ID: 1146601985 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:34225383-34225405 |
Sequence | TGGGCCCCCTTAAAGGCACC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146601985_1146601992 | 14 | Left | 1146601985 | 17:34225383-34225405 | CCTGGTGCCTTTAAGGGGGCCCA | No data | ||
Right | 1146601992 | 17:34225420-34225442 | TCACTATTTCTCTAAGTTATGGG | No data | ||||
1146601985_1146601991 | 13 | Left | 1146601985 | 17:34225383-34225405 | CCTGGTGCCTTTAAGGGGGCCCA | No data | ||
Right | 1146601991 | 17:34225419-34225441 | TTCACTATTTCTCTAAGTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146601985 | Original CRISPR | TGGGCCCCCTTAAAGGCACC AGG (reversed) | Intergenic | ||