ID: 1146589991

View in Genome Browser
Species Human (GRCh38)
Location 17:34120667-34120689
Sequence AGGTTATACTAGATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146589991 Original CRISPR AGGTTATACTAGATGGAGTA AGG Intronic
903382624 1:22907588-22907610 GGGTTATACAAGAAGGTGTATGG - Intronic
905833596 1:41096233-41096255 AGGTTAAACTAGATGACATAAGG - Intronic
906004668 1:42458017-42458039 AGGTCATTCCAGGTGGAGTATGG + Intronic
906243177 1:44254882-44254904 AAGAAATACTAGATGGAGCAAGG - Intronic
909760146 1:79276278-79276300 AGGTTCTACTTGATGGGGGAGGG + Intergenic
916024601 1:160822912-160822934 AGGGTATTCTAGGTGGAGGAGGG - Intronic
918575994 1:186061018-186061040 AGATGAGGCTAGATGGAGTATGG - Intronic
918626471 1:186661164-186661186 AAGTTACACTAGATGGATTTTGG - Intergenic
921406866 1:214789970-214789992 ATTTTATAGTAGAAGGAGTAAGG - Intergenic
922021536 1:221709826-221709848 TGGTGATACTTGATGGGGTAGGG - Intronic
924095529 1:240547083-240547105 AGGCTATGCTAGATGGAGAAGGG + Intronic
1068233424 10:54200846-54200868 AGATTAGACTAGATTGAGCAAGG - Intronic
1069014647 10:63415308-63415330 AGGTTTTATTAGATGGAGAAGGG - Intronic
1070290875 10:75112258-75112280 AGGTTTGACTAGAAGGAGGAGGG + Intronic
1072060774 10:91808585-91808607 AGGTGATAGTGGTTGGAGTAAGG + Intronic
1079217858 11:18530515-18530537 AGGTTAATCCAGATGGAGTTAGG - Exonic
1085432610 11:76466796-76466818 AGGTCATACTAGAAGAACTAGGG - Intronic
1088755148 11:112879295-112879317 AGGTCATACTAGAGGGAGGTGGG + Intergenic
1091619461 12:2075330-2075352 AGATTAAACAAGATAGAGTATGG - Intronic
1095257143 12:40051901-40051923 AGATCATTCTAGTTGGAGTACGG + Intronic
1101195962 12:102382596-102382618 TGGTTATTCTTGAAGGAGTAAGG + Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108839324 13:54593086-54593108 AGATTCCACCAGATGGAGTAGGG - Intergenic
1112621661 13:101059467-101059489 TGGGTATATTACATGGAGTATGG - Intronic
1115542954 14:34439887-34439909 AGGTTTTACTAGGGGGAGTAGGG - Intronic
1116307423 14:43275717-43275739 GGGTAATAGTAGAAGGAGTATGG + Intergenic
1117319687 14:54609077-54609099 ATGTTATGTTACATGGAGTAGGG + Intronic
1117828055 14:59724106-59724128 AGGTCATCCTAGAAGGTGTAGGG + Intronic
1118789462 14:69076505-69076527 ACGTTATACTAAATGAAATAAGG + Intronic
1119453306 14:74731420-74731442 AGGATACACTAGAGGGAGGATGG - Intronic
1121572019 14:94953348-94953370 AGGGTCTACTTGATGGAGTGGGG - Intergenic
1127075062 15:55317611-55317633 AGTTAATACTACATGGAGTTAGG - Exonic
1131513463 15:93062669-93062691 AGGGGACACTAGATGGAGAAGGG + Intronic
1131600406 15:93841968-93841990 AGGTTATAAGAGATGGAATTGGG - Intergenic
1138320555 16:56107596-56107618 AGGGTACACTTGATGGAGTAAGG + Intergenic
1139622489 16:68157417-68157439 AGTTTATAATATATGGAATAGGG + Intronic
1140344750 16:74202348-74202370 TGTTTTTACTATATGGAGTAAGG - Intergenic
