronic
993886436 5:93420816-93420838 CTTGCAGACTGCCAAAGAGCTGG + Intergenic
994086051 5:95760275-95760297 CCTGAAGACCAGGAAAGGGCTGG - Intronic
994927004 5:106128757-106128779 CCTCCAGACTCCCAAAGTGCTGG - Intergenic
997783046 5:136679097-136679119 AATGCAAACCCCCAAAGAGCAGG + Intergenic
998567076 5:143225436-143225458 ACTTCAGACCCCCAAAGTGCTGG + Exonic
1000624367 5:163522219-163522241 CCAGCAGAGCACCAAAGAGAAGG + Intergenic
1004320612 6:14628790-14628812 TGTGCAGATCACCAAAGAGCTGG + Intergenic
1005722729 6:28618686-28618708 ACTGCAGCCCCCCAAATAGCTGG - Intergenic
1007116593 6:39347579-39347601 CCTGGAGACAACCTCAGAGCTGG + Intronic
1007136579 6:39527721-39527743 CCTGCACACCTCCAAAGCTCTGG + Intronic
1007250045 6:40489427-40489449 CCTGCAGACCTCCTAACACCCGG + Intronic
1009274518 6:61658115-61658137 GCTGCAAACTACCAAAGGGCAGG - Intergenic
1010850840 6:80774366-80774388 CCGGCAGATCACCTAAGATCGGG - Intergenic
1016793490 6:148091522-148091544 CCAGCAGACCAGGAAAGAGTGGG + Intergenic
1016935647 6:149447487-149447509 CATGAAGCCCACCAAAGTGCTGG + Intergenic
1017599489 6:156064899-156064921 CCTGCAATCCAGCACAGAGCAGG + Intergenic
1017907810 6:158768871-158768893 CCTGGAGACGTCCAAGGAGCTGG + Intronic
1018070617 6:160161428-160161450 GCTGCAGATCAGGAAAGAGCAGG + Intergenic
1018901586 6:168054386-168054408 CCTGTGGACCCCCAAGGAGCAGG - Intergenic
1020086290 7:5312601-5312623 CCTCCCCACCACCAAGGAGCTGG - Exonic
1021993437 7:26157899-26157921 CCAGCAAACCACCAAAAGGCAGG - Intronic
1024667757 7:51563475-51563497 GCTGGAGAGCAGCAAAGAGCAGG - Intergenic
1025156153 7:56607329-56607351 GCTGCAGACCAGGAAAAAGCAGG - Intergenic
1025208017 7:57004471-57004493 CCTCCCCACCACCAAGGAGCTGG + Intergenic
1025663936 7:63572404-63572426 CCTCCCCACCACCAAGGAGCTGG - Intergenic
1026808865 7:73445381-73445403 CTTTCAGACCACCAAAGATGTGG - Intronic
1030714355 7:112790599-112790621 CGGGAAGACCACCAAAGATCAGG + Intergenic
1031017779 7:116594285-116594307 CCTTCAGCCTACCAAAGTGCTGG + Intergenic
1031690553 7:124782613-124782635 CCAGCAGACCACCAACCAGATGG - Intronic
1034621940 7:152463657-152463679 CCCGCAGACAAGCAGAGAGCCGG + Intergenic
1034894821 7:154869685-154869707 CCTGCAGCCCACCACAGGTCCGG + Intronic
1035761251 8:2070440-2070462 CCCCAAGACCACCAAAGGGCAGG + Intronic
1036170824 8:6482678-6482700 CATGCAGACAACCAGGGAGCAGG - Intronic
1036237170 8:7049837-7049859 CCTACAGACCAACAAGGAGAGGG - Intergenic
1037797581 8:22009747-22009769 TCTGCAGACCAGCAAAGGCCGGG - Intergenic
1038263985 8:26022696-26022718 CCTCGAGACCACCAAGGAGCTGG - Intronic
