ID: 1146605689

View in Genome Browser
Species Human (GRCh38)
Location 17:34255712-34255734
Sequence CAGGGTAATCAAAGAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146605678_1146605689 7 Left 1146605678 17:34255682-34255704 CCCCAGCTGCTTCCAGCAGAGTT 0: 1
1: 0
2: 4
3: 14
4: 298
Right 1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 228
1146605685_1146605689 -5 Left 1146605685 17:34255694-34255716 CCAGCAGAGTTTGGGGATCAGGG 0: 1
1: 0
2: 1
3: 16
4: 212
Right 1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 228
1146605680_1146605689 5 Left 1146605680 17:34255684-34255706 CCAGCTGCTTCCAGCAGAGTTTG 0: 1
1: 1
2: 3
3: 23
4: 279
Right 1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 228
1146605677_1146605689 8 Left 1146605677 17:34255681-34255703 CCCCCAGCTGCTTCCAGCAGAGT 0: 1
1: 2
2: 1
3: 27
4: 268
Right 1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 228
1146605679_1146605689 6 Left 1146605679 17:34255683-34255705 CCCAGCTGCTTCCAGCAGAGTTT 0: 1
1: 0
2: 1
3: 26
4: 210
Right 1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG 0: 1
1: 0
2: 3
3: 28
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146605689 Original CRISPR CAGGGTAATCAAAGAGAGGG TGG Intronic
900038531 1:436015-436037 GATGGTAGTCAAACAGAGGGAGG - Intergenic
900059966 1:670994-671016 GATGGTAGTCAAACAGAGGGAGG - Intergenic
902439360 1:16419373-16419395 TAGGGTAATGAAAGAGGGAGTGG + Intronic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903365979 1:22805630-22805652 CAGGGTCAGCAAGGAGCGGGTGG + Intronic
903823545 1:26123582-26123604 CAGGGCAGGCAAAGTGAGGGTGG - Exonic
905446240 1:38030064-38030086 CAGGGTCCTCAAAGGGAGTGAGG - Intergenic
914242893 1:145863992-145864014 CAGTGTAACCAAGCAGAGGGTGG + Intergenic
915042469 1:152980694-152980716 CAAGGTGATCAGAGAAAGGGAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916502205 1:165396681-165396703 CAGGGTATACAGCGAGAGGGAGG - Intergenic
919496195 1:198271625-198271647 CAGAGTTATCAAAGAGAGATGGG - Intronic
922599566 1:226839374-226839396 CATGGTGATTAAATAGAGGGTGG + Intergenic
924855144 1:247868375-247868397 CAGGGTTATTGAAGAGATGGGGG + Intronic
1063419032 10:5896384-5896406 GAGGGTTAGCAAAGAGAGGTGGG + Intronic
1063966697 10:11351714-11351736 CAGGGCAACCAAATAGCGGGGGG + Intergenic
1065200999 10:23313043-23313065 CAGGGAAAGAGAAGAGAGGGTGG - Intronic
1065516902 10:26532808-26532830 CAGCCTAAACAAAGACAGGGAGG - Intronic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1066361192 10:34733008-34733030 GAGGGAGTTCAAAGAGAGGGTGG - Intronic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1069944947 10:71979265-71979287 CTGGATAATGAAGGAGAGGGTGG + Intronic
1070144505 10:73764004-73764026 GAGTGTAATGAAAGGGAGGGAGG + Intronic
1072318865 10:94229400-94229422 GTGGGTGATCCAAGAGAGGGAGG + Intronic
1072813514 10:98482438-98482460 CTGGGGAATCTAAGATAGGGAGG + Intronic
1076964736 11:71929-71951 GATGGTAGTCAAACAGAGGGAGG - Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079590490 11:22177344-22177366 CAGGGTATTGAAAGGAAGGGAGG - Intergenic
1079783992 11:24647849-24647871 CAGGGTATTCAAAAAGAGAGAGG - Intronic
