ID: 1146593217

View in Genome Browser
Species Human (GRCh38)
Location 17:34146678-34146700
Sequence TTGACAGGTGCTGCCTCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146593217_1146593223 3 Left 1146593217 17:34146678-34146700 CCAGAAGAGGCAGCACCTGTCAA 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1146593223 17:34146704-34146726 AGGGCCAGCCTCCCCACGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 123
1146593217_1146593222 2 Left 1146593217 17:34146678-34146700 CCAGAAGAGGCAGCACCTGTCAA 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1146593222 17:34146703-34146725 AAGGGCCAGCCTCCCCACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 120
1146593217_1146593224 4 Left 1146593217 17:34146678-34146700 CCAGAAGAGGCAGCACCTGTCAA 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1146593224 17:34146705-34146727 GGGCCAGCCTCCCCACGAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146593217 Original CRISPR TTGACAGGTGCTGCCTCTTC TGG (reversed) Intronic
900143681 1:1149119-1149141 GTTGCAGGTGCTGCTTCTTCTGG - Intergenic
906715181 1:47963413-47963435 CTGCCAGGAGCTGCCTCTTAGGG + Intronic
907002235 1:50873044-50873066 TTGATAGGTGCTGACTGATCAGG - Intronic
908736553 1:67282904-67282926 TTGAGAGGTCCTGCCTTTTTAGG - Intergenic
911056806 1:93715739-93715761 TAGACAGATGGTGGCTCTTCAGG + Intronic
911903748 1:103538705-103538727 TTGACAGATGCTTATTCTTCTGG + Intronic
912970223 1:114274640-114274662 TTTCCAGGTGCTCCCACTTCTGG + Intergenic
915030160 1:152872328-152872350 TTCCCGGGTGCTGTCTCTTCAGG - Intergenic
917353138 1:174098980-174099002 TTGACAGCTGCTGACTGATCAGG + Intergenic
917580166 1:176368940-176368962 CTGCCAGGTGCTGCCTCTTCTGG - Intergenic
917808556 1:178636066-178636088 GTGACAGATGCTTCCTCTGCAGG + Intergenic
919415407 1:197302180-197302202 TTGACAGCTGCTGACTGATCAGG - Intronic
920284361 1:204868914-204868936 TGGAAAAGGGCTGCCTCTTCCGG + Intronic
920816245 1:209335265-209335287 TTCACTGTTGCTGCCCCTTCTGG + Intergenic
922624905 1:227029758-227029780 TTAATAGCTGTTGCCTCTTCTGG + Intronic
924771652 1:247085427-247085449 ATTACAGGTGCTCCCTCCTCAGG - Intergenic
1062962258 10:1581342-1581364 TAGGAAGGTGCTGCCTCTGCTGG + Intronic
1063911468 10:10834853-10834875 TTGTCCGATGCTGCCTCTCCAGG + Intergenic
1063950335 10:11216315-11216337 TTGAGAGGTGCTGCCATTTCAGG - Intronic
1065996481 10:31064098-31064120 TTGACAGGAGCTGCCTCACTTGG - Intergenic
1067252817 10:44602046-44602068 TGGACTGGTTCTGCCTCGTCAGG + Intergenic
1069196679 10:65559784-65559806 TTGACAGCTGCTGACTGATCAGG + Intergenic
1070513277 10:77180175-77180197 TGGAAGGGTGCTGCCTTTTCTGG - Intronic
1073208023 10:101778918-101778940 TTGACAGGCGCTCCCTCATCTGG - Intronic
1073538750 10:104300982-104301004 CTGTCATGCGCTGCCTCTTCTGG - Intronic
1074650014 10:115510433-115510455 TTGACAGCTGCTGCCTGATCAGG - Intronic
1083322250 11:61854990-61855012 GTTACAGGGGCTGCCTCTGCTGG - Intronic
