ID: 1146597691

View in Genome Browser
Species Human (GRCh38)
Location 17:34184254-34184276
Sequence GCAAGTCCTGCTTTTCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146597680_1146597691 7 Left 1146597680 17:34184224-34184246 CCCTCAACCCCTTCTCTTTCACC No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597681_1146597691 6 Left 1146597681 17:34184225-34184247 CCTCAACCCCTTCTCTTTCACCC No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597683_1146597691 -1 Left 1146597683 17:34184232-34184254 CCCTTCTCTTTCACCCTTAGTGG No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597679_1146597691 8 Left 1146597679 17:34184223-34184245 CCCCTCAACCCCTTCTCTTTCAC No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597682_1146597691 0 Left 1146597682 17:34184231-34184253 CCCCTTCTCTTTCACCCTTAGTG No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597685_1146597691 -2 Left 1146597685 17:34184233-34184255 CCTTCTCTTTCACCCTTAGTGGC No data
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data
1146597678_1146597691 27 Left 1146597678 17:34184204-34184226 CCTGGGGCAGGGGCAAGTACCCC 0: 146
1: 46
2: 15
3: 24
4: 226
Right 1146597691 17:34184254-34184276 GCAAGTCCTGCTTTTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146597691 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG Intergenic
No off target data available for this crispr