1081614219 11:44580984-44581006 TAGGGTGATTAGAGAGAGGGAGG - Intronic
1083843247 11:65316283-65316305 CAGGGCAATCACAGAGAGCTAGG + Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1088768380 11:113008277-113008299 CAGAATAATCACAGATAGGGGGG + Intronic
1089213599 11:116822318-116822340 CAGTGGAATCAAGGGGAGGGAGG - Intronic
1089213612 11:116822393-116822415 CAGGCTCATGGAAGAGAGGGAGG - Intronic
1090721082 11:129473823-129473845 CAGAATAATCAGGGAGAGGGAGG + Intergenic
1090832687 11:130429929-130429951 CTGAGAAAGCAAAGAGAGGGGGG - Intergenic
1090948470 11:131451980-131452002 CAGGGTCATCGGAGAGCGGGAGG - Intronic
1091630209 12:2154302-2154324 AAAGGCAATCAAAGAGTGGGCGG + Intronic
1094057478 12:26281730-26281752 CCGTGTAGTCAAAGAGAGGTAGG + Intronic
1095279183 12:40330095-40330117 GAGAGTAATCAAAGAGGGCGAGG - Intronic
1095349246 12:41189100-41189122 CAGGGTAAGCAAAGGGGGGTGGG + Exonic
1096801127 12:54111231-54111253 GTGGGTAATCACAGACAGGGTGG - Intergenic
1096869512 12:54584574-54584596 CTGGGGAATAAAAGAGAGGGAGG + Intronic
1097352916 12:58568367-58568389 CAGGGTAAGTGCAGAGAGGGAGG + Intronic
1098212126 12:68177542-68177564 GAGGGTAAGAAGAGAGAGGGAGG + Intergenic
1099325998 12:81215146-81215168 CAGCATAATCAAAGCAAGGGAGG - Intronic
1099558767 12:84146859-84146881 CAGGATAATTAATGAGAGGAGGG + Intergenic
1099720318 12:86353937-86353959 CAAGGTAATCAAGAAGAGGATGG + Intronic
1100219300 12:92486704-92486726 CACGGAAATCAAAGAAAGGAAGG - Intergenic
1101499356 12:105288074-105288096 GATGGTCATCAGAGAGAGGGTGG + Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102744937 12:115242269-115242291 CTGGGAAGTCAGAGAGAGGGTGG + Intergenic
1103164178 12:118756089-118756111 CAGAGTAAGCAAGCAGAGGGTGG + Intergenic
1104725087 12:131070969-131070991 CAGGGGAATGTAAGAGAGGCTGG + Intronic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1106469411 13:30040973-30040995 CAGGGAAAACTAAGTGAGGGAGG - Intergenic
1107957784 13:45533135-45533157 CAAGGTCATCACCGAGAGGGAGG + Intronic
1108454481 13:50599175-50599197 CAGGTTAGTCAAATAAAGGGAGG - Intronic
1108478025 13:50840671-50840693 GAGGGTCAGCAAAGAGGGGGCGG + Intronic
1110873155 13:80476302-80476324 CATGATAATCAAAGTGAGGCAGG + Intergenic
1111830392 13:93322285-93322307 GAGGGTGAACAAAGAGAGAGAGG - Intronic
1111960510 13:94804892-94804914 TACGCTAATCAAAGTGAGGGTGG - Intergenic
1112091150 13:96085547-96085569 TAGAGAAATGAAAGAGAGGGAGG - Intergenic
1115241823 14:31257433-31257455 TATGGGAAGCAAAGAGAGGGTGG + Intergenic
1117732447 14:58736940-58736962 CAAGGTAATCAGAGAGAGACCGG + Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119507216 14:75183414-75183436 TAGGATAATCACAGAGAGGCAGG - Intergenic
1124887794 15:33702951-33702973 CAGGGTGAGGAAAGAGAGAGAGG + Intronic
1126160742 15:45611287-45611309 AAGGGCAATCAAAGAGAAGGTGG + Intronic
1129194454 15:73955775-73955797 CAGGGGAAGAGAAGAGAGGGAGG + Intergenic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1129805778 15:78456023-78456045 CCGAGTAATCTAAGAGAGGAAGG + Intronic
1130756333 15:86768389-86768411 AAGGGGAATCAAAGACTGGGTGG - Intronic
1131654412 15:94440764-94440786 CAGGGCAATCAGAGAGTGGGTGG + Intronic