1084383045 11:68825717-68825739 CTTCCAGGTGCTTCCTCTTCAGG + Intronic
1084666523 11:70579383-70579405 GTGCCAGCTGCAGCCTCTTCTGG - Intronic
1084991131 11:72926230-72926252 GGGACTGGTGGTGCCTCTTCTGG + Intronic
1085198660 11:74688101-74688123 TTGACCTCTGCTGCCTCTCCAGG + Intergenic
1087024402 11:93635673-93635695 ATGAGAAGAGCTGCCTCTTCAGG + Intergenic
1088013743 11:105035037-105035059 TTGGAAGGGGCTGGCTCTTCTGG - Intronic
1089115995 11:116095612-116095634 TTCACAGGTGCACCCTTTTCTGG - Intergenic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1094000748 12:25691347-25691369 GTCACAGGGGCTTCCTCTTCTGG - Intergenic
1094014237 12:25845393-25845415 AAGACAGGAGCAGCCTCTTCAGG - Intergenic
1101872026 12:108573850-108573872 TTGACAGCTGCTGACTGATCAGG + Intergenic
1103104429 12:118210633-118210655 TTGACAGGTGCTGCTATTTTAGG - Intronic
1105059237 12:133133348-133133370 TTGACAGGTACAACCTCGTCAGG - Intronic
1105587128 13:21755855-21755877 TTGAGATGTCCTGTCTCTTCAGG + Intergenic
1106469040 13:30038577-30038599 ATCGCAGTTGCTGCCTCTTCCGG + Intergenic
1107779841 13:43887240-43887262 GTGACAGGTTCAGCCTCTACAGG - Intronic
1108529070 13:51312079-51312101 CTGTCAGCTGCTGCCCCTTCGGG + Intergenic
1110719336 13:78744112-78744134 TGAATAGGTTCTGCCTCTTCTGG + Intergenic
1110998047 13:82138755-82138777 TTGCCAGATGGTGCCTCCTCAGG + Intergenic
1112379084 13:98871786-98871808 CTGACAGGTGCTGCCTGTGTGGG + Intronic
1112805164 13:103156754-103156776 AAGCCAGGTGCTGCGTCTTCTGG + Intergenic
1113605762 13:111604240-111604262 TGGACTGATGCTGCCTCTTCTGG + Intronic
1117947943 14:61050289-61050311 TTGAGAGGTTCTGCTTATTCTGG + Intronic
1118960046 14:70521362-70521384 TTGACAGATGCTGACTCTTCAGG - Intergenic
1119160819 14:72451232-72451254 ATGACAGCTGCTGTCTCATCTGG - Intronic
1121269664 14:92629642-92629664 CTAACAGCTGCTGCCTCTTAAGG + Intronic
1121625959 14:95385561-95385583 TAGATAGGTGCTGGCTGTTCTGG - Intergenic
1122522066 14:102351761-102351783 ATGACAAGTCCTGCCTCTTGGGG - Intronic
1124082684 15:26516331-26516353 TCCACAGATGCTGCCTCTCCAGG - Intergenic
1124709124 15:31990744-31990766 TTGACAGCTGCTGACTGATCAGG + Intergenic
1125886703 15:43234876-43234898 TTGACAGGTACTGGCTGTACTGG + Exonic
1125981587 15:44007082-44007104 TTGACAGCTGCTGACTGGTCAGG - Intronic
1127371804 15:58348485-58348507 ATGACAGGTGCAGCCTCTACAGG + Intronic
1130240760 15:82187173-82187195 TTGACAAGTGCCGCCTCTGTAGG - Intronic
1134832744 16:17336795-17336817 CTGCCAGTGGCTGCCTCTTCAGG + Intronic
1137884595 16:52089003-52089025 TTGCCAGGCGCTGTTTCTTCAGG - Intergenic
1139548836 16:67662393-67662415 TTGACAGGTCCTCCCTCTGCAGG + Exonic
1139852688 16:69960486-69960508 TTGAGAGGAGCTGGCTCTTTGGG - Intronic
1139881659 16:70183394-70183416 TTGAGAGGAGCTGGCTCTTTGGG - Intronic
1140031731 16:71344654-71344676 CTCACACCTGCTGCCTCTTCAGG - Intergenic
1140370849 16:74412111-74412133 TTGAGAGGAGCTGGCTCTTTGGG + Intronic
