ID: 1146603594

View in Genome Browser
Species Human (GRCh38)
Location 17:34239003-34239025
Sequence CTGGTTTTCTAGAGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146603594_1146603600 19 Left 1146603594 17:34239003-34239025 CCCTTTGTTCTCTAGAAAACCAG No data
Right 1146603600 17:34239045-34239067 GCCCCAGCCACCCACGAGAGTGG No data
1146603594_1146603609 30 Left 1146603594 17:34239003-34239025 CCCTTTGTTCTCTAGAAAACCAG No data
Right 1146603609 17:34239056-34239078 CCACGAGAGTGGGTCAAGTTGGG No data
1146603594_1146603607 29 Left 1146603594 17:34239003-34239025 CCCTTTGTTCTCTAGAAAACCAG No data
Right 1146603607 17:34239055-34239077 CCCACGAGAGTGGGTCAAGTTGG No data
1146603594_1146603602 20 Left 1146603594 17:34239003-34239025 CCCTTTGTTCTCTAGAAAACCAG No data
Right 1146603602 17:34239046-34239068 CCCCAGCCACCCACGAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146603594 Original CRISPR CTGGTTTTCTAGAGAACAAA GGG (reversed) Intergenic
No off target data available for this crispr