1131684879 15:94757759-94757781 AAGTGAAATCAAAGAGAGGGTGG - Intergenic
1132443383 15:101891601-101891623 GATGGTAGTCAAACAGAGGGAGG + Intergenic
1133002018 16:2856571-2856593 CAGGGTAAGGAAAGAGGGGGAGG - Intronic
1133396814 16:5454008-5454030 AAGGGTGACTAAAGAGAGGGAGG + Intergenic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1134777963 16:16869289-16869311 CAGGGAAAGGAAAGAGAGTGAGG + Intergenic
1135031916 16:19045320-19045342 CACTGAAATCAAAGAGAGTGAGG - Exonic
1135156733 16:20059158-20059180 CGGGCTTAGCAAAGAGAGGGAGG - Intronic
1136536545 16:30902970-30902992 CAGGCAAAGCAAAGAGAGGCTGG - Exonic
1136955369 16:34778616-34778638 CAGGATCATAAAAGAAAGGGAGG + Intergenic
1137869735 16:51938451-51938473 CAGGGTAAGTAAAGAGACTGAGG - Intergenic
1138002464 16:53296045-53296067 CAGAGTAAGCAAAGAGGGAGTGG - Intronic
1138444416 16:57054669-57054691 GAGGGTAAGGAAAGGGAGGGTGG - Intronic
1138778873 16:59758366-59758388 CATTGTAATCACAGAGAGAGAGG - Intergenic
1139391301 16:66607665-66607687 GAGGGAAATCAAAGCGAGGCAGG - Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140903562 16:79392006-79392028 CAGAGTAAGGAAAGAGAGAGAGG + Intergenic
1140939656 16:79709430-79709452 CAGGGAAGTCAAGGACAGGGTGG - Intergenic
1142941048 17:3380024-3380046 CAGGCTAATCAATTAGTGGGTGG + Intergenic
1144024705 17:11267793-11267815 CAGGCTTATCTGAGAGAGGGAGG + Intronic
1146605689 17:34255712-34255734 CAGGGTAATCAAAGAGAGGGTGG + Intronic
1147620109 17:41860713-41860735 CTGGGTCATCAATGAGAAGGTGG - Intronic
1148293495 17:46478137-46478159 AAGGTTAATCAAAGAGAAGGTGG - Intergenic
1148315681 17:46695839-46695861 AAGGTTAATCAAAGAGAAGGTGG - Intronic
1148382511 17:47210114-47210136 CTGGGTAAGGAAAGAGAGAGAGG - Intronic
1152501924 17:80717838-80717860 CAGGGGAATGCAAGGGAGGGCGG - Intronic
1153752535 18:8247976-8247998 CAGGGATAGCAGAGAGAGGGCGG - Intronic
1155280078 18:24230231-24230253 CAGGACAAACAAGGAGAGGGAGG + Intronic
1155532374 18:26780361-26780383 CAGGGGAATCAAAGGTAAGGAGG - Intergenic
1156525163 18:37760223-37760245 CAGAATAATCAAGGAGAGGGAGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1158841370 18:61391909-61391931 CAGAGTAATGAAGGAGATGGAGG - Intronic
1159644661 18:70903287-70903309 CAGGGTAGTCAGATAGAAGGAGG + Intergenic
1160641541 19:141560-141582 GATGGTAGTCAAACAGAGGGAGG - Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1163267391 19:16229189-16229211 CAGGGGCATCACAGAGAGGGAGG - Intronic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1166267071 19:41690918-41690940 CAGGGCCTTCTAAGAGAGGGGGG - Intronic
1166388894 19:42397831-42397853 CAGCGTGACCAAAGACAGGGAGG + Intergenic
1166496227 19:43305103-43305125 CAACATAATGAAAGAGAGGGAGG - Intergenic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1168134278 19:54339706-54339728 CAGGGTCCTCACAGACAGGGAGG + Intergenic
925657114 2:6161740-6161762 CAGGTTTGTCAAAGATAGGGTGG - Intergenic
927787599 2:25984235-25984257 GAGCTTAATCAAGGAGAGGGTGG - Intergenic
928189915 2:29154631-29154653 CAGGGAAATCATAGAGAGGAGGG + Intronic
929943728 2:46354567-46354589 CAGGATACTCAAAGTGTGGGTGG + Intronic