1141488991 16:84359293-84359315 TTGACAGATGGGGCCTCTTGGGG + Intergenic
1141544670 16:84757128-84757150 ATGACAGGTGCTATCTCTGCTGG + Intronic
1143054676 17:4153996-4154018 GTGGCAGGTGCTGCCTCTGAAGG + Intronic
1144109355 17:12017355-12017377 GTGACGGATGTTGCCTCTTCAGG - Intergenic
1146593217 17:34146678-34146700 TTGACAGGTGCTGCCTCTTCTGG - Intronic
1150716508 17:67576779-67576801 AAGACAGGGGCTGCCTTTTCTGG + Intronic
1152257143 17:79246732-79246754 CAGAGAGGTGGTGCCTCTTCAGG - Intronic
1152474508 17:80509253-80509275 AAGACAGGGGCTGCCTTTTCTGG + Intergenic
1155238234 18:23842700-23842722 TTCACAGTTGCGGCCACTTCAGG - Exonic
1155693217 18:28652357-28652379 AATACAGGTGCTACCTCTTCAGG + Intergenic
1157096799 18:44693016-44693038 TAGACAGGTGATGTATCTTCAGG + Intronic
1158204505 18:54977118-54977140 TTGATGGCTGCTGCCTCATCAGG + Intergenic
1158367256 18:56751474-56751496 TTGGCAGATGCTGCCTCTCTGGG - Intronic
1162105188 19:8366022-8366044 TTCGCAGGTGCTGCTTCTCCAGG - Exonic
1162999335 19:14356252-14356274 TTCACGGGTCCTGCCTCTCCGGG - Intergenic
1163064796 19:14785100-14785122 TTCACGGGTCCTGCCTCTCCGGG + Intergenic
1167027202 19:46929225-46929247 TTAACCGGTGCTCCCCCTTCTGG - Intronic
1167347910 19:48958017-48958039 ATGACAGGTGCCACCTCTCCAGG - Intronic
925292583 2:2757422-2757444 TTGAAAGTTTCTGCCTCTTTAGG + Intergenic
926029721 2:9575569-9575591 TTGACAGGTGGTGCTTTTTTGGG - Intergenic
926546065 2:14241726-14241748 TTCACAGGTGTTTCCACTTCAGG - Intergenic
926561061 2:14417966-14417988 CTGACAGCTGATGCCTCTTAGGG - Intergenic
927111465 2:19866787-19866809 TTTACAAGTGTTGCCTCTTTAGG - Intergenic
929866978 2:45726410-45726432 TTGACAGCTGCTGACTGATCAGG - Intronic
932671330 2:73740167-73740189 TTCACAGGTGCAGCCTCATCAGG + Intergenic
932855457 2:75229258-75229280 CTCAGAGATGCTGCCTCTTCAGG + Intergenic
936064764 2:109322329-109322351 TTGAAATGTTCTGCCTCTGCCGG - Intronic
939439202 2:142221431-142221453 TTGAAAAGTGCTACCTCTTTGGG + Intergenic
942169180 2:173273098-173273120 TTGCCAGATGATGCCTCTTCTGG + Intergenic
944205982 2:197158839-197158861 TTGAAGGCTGCTGCATCTTCAGG - Intronic
947742607 2:232491466-232491488 TGGTCAGGTGCTGCCTCCACAGG + Intergenic
947935127 2:233997856-233997878 CTGACAGCTGCTACCACTTCAGG - Intronic
947980591 2:234405411-234405433 CTGCCAGGTGCTCGCTCTTCTGG - Intergenic
1170331177 20:15212573-15212595 TTGACCTGTGTTGCCTCTCCTGG - Intronic
1171166261 20:22974682-22974704 GTCACTGGTGCTGGCTCTTCAGG + Intergenic
1172390481 20:34561814-34561836 TTGACAGCTGCTTACTCTTCAGG + Intronic
1172783133 20:37449063-37449085 ATGGAATGTGCTGCCTCTTCAGG + Intergenic
1172837975 20:37885160-37885182 CTGCTAGGTTCTGCCTCTTCTGG + Intergenic
1173073859 20:39797329-39797351 TTGCCAGGGGCTTCCTATTCTGG + Intergenic
1175737491 20:61397252-61397274 TTGAGAAGTGAGGCCTCTTCTGG + Intronic
1179260961 21:39757895-39757917 TGGACAGGGGCAGCCTCATCTGG - Intronic
