ID: 1146601994

View in Genome Browser
Species Human (GRCh38)
Location 17:34225438-34225460
Sequence ATGGGTGAATTGTCACTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146601989_1146601994 9 Left 1146601989 17:34225406-34225428 CCTCTGTCCATGATTCACTATTT No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data
1146601986_1146601994 25 Left 1146601986 17:34225390-34225412 CCTTTAAGGGGGCCCACCTCTGT No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data
1146601987_1146601994 13 Left 1146601987 17:34225402-34225424 CCCACCTCTGTCCATGATTCACT No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data
1146601988_1146601994 12 Left 1146601988 17:34225403-34225425 CCACCTCTGTCCATGATTCACTA No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data
1146601990_1146601994 2 Left 1146601990 17:34225413-34225435 CCATGATTCACTATTTCTCTAAG No data
Right 1146601994 17:34225438-34225460 ATGGGTGAATTGTCACTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146601994 Original CRISPR ATGGGTGAATTGTCACTACA GGG Intergenic
No off target data available for this crispr