ID: 1146601992

View in Genome Browser
Species Human (GRCh38)
Location 17:34225420-34225442
Sequence TCACTATTTCTCTAAGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601979_1146601992 24 Left 1146601979 17:34225373-34225395 CCTTCACCTTCCTGGTGCCTTTA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601985_1146601992 14 Left 1146601985 17:34225383-34225405 CCTGGTGCCTTTAAGGGGGCCCA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601989_1146601992 -9 Left 1146601989 17:34225406-34225428 CCTCTGTCCATGATTCACTATTT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601987_1146601992 -5 Left 1146601987 17:34225402-34225424 CCCACCTCTGTCCATGATTCACT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601977_1146601992 26 Left 1146601977 17:34225371-34225393 CCCCTTCACCTTCCTGGTGCCTT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601978_1146601992 25 Left 1146601978 17:34225372-34225394 CCCTTCACCTTCCTGGTGCCTTT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601988_1146601992 -6 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601983_1146601992 18 Left 1146601983 17:34225379-34225401 CCTTCCTGGTGCCTTTAAGGGGG No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data
1146601986_1146601992 7 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601992 17:34225420-34225442 TCACTATTTCTCTAAGTTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601992 Original CRISPR TCACTATTTCTCTAAGTTAT GGG Intergenic
No off target data available for this crispr