ID: 1146601985

View in Genome Browser
Species Human (GRCh38)
Location 17:34225383-34225405
Sequence TGGGCCCCCTTAAAGGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601985_1146601992 14 Left 1146601985 17:34225383-34225405 CCTGGTGCCTTTAAGGGGGCCCA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601985_1146601991 13 Left 1146601985 17:34225383-34225405 CCTGGTGCCTTTAAGGGGGCCCA No data
Right 1146601991 17:34225419-34225441 TTCACTATTTCTCTAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601985 Original CRISPR TGGGCCCCCTTAAAGGCACC AGG (reversed) Intergenic