1038319622 8:26514658-26514680 CCTGCAGAACATCAACGACCAGG + Intronic
1038652891 8:29421756-29421778 CCTGCAGATCTGCAAACAGCTGG - Intergenic
1038832740 8:31080265-31080287 TATGCAGAACTCCAAAGAGCTGG - Intronic
1039748423 8:40454294-40454316 CTAGCAGACCATCAAAGATCAGG + Intergenic
1043051769 8:75394019-75394041 CTTGCAGACCACCAAAGACCGGG - Intergenic
1043389851 8:79781943-79781965 GCTGCAGATCACCAAAGGGGTGG - Intergenic
1044518989 8:93176218-93176240 GCTGGAGGCCACCAAGGAGCTGG + Intergenic
1044647929 8:94464257-94464279 GCTGCAGAAAACCAAAGAGAAGG + Intronic
1045216347 8:100152602-100152624 CCTGCAGCCTCCCAAAGTGCTGG - Intronic
1047917302 8:129595785-129595807 GCTTCAGCCCCCCAAAGAGCTGG + Intergenic
1048191279 8:132291924-132291946 CCTGCAGACTGACACAGAGCAGG + Intronic
1048806057 8:138242361-138242383 CCTGCACATCACAGAAGAGCAGG + Intronic
1049658211 8:143808189-143808211 CCTGGAGACCCACAAAGAGTGGG + Intronic
1050443208 9:5686880-5686902 CTTCCAGAACACCAAAGAGAAGG - Intronic
1051666567 9:19472007-19472029 CCTGCAGCCCACCAAAAGGAAGG + Intergenic
1053787397 9:41662543-41662565 CCCAAACACCACCAAAGAGCAGG - Intergenic
1054157730 9:61652224-61652246 CCCAAACACCACCAAAGAGCAGG + Intergenic
1054175673 9:61873882-61873904 CCCAAACACCACCAAAGAGCAGG - Intergenic
1054477504 9:65583229-65583251 CCCAAACACCACCAAAGAGCAGG + Intergenic
1054661866 9:67706928-67706950 CCCAAACACCACCAAAGAGCAGG + Intergenic
1055570848 9:77615522-77615544 GCTGCAGATCACCAAGGAGATGG + Intronic
1056722984 9:89087461-89087483 CCTGCAGGCACCCCAAGAGCAGG - Intronic
1056833975 9:89939722-89939744 GGTGCAGACCACCAAGGAGTTGG - Intergenic
1060731223 9:126038247-126038269 CCTTCAGCCCCCCGAAGAGCTGG - Intergenic
1061468465 9:130802683-130802705 CCTGCAGATCAACAAAATGCTGG - Intronic
1062269315 9:135701411-135701433 CCTGCAAACCAACAAAGCTCTGG + Intergenic
1186896409 X:14008732-14008754 CCTGCAGACCTCCAAGTGGCTGG + Exonic
1195779874 X:108450341-108450363 GCTTCAGCCCCCCAAAGAGCTGG + Intronic
1197260805 X:124315460-124315482 ACTGGAAACCACAAAAGAGCAGG + Intronic
1200122145 X:153796189-153796211 CCTGCACACCTCCAGAAAGCCGG + Intronic
1201220962 Y:11769896-11769918 CCTGCTCCCCACCAAAGAGCTGG - Intergenic
1201350459 Y:13034862-13034884 CCTGCAGACCAGAAGAGAGTGGG + Intergenic
1202086027 Y:21137793-21137815 CCTTCAGACTCCCAAAGTGCTGG + Intergenic
1202269142 Y:23053648-23053670 CCAGAAGACCAGCAAAGAGGTGG - Intergenic
1202422134 Y:24687388-24687410 CCAGAAGACCAGCAAAGAGGTGG - Intergenic
1202448652 Y:24982690-24982712 CCAGAAGACCAGCAAAGAGGTGG + Intergenic