ID: 1146595216

View in Genome Browser
Species Human (GRCh38)
Location 17:34162471-34162493
Sequence GTAACTCAGCCAAGATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146595216_1146595218 3 Left 1146595216 17:34162471-34162493 CCAGAGAATCTTGGCTGAGTTAC 0: 1
1: 0
2: 0
3: 11
4: 119
Right 1146595218 17:34162497-34162519 ATTTTAAAACTCCTGACTTAAGG 0: 1
1: 0
2: 3
3: 41
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146595216 Original CRISPR GTAACTCAGCCAAGATTCTC TGG (reversed) Intronic
903009145 1:20318047-20318069 GGAACTCACCCCAGAATCTCTGG - Intronic
906265209 1:44423768-44423790 GAAACTCTGCCAAGAATCCCGGG - Intronic
906502971 1:46355418-46355440 GTAACTCACCGAAACTTCTCTGG - Intronic
906620893 1:47277653-47277675 GTCACTCAGGCAAAATTCTCAGG - Intronic
906668890 1:47640728-47640750 GAATCTCAGCCAAGGCTCTCTGG - Intergenic
908256221 1:62305674-62305696 ATAACTCATCCAAGGTTCACTGG + Intronic
911352276 1:96767881-96767903 GCTACCCAGCCAAGATTTTCAGG + Intronic
911495473 1:98626042-98626064 TTAACTCAGACAAGATGTTCAGG + Intergenic
913233501 1:116761343-116761365 GAAACTCTGTCAAGATTCTCTGG - Intronic
913992640 1:143628769-143628791 GTATTTCAGACAAGACTCTCTGG + Intergenic
917385395 1:174467461-174467483 TTCACTTAGCCATGATTCTCAGG + Intronic
923490876 1:234482961-234482983 GAAACTCAACCATGATTCTGAGG - Intergenic
923494873 1:234515097-234515119 GGAACCCGGCCAAGATTATCAGG + Intergenic
923956474 1:239028125-239028147 GTAACACAGCAAGGATTCTATGG + Intergenic
1063318423 10:5029919-5029941 GAAAATCAGCTAAGAATCTCTGG - Intronic
1068234265 10:54212556-54212578 GAAACTCAGGGAAGATTTTCTGG - Intronic
1068847993 10:61702565-61702587 GTAAGTCAACCAAGACTCTAGGG + Intronic
1069676812 10:70254616-70254638 GTGACTCACCCAAGTTTCTCAGG - Exonic
1070754591 10:78984208-78984230 ATAATTCAGCTAAGATTCCCTGG + Intergenic
1072624924 10:97105084-97105106 GATACTCAGCCAAGATGCTGAGG + Intronic
1073620839 10:105046757-105046779 GTGACTCAGCCATCAATCTCAGG + Intronic
1073750605 10:106522325-106522347 TTCAGTCAGACAAGATTCTCAGG + Intergenic
1075394713 10:122118671-122118693 GTAACTCTGCTAAGATGCTGAGG + Intronic
1075860994 10:125676155-125676177 GTAACTCAACCAAGAAACACTGG - Intronic
1077244920 11:1532077-1532099 CTGACTCAACCCAGATTCTCAGG + Intergenic
1078546358 11:12249784-12249806 GGAACTGAGCCAAGATTACCAGG - Intronic
1079118066 11:17653345-17653367 GGAGCTCAGGGAAGATTCTCTGG - Intergenic
1079252752 11:18798974-18798996 GGAACTCAGCCAAAATTCTGAGG - Intergenic
1082265097 11:50109609-50109631 GTAACTCAGTCTCTATTCTCGGG - Intergenic
1083888285 11:65583388-65583410 GTCACTCAGCCAAGAGTTTTAGG + Exonic
1087611021 11:100434069-100434091 GCAATTCAGCTAAGATGCTCTGG - Intergenic
1091682753 12:2538879-2538901 GTAACACAGCCCAGTTGCTCAGG + Intronic
1092468136 12:8753178-8753200 GTAGAGCAGCCAAGAGTCTCAGG + Intronic
1092839338 12:12524180-12524202 GTAACTAAGCTCTGATTCTCTGG - Intronic
1095325337 12:40884534-40884556 GTAACTAAGACAACATTTTCAGG - Intronic
1096112353 12:49037089-49037111 GTAACATAGCCAAGTTACTCAGG - Intronic
1096904637 12:54923982-54924004 GTAAATCATCCAAGATTGGCTGG + Intergenic
1103628235 12:122237351-122237373 GTAACTCACCCAAGGTTACCTGG - Intronic
1105628145 13:22134026-22134048 GAAACTCTGCCCAGAATCTCAGG - Intergenic
