ID: 1146601815

View in Genome Browser
Species Human (GRCh38)
Location 17:34223917-34223939
Sequence CTGTGTGAGTAATAGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601815_1146601820 11 Left 1146601815 17:34223917-34223939 CCCACTTGCTATTACTCACACAG No data
Right 1146601820 17:34223951-34223973 TAAAACTTCCTCAAGAAAACGGG No data
1146601815_1146601819 10 Left 1146601815 17:34223917-34223939 CCCACTTGCTATTACTCACACAG No data
Right 1146601819 17:34223950-34223972 ATAAAACTTCCTCAAGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601815 Original CRISPR CTGTGTGAGTAATAGCAAGT GGG (reversed) Intergenic
No off target data available for this crispr