1179299486 21:40093749-40093771 TTCACTGCTGTTGCCTCTTCCGG + Exonic
1181393955 22:22604732-22604754 TGCACAGGTGCTGCCTCCTAGGG + Intergenic
1181782190 22:25201418-25201440 TTGCCAGCTGCAGCCTGTTCGGG - Exonic
1182021011 22:27081497-27081519 TATACAGGGGCTGCCTCTACTGG + Intergenic
1183488692 22:38105183-38105205 TTAACAGGTCCTGACTCTGCAGG - Intronic
1183909553 22:41068185-41068207 TGGACAGGTGCTGCCCCCACAGG + Intergenic
1184763897 22:46561805-46561827 CTGTCAGCAGCTGCCTCTTCTGG - Intergenic
1185394266 22:50578696-50578718 GTGTCAGCTGCTGCCTGTTCTGG + Intronic
951846952 3:27094951-27094973 TGGTCAGCTGCTGCCTATTCAGG + Intergenic
954867812 3:53744544-53744566 TTGGGAGGTGCTGCCTCGTGTGG + Intronic
956735989 3:72238636-72238658 TTGGCAGAAGCTGGCTCTTCTGG - Intergenic
959726939 3:109554276-109554298 TTGAAAAATGCTCCCTCTTCAGG - Intergenic
959821001 3:110735253-110735275 TTGACAGCTGCTGACTGATCAGG + Intergenic
960703291 3:120458099-120458121 TCTCCTGGTGCTGCCTCTTCAGG - Intergenic
961752824 3:129107394-129107416 TTGCCAAGTGCCACCTCTTCCGG + Intronic
962116107 3:132509699-132509721 TTGACAGCTGCTGACTAATCAGG - Intronic
964305475 3:155334966-155334988 CTGACATGTGCTGCTTCTCCTGG + Intergenic
968382527 4:108319-108341 TTGACAGGTGCTGCCACCTTGGG - Intergenic
968504244 4:964594-964616 TTGCCAGGTGCCCCCTCTTCTGG + Intronic
969606125 4:8203103-8203125 TACACAGGAGCTGCCTCTTGGGG + Intronic
969876293 4:10137802-10137824 TTGACCCGTCCTGCCTCATCTGG - Intergenic
970844671 4:20522411-20522433 ATGACAGTTTCTCCCTCTTCAGG - Intronic
970931624 4:21518567-21518589 TCGGCAGGTCCTACCTCTTCAGG - Intronic
972727550 4:41758321-41758343 TTGTCGGGTGCAGCCTGTTCTGG - Intergenic
974791110 4:66691280-66691302 TTGAAAGCTGCTCCCTCTGCAGG + Intergenic
976374230 4:84325800-84325822 TTCACTAGTGCTGCCTCTGCTGG - Intergenic
977068718 4:92354047-92354069 ATGCCATGTGCTGGCTCTTCAGG + Intronic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983987832 4:174081799-174081821 TTTACATGTGCTGCTTCCTCAGG + Intergenic
984675765 4:182545667-182545689 TTGACAGGGGCAGAGTCTTCTGG - Intronic
987486694 5:18534821-18534843 TTGAGATGTCCTGCCTTTTCAGG + Intergenic
991642027 5:68764475-68764497 CTTACTGGTCCTGCCTCTTCTGG - Intergenic
999264380 5:150256868-150256890 GCGACAGGTGCTGCCTCATCTGG + Intronic
999515047 5:152293176-152293198 TTGACAGCTGCTGACTGATCAGG - Intergenic
1003054045 6:2803180-2803202 TTCACAGGTGCAGCCTAATCAGG + Intergenic
1003852523 6:10239932-10239954 TGTGCAGGTGCTGCCTCTTAGGG - Intergenic
1004170169 6:13289415-13289437 TTGACAGGTCCTGCGCCTTCAGG + Exonic
1006503863 6:34475625-34475647 CTTACAGGAGCTGCCTCATCTGG - Intronic
1007755535 6:44096806-44096828 TGGGCAGGTGCTGCCTCAGCTGG - Intergenic
1010437103 6:75845167-75845189 GTGACAGGTTCTGGTTCTTCTGG + Intronic
1011018483 6:82784486-82784508 TTGACTGGTAGTGGCTCTTCTGG + Intergenic
1011231723 6:85169340-85169362 TTCTCAGATGCTGCCTCTGCAGG + Intergenic
