ID: 1146601978

View in Genome Browser
Species Human (GRCh38)
Location 17:34225372-34225394
Sequence AAAGGCACCAGGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601978_1146601992 25 Left 1146601978 17:34225372-34225394 CCCTTCACCTTCCTGGTGCCTTT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601978_1146601991 24 Left 1146601978 17:34225372-34225394 CCCTTCACCTTCCTGGTGCCTTT No data
Right 1146601991 17:34225419-34225441 TTCACTATTTCTCTAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601978 Original CRISPR AAAGGCACCAGGAAGGTGAA GGG (reversed) Intergenic