ID: 1146602718

View in Genome Browser
Species Human (GRCh38)
Location 17:34232732-34232754
Sequence TGTTATCTGCAGGAGTTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146602718_1146602721 2 Left 1146602718 17:34232732-34232754 CCCAGTAACTCCTGCAGATAACA No data
Right 1146602721 17:34232757-34232779 ACCATTGTAGAACCTAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146602718 Original CRISPR TGTTATCTGCAGGAGTTACT GGG (reversed) Intergenic
No off target data available for this crispr