1144176943 17:12716621-12716643 ATGTTATATTAGATGGATTTAGG + Intronic
1144899266 17:18568942-18568964 AGGGGACACTAGATGGAGAAGGG - Intergenic
1146224818 17:31056397-31056419 AGGTAATGCTACATGGAGAAAGG + Intergenic
1146589991 17:34120667-34120689 AGGTTATACTAGATGGAGTAAGG + Intronic
1147762260 17:42806659-42806681 ATTGTATCCTAGATGGAGTATGG - Exonic
1149615138 17:57990849-57990871 AGGTTATACAACTTGGAGTGTGG - Intronic
1150898502 17:69241246-69241268 AGATTATAGTACATGGAGTATGG - Intronic
1154342472 18:13515414-13515436 AGGTTGTCCTAGATGGCTTATGG + Intronic
1158983991 18:62794909-62794931 AGGATTAAGTAGATGGAGTAGGG + Intronic
1159184582 18:64952256-64952278 ACATTAAACCAGATGGAGTAGGG + Intergenic
1161180772 19:2880081-2880103 AGGTCACAGTAGATGCAGTAGGG - Exonic
932549534 2:72753884-72753906 AGGTTATAGTAGTTGTATTAAGG - Intronic
936278444 2:111119634-111119656 AGGTCAGGCTAGATGGATTAAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937064988 2:119011125-119011147 AGGTTGTACTATATGGAGTTCGG - Intergenic
944306966 2:198189496-198189518 AGGTAGTACTGGATGGAGTCGGG - Intronic
946724487 2:222648522-222648544 AGGTGATTGTAGATGGAATAAGG + Intronic
1169826038 20:9769815-9769837 AGGTCATATCAGATGGAGAATGG - Intronic
1169924762 20:10771113-10771135 AGGTATTACTGGATTGAGTAAGG + Intergenic
1170381757 20:15768280-15768302 AGGTTATACTGTATGGCCTAGGG - Intronic
949090688 3:25362-25384 AGGTTATAGTACATGATGTATGG - Intergenic
951174913 3:19587905-19587927 AGGGACTACTAGATGGAGGAGGG + Intergenic
951463271 3:22974033-22974055 GGGGTATACAAGATGGATTAAGG - Intergenic
953869917 3:46617704-46617726 AGGTTACACTAAATGGGGCAGGG + Intronic
956579985 3:70799826-70799848 AGGTAAAAGTAGATGTAGTAGGG + Intergenic
957031010 3:75241577-75241599 AGGTTATAGTACATGATGTATGG - Intergenic
959008997 3:101052462-101052484 AGGTTCAATTAGATGGAGTGAGG + Intergenic
960898905 3:122534390-122534412 AGGTTTTACAACATGGAATAGGG + Intronic
962959181 3:140294106-140294128 ATGTTATAGCAAATGGAGTATGG + Intronic
973282534 4:48374646-48374668 AGGTTATTCTAGTAGTAGTATGG + Intronic
973303058 4:48611634-48611656 AGGTGACTCTAGATGGAATATGG - Intronic
973826670 4:54714443-54714465 AAGAAATACTAGATGGAGTGGGG - Intronic
974528793 4:63080483-63080505 AGCTTATCCTAGCTAGAGTATGG - Intergenic
977450289 4:97187778-97187800 AGGACATACTACATGGAGCATGG - Intronic
978320788 4:107493118-107493140 AGGTTAAACTAGAAGTAGTTGGG - Intergenic
984082360 4:175263285-175263307 TGGTAATAATGGATGGAGTAAGG + Intergenic
985322703 4:188732745-188732767 AGTTTATACTAAATTTAGTATGG + Intergenic
986080557 5:4387726-4387748 TGGTTTTACTAAATTGAGTATGG - Intergenic
987924987 5:24329477-24329499 GGGTGATAATAGCTGGAGTAGGG - Intergenic
989094214 5:37766308-37766330 AGGTTATACTAGATTAAGGTGGG + Intergenic
989116354 5:37957177-37957199 AGGTTATACCACATAGAGTAGGG + Intergenic
