ID: 1146601986

View in Genome Browser
Species Human (GRCh38)
Location 17:34225390-34225412
Sequence ACAGAGGTGGGCCCCCTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601986_1146601993 24 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601993 17:34225437-34225459 TATGGGTGAATTGTCACTACAGG No data
1146601986_1146601991 6 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601991 17:34225419-34225441 TTCACTATTTCTCTAAGTTATGG No data
1146601986_1146601992 7 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601986_1146601994 25 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601986 Original CRISPR ACAGAGGTGGGCCCCCTTAA AGG (reversed) Intergenic
No off target data available for this crispr