1108213581 13:48161738-48161760 GTAAGTCACTCCAGATTCTCTGG + Intergenic
1108562939 13:51664569-51664591 AGAACACAGCCAGGATTCTCAGG - Intronic
1112231199 13:97590603-97590625 GTAACTCAGTAAAGTTTCTAGGG - Intergenic
1116764450 14:49053210-49053232 GTAACTTACCCAAGATCCTCTGG - Intergenic
1122734634 14:103830510-103830532 GTAACTCACCCAAGATTACAGGG + Intronic
1123106786 14:105845507-105845529 GTATCTCAGGGAAGGTTCTCTGG + Intergenic
1124497400 15:30194766-30194788 ATGACTCACCCAAGGTTCTCAGG + Intergenic
1124746173 15:32343881-32343903 ATGACTCACCCAAGGTTCTCAGG - Intergenic
1125439018 15:39681169-39681191 GTTATACAGCCAAGATTCACAGG + Intronic
1127345192 15:58088269-58088291 ATAAATGAGGCAAGATTCTCAGG - Intronic
1128527080 15:68419860-68419882 GTAACTTAGCCAAGATCACCCGG - Intronic
1202979632 15_KI270727v1_random:339528-339550 GTAACTCACCCACTACTCTCGGG - Intergenic
1132882839 16:2170069-2170091 GAAGCTCAGCCGAGGTTCTCTGG + Intronic
1135458028 16:22615859-22615881 GTAACTCTCCCAAGATTATAGGG + Intergenic
1135801564 16:25501960-25501982 GGAACTAAGCCAGGTTTCTCTGG - Intergenic
1135840280 16:25869924-25869946 GTAACTTGGCCAAGATGCACAGG + Intronic
1139626985 16:68198008-68198030 GTAACTCAGCTCAGAATTTCGGG + Intronic
1142060373 16:88025394-88025416 GTCACCCAGCCAAGATTCGAGGG + Intronic
1146595216 17:34162471-34162493 GTAACTCAGCCAAGATTCTCTGG - Intronic
1147554038 17:41465014-41465036 GAAACCCAGCCAAGATTCAGAGG + Intronic
1149068116 17:52504587-52504609 GTAAATCATCCAACCTTCTCTGG - Intergenic
1149414551 17:56445806-56445828 GTAACTCAGACAAGCCTGTCTGG - Intronic
1152262599 17:79275039-79275061 GTAGCACAGCCAAGAGTCTAAGG - Intronic
1153347462 18:4043464-4043486 TTAGCTCAGCCAAAATTCCCAGG + Intronic
1157166771 18:45364873-45364895 GTAACTCAAGCACCATTCTCTGG + Intronic
1158636338 18:59161910-59161932 GGATCTCAGCCCAGAATCTCAGG - Intergenic
1160843990 19:1158703-1158725 TTACCTCAGCCGAGGTTCTCCGG + Intronic
1163710024 19:18840853-18840875 GTAACCCAGCCGGGCTTCTCAGG + Intronic
1167527556 19:49994526-49994548 GTTTCTAAGCCAAGACTCTCAGG - Intronic
926048424 2:9727350-9727372 GTATCTCTTCAAAGATTCTCAGG - Intergenic
928808210 2:35188169-35188191 ATAGGTCAGCCAACATTCTCTGG - Intergenic
931795451 2:65704289-65704311 GAAACTCAGCCAAGATTAAATGG + Intergenic
934062499 2:88308108-88308130 TTAACTTACCCAGGATTCTCTGG - Intergenic
937732333 2:125248421-125248443 GTGAAACAGCCAAGATTATCAGG - Intergenic
942566837 2:177273597-177273619 GTAACTTGGCCAAGATTCCATGG + Intronic
945504091 2:210616297-210616319 GTAACTCAGTCTACAGTCTCGGG + Intronic
947990782 2:234485789-234485811 GTGCCTCAGCCATGTTTCTCTGG - Intergenic
948002310 2:234578239-234578261 GTGACTCAGTCAAGGTTCACTGG - Intergenic
948403820 2:237702961-237702983 GTATCTCAGCAAAGATTGTATGG + Intronic
948564560 2:238875719-238875741 GTCACTCAGCCGAGTTTCTGGGG + Intronic
1179260713 21:39756278-39756300 GAAAGACAGCAAAGATTCTCAGG - Intronic
1182022737 22:27094775-27094797 GAAACTCAGCCAAAATTCCTTGG + Intergenic
1184119755 22:42442113-42442135 GCAAGTCACCCAGGATTCTCAGG + Intergenic
950528731 3:13540164-13540186 GCAACTCAGTGAAGATACTCAGG + Intergenic
952955523 3:38555018-38555040 GTAAATCAGCCCAGATTATTTGG + Intronic
953544676 3:43855764-43855786 GTAACTCAGCCCTTCTTCTCTGG + Intergenic
