ID: 1146601979

View in Genome Browser
Species Human (GRCh38)
Location 17:34225373-34225395
Sequence TAAAGGCACCAGGAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601979_1146601992 24 Left 1146601979 17:34225373-34225395 CCTTCACCTTCCTGGTGCCTTTA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601979_1146601991 23 Left 1146601979 17:34225373-34225395 CCTTCACCTTCCTGGTGCCTTTA No data
Right 1146601991 17:34225419-34225441 TTCACTATTTCTCTAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601979 Original CRISPR TAAAGGCACCAGGAAGGTGA AGG (reversed) Intergenic