1015786654 6:136925492-136925514 TTTACAGGTGGTCCCTCTTCTGG - Exonic
1017022724 6:150153183-150153205 GTGACAGTGGCTGCATCTTCTGG + Intronic
1018248875 6:161848099-161848121 ATGTCAGGTACCGCCTCTTCAGG + Intronic
1018692911 6:166363407-166363429 TTGACAGTGGCTGACTCTACAGG + Intergenic
1018756431 6:166853469-166853491 TGGACAGGTGGGGCCTCTCCTGG + Intronic
1019159671 6:170061371-170061393 TTGACAGCTGCTGACTGATCAGG - Intergenic
1021058548 7:16080866-16080888 TTTACAGGTGCTGCTGGTTCTGG + Intergenic
1021678255 7:23103357-23103379 TTGATAGGTGCTGACTGATCAGG - Intergenic
1022156084 7:27662970-27662992 TTGACAGGCCCTGCCGCGTCAGG - Exonic
1022637762 7:32153426-32153448 TTGACGGGTGCTGCCTCTGTAGG - Intronic
1028995247 7:97092934-97092956 TTGAAATGTGCTGCCTATTGTGG + Intergenic
1029314482 7:99699138-99699160 TTCACAGCTCCTGCCTTTTCAGG + Intronic
1029320122 7:99751598-99751620 TTCACAGCTCCTGCCTTTTCAGG + Intergenic
1029600760 7:101562123-101562145 ATGACAGGGGCTGGCTCTCCCGG + Intergenic
1032736167 7:134694484-134694506 TTGCTCGGTGCTGCCTCTCCTGG - Intergenic
1034892209 7:154851582-154851604 TTGGTAAGTGCTGCCTCTTTGGG + Intronic
1035318274 7:158011454-158011476 TAAACATGTGCTCCCTCTTCTGG - Intronic
1035819733 8:2578648-2578670 TGGACAGGTCCTGACTCTTCCGG + Intergenic
1036727858 8:11236076-11236098 TTGCCAGCTGCCACCTCTTCAGG - Intergenic
1036796887 8:11762778-11762800 GTCTCTGGTGCTGCCTCTTCAGG + Exonic
1037946522 8:22993060-22993082 CTGACTGGTGCTCCCTGTTCTGG + Intronic
1040754168 8:50750604-50750626 CTGACAGCTGCTGGCTCATCAGG - Intronic
1044370810 8:91408573-91408595 CTGACAGGCACTGCCTCTTTGGG - Intergenic
1048244606 8:132779369-132779391 TAGACAAGTGCTGCCTCAACTGG - Intronic
1048982319 8:139709411-139709433 TTGAAAGGCACTGCCTCTGCAGG + Intergenic
1049021748 8:139961749-139961771 GGGACTTGTGCTGCCTCTTCTGG + Intronic
1049300047 8:141864761-141864783 TTCACAGGTGCTGGCTGCTCAGG + Intergenic
1049353660 8:142177372-142177394 GTGACAGCGGCTGTCTCTTCAGG - Intergenic
1050464356 9:5905706-5905728 TTGCCATGTCCTGCCTTTTCAGG + Intronic
1052866610 9:33467982-33468004 TTGGCGGGTCCTGTCTCTTCGGG - Intronic
1055534526 9:77224927-77224949 TTGATAGCTGCTGACTCATCAGG - Intronic
1055650403 9:78401325-78401347 GTGTCAGTTGCTGCCTCTTGTGG + Intergenic
1056588608 9:87945686-87945708 TTGACAGATGCTGAATCTGCTGG + Intergenic
1056985846 9:91363162-91363184 TTGACAGGTTCTGGCTCTGTCGG + Intergenic
1057972660 9:99572471-99572493 TGGATAGGTGCTGCCTCCTGTGG + Intergenic
1060692534 9:125677072-125677094 TTCACAAATGCTGTCTCTTCAGG + Intronic
1185933036 X:4224361-4224383 CTGACATGTGCTCCATCTTCGGG + Intergenic
1186138703 X:6548064-6548086 TTATCAGGTGCTGTCTCTTCTGG + Intergenic
1188447933 X:30276257-30276279 TAGACAGGTGCTGTATCTTGTGG + Intergenic
1189106837 X:38245245-38245267 CTCACAGCTGCTTCCTCTTCTGG - Intronic
1190383493 X:49862256-49862278 TTGGTTAGTGCTGCCTCTTCTGG + Intergenic