997904356 5:137800363-137800385 AGGTTGTAGAAGATTGAGTATGG - Intergenic
998977653 5:147665712-147665734 GGGTTAAACTAGATTGTGTACGG + Intronic
1001260996 5:170228409-170228431 AGGTTAAAATAGAAGGAGTCGGG + Intergenic
1010320033 6:74496304-74496326 AAGTAATTCAAGATGGAGTAAGG - Intergenic
1012608270 6:101185274-101185296 AGGCTATACCAGATGGCTTATGG - Intergenic
1012669718 6:102028449-102028471 ATGTTATATTAGATGGATTTGGG - Intronic
1014445555 6:121523309-121523331 AGGTTACTGTAGAAGGAGTAAGG + Intergenic
1014565749 6:122945671-122945693 ATGTTATAACAGTTGGAGTATGG - Intergenic
1017020128 6:150133379-150133401 TGGTGATACTAGATGGCGTCTGG - Intergenic
1020252027 7:6476911-6476933 AGGGAATACAAGATGGAATAAGG - Intronic
1021883795 7:25118947-25118969 AGGTTATCTTAGTTGGAGTTTGG - Intergenic
1028007525 7:85593761-85593783 AGGTTTTACTAGAGGGAGATGGG - Intergenic
1028101395 7:86825112-86825134 AGGGTATACTAGAAGGTGGAGGG - Intronic
1028292182 7:89078908-89078930 AGATTAAAGGAGATGGAGTATGG + Intronic
1035055619 7:156034015-156034037 AGGTAATTCTAGATGGAGTAAGG + Intergenic
1037727810 8:21497726-21497748 AGGTCATTGTGGATGGAGTAGGG + Intergenic
1039540939 8:38368680-38368702 AGGTTAAACTAGATAGATAAGGG - Intronic
1041031469 8:53740097-53740119 AGTTTATATCATATGGAGTATGG - Intronic
1043251496 8:78079460-78079482 AGTATATACTAGATTCAGTAGGG + Intergenic
1052485297 9:29090290-29090312 ACTTTATACTATATGGAGTTGGG - Intergenic
1053585260 9:39451692-39451714 AAGTTATACTAGCGGGAGTGAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054581059 9:66913531-66913553 AAGTTATACTAGCGGGAGTGAGG - Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055034396 9:71802793-71802815 AGGTTCTACTTGATGGGGGAGGG + Intronic
1055997139 9:82172322-82172344 AAGTTCTACAAGATCGAGTATGG - Intergenic
1186552368 X:10520210-10520232 ATCTTAGATTAGATGGAGTATGG - Intronic
1186704905 X:12130536-12130558 AGTATATAGTAGATGGTGTATGG + Intergenic
1188168129 X:26887577-26887599 AGGTCATGCTGGATGGACTAGGG + Intergenic
1189613248 X:42759711-42759733 AGGTTATACTAGCTGCAAAATGG + Intergenic
1194430198 X:93794264-93794286 GAGTTATACTAGATGGATTTAGG + Intergenic
1196112047 X:111956750-111956772 GGGTTATTCTAGATGGACTTTGG - Intronic
1196921462 X:120590063-120590085 AGGTAATAATAGGTTGAGTATGG + Intergenic
1197838943 X:130724813-130724835 AGGTGATACTAGAGGGATCAGGG + Intronic
1198698282 X:139367395-139367417 AAGTGTTACTAGGTGGAGTATGG + Intergenic
1198934399 X:141890777-141890799 AGGGTATACAAGATGGAGATGGG - Intronic
1201269763 Y:12243251-12243273 AGGTCATACTAGATGAAGGTGGG + Intergenic
1201617640 Y:15919330-15919352 ATGTTATACAAGATAAAGTATGG - Intergenic
1201762105 Y:17551768-17551790 GGGTTCTACTTGATGGAGGAGGG + Intergenic
1201839447 Y:18354220-18354242 GGGTTCTACTTGATGGAGGAGGG - Intergenic