ID: 1146601988

View in Genome Browser
Species Human (GRCh38)
Location 17:34225403-34225425
Sequence TAGTGAATCATGGACAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601988_1146601992 -6 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601988_1146601993 11 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601993 17:34225437-34225459 TATGGGTGAATTGTCACTACAGG No data
1146601988_1146601991 -7 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601991 17:34225419-34225441 TTCACTATTTCTCTAAGTTATGG No data
1146601988_1146601994 12 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601988 Original CRISPR TAGTGAATCATGGACAGAGG TGG (reversed) Intergenic