954939637 3:54359803-54359825 GTAAATCATCCATGATTTTCTGG + Intronic
960210181 3:114955198-114955220 GTAACTTGTCCAAGAATCTCTGG - Intronic
963395256 3:144724342-144724364 GTAAATTAGCCAAAAGTCTCTGG + Intergenic
965026020 3:163303022-163303044 GTAACTCAGACAAGATCTTAGGG + Intergenic
966165840 3:177015453-177015475 GTATCTCACCCAAGATCATCTGG + Intergenic
966865347 3:184255792-184255814 GTGAGTCAGCCAAGAGTTTCCGG - Intronic
970528556 4:16958113-16958135 GGCCCTCAGCCAAGATTCTAGGG - Intergenic
977694595 4:99951275-99951297 GTAACTCTGACATGATTTTCAGG + Intergenic
977804681 4:101282770-101282792 GTAAATCAGCCATGTTTCTGTGG - Intronic
980032623 4:127848047-127848069 GAAAATCAGCAAAGAATCTCTGG + Intergenic
983597652 4:169489216-169489238 GTAAATCAGTTAAGATTCTTTGG + Intronic
983784335 4:171713707-171713729 GAAACTCAGCCATAATTATCTGG + Intergenic
988853729 5:35205118-35205140 GAAATTCAGCCAAGATTCACAGG + Intronic
989189444 5:38655713-38655735 TTAACTCAGTCTAGCTTCTCTGG - Intergenic
989361644 5:40608167-40608189 GTAACTCTGCCAAAATGCTTGGG + Intergenic
992091214 5:73318864-73318886 ATAAATCAGGCAAGAGTCTCTGG - Intergenic
996657536 5:125959536-125959558 AGATCTCAGCCAAGATTCTCTGG - Intergenic
998371147 5:141662184-141662206 GGAACTCAGCCAGGAGTCTCAGG + Exonic
999372854 5:151066737-151066759 GTAACTCAGCCACGATGACCCGG + Intronic
999635191 5:153614518-153614540 GTCACTCACCCAAGATTATATGG + Intronic
1001963634 5:175895230-175895252 GTCACTCAGCAAATATTCTGAGG - Intergenic
1005007936 6:21309000-21309022 GTAACTGAGGACAGATTCTCTGG - Intergenic
1007725275 6:43912365-43912387 GTAACTCATGCAAGACTCTGTGG + Intergenic
1008488823 6:52064240-52064262 GTTACTCAGCCAAGAACCACAGG - Intronic
1009567639 6:65331584-65331606 GTAATTTATCCAAGATTCTCTGG + Intronic
1009896465 6:69756674-69756696 GCAAATCAACCAAGCTTCTCTGG - Intronic
1016430154 6:143974822-143974844 GTAACTCAGTAGAGGTTCTCTGG + Intronic
1016745478 6:147574695-147574717 ATGACACAGCCAACATTCTCTGG - Intronic
1020426799 7:8076173-8076195 ATAAATCAGCCAAGATTTTATGG + Intronic
1022311828 7:29203761-29203783 GCAACTCAGCCCTGATTCTCAGG + Intronic
1022430376 7:30313664-30313686 GTAACTTAGTCCATATTCTCGGG - Intronic
1024201872 7:47116595-47116617 GTGACACAGCCAAGATCCCCAGG + Intergenic
1027262468 7:76474894-76474916 GTGCCTCAGCCACGATCCTCTGG + Intronic
1027313844 7:76972986-76973008 GTGCCTCAGCCACGATCCTCTGG + Intergenic
1039981858 8:42415097-42415119 TGAACTCAGGAAAGATTCTCTGG + Intergenic
1043834261 8:85028917-85028939 GTGAATCTGCCAAGAATCTCTGG - Intergenic
1046551022 8:115717073-115717095 GTTACTCAGCCAAGATCTTTTGG - Intronic
1047765288 8:127985475-127985497 GGAAGTCAGCCTAGCTTCTCTGG - Intergenic
1049042423 8:140122790-140122812 GTGACTCAGCCATGAGGCTCAGG + Intronic
1050574905 9:6984538-6984560 GTAACTCAACCAATAGTCCCAGG + Intronic
1059645675 9:116264443-116264465 GTAATACATCCAACATTCTCAGG + Intronic
1188011443 X:25060511-25060533 GTAACTCAGCCAATCTTGGCTGG - Intergenic
1188693415 X:33157992-33158014 GTAAATCAGGCAGGATTTTCTGG + Intronic
1189736213 X:44072379-44072401 ATAAATCAGCCAAGATTGTCAGG + Intergenic
1191906576 X:66098676-66098698 GTACTTCAGCCATCATTCTCTGG + Intergenic
1196283529 X:113852716-113852738 GAAAATCACTCAAGATTCTCTGG + Intergenic