930246648 2:48990430-48990452 CTGGGTTAGCAAAGATAGGGAGG - Intronic
931673376 2:64669544-64669566 CAGGATGAACAAAGATAGGGAGG + Intronic
935515902 2:104038323-104038345 GATGGTAATTAAAGAGTGGGTGG - Intergenic
939117172 2:138073589-138073611 CAGGGACACCAAAGAGAGGGAGG - Intergenic
945133609 2:206601379-206601401 CAGGGTTAACAAAGAGTGAGAGG + Intronic
946777150 2:223155291-223155313 CAGGGAAACCATAGAGAGGGGGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
1168848000 20:958615-958637 CAGGGAAGTCAGAGAGAGGGTGG + Exonic
1168958234 20:1849497-1849519 CATGGTAATCAAAAAGAGGTCGG + Intergenic
1171331092 20:24339502-24339524 CAGGGTAATAAAGGAGAGAGTGG - Intergenic
1171852895 20:30321029-30321051 GTGGGTAATCACAGACAGGGTGG - Intergenic
1173142206 20:40494337-40494359 CAGAGGAATGAAAGGGAGGGAGG - Intergenic
1173737402 20:45372122-45372144 ATGGTTAAACAAAGAGAGGGTGG + Intronic
1173873956 20:46358179-46358201 CAGGGAAACCAAGGAGAGCGGGG - Intronic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1175220654 20:57414638-57414660 CAGGGTAAGCGAAGCGATGGAGG + Intergenic
1176161274 20:63650172-63650194 GAAGGGAGTCAAAGAGAGGGAGG - Intronic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1177873888 21:26607785-26607807 GAGGGTTATCACAGGGAGGGAGG + Intergenic
1178100854 21:29267172-29267194 GCAGGTAATAAAAGAGAGGGTGG + Intronic
1179164711 21:38926348-38926370 GAGGGCAAGTAAAGAGAGGGGGG - Intergenic
1181544302 22:23592343-23592365 CAGAGTAATCAGAGAGGAGGTGG + Intergenic
1181928947 22:26383805-26383827 CAGGCTGAGCTAAGAGAGGGAGG - Intergenic
1182980813 22:34669088-34669110 CAGGGTAGATAAAGAGAGTGAGG - Intergenic
1183899479 22:40994138-40994160 CAGGGAAATGACAGAGAGGTTGG + Intergenic
949205480 3:1433175-1433197 CAGGAAAAACAGAGAGAGGGAGG - Intergenic
949762312 3:7484549-7484571 AAAGATAATCAAAGAAAGGGAGG + Intronic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
953243300 3:41168491-41168513 CAGGCAAAGCAAAGAGAAGGAGG - Intergenic
953355166 3:42249743-42249765 CAGGGAGATTACAGAGAGGGTGG + Intergenic
953856150 3:46500491-46500513 CAGGGTCCTCAAACAGAGGTTGG - Exonic
953862701 3:46558625-46558647 CAGGGAGATCACAGAGAGGGAGG - Intronic
955217726 3:56998257-56998279 CAGGGAAATCAAACAGAAAGAGG + Intronic
956233333 3:67041104-67041126 AAGTGAAATCAAAGAGAGGCTGG + Intergenic
956320792 3:67993895-67993917 CTGGTTAATCAAGGGGAGGGGGG + Intergenic
959551279 3:107661669-107661691 CAGAGAAATCACAGACAGGGAGG - Intronic
962188080 3:133281198-133281220 CAGGGCAAAAAAAGAGAGGATGG + Intronic
962925795 3:139992345-139992367 CAGGGTTATCAAAGAGAAGGAGG - Intronic
964309780 3:155380281-155380303 CAAGGGACTCAAACAGAGGGTGG - Intronic
964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG + Intergenic
965773182 3:172202204-172202226 AAGAGTCATTAAAGAGAGGGAGG - Intronic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
969091220 4:4695360-4695382 CAGGGAACTTAAAAAGAGGGAGG + Intergenic
971504872 4:27355654-27355676 CAGGGTAATCAAAGAGAAACGGG - Intergenic
972752151 4:42000922-42000944 CATGGTAAAAAAAGAGAAGGAGG + Intronic
974136798 4:57828185-57828207 CAGTGAAATCAAAGAGAGAGGGG + Intergenic
974428851 4:61770970-61770992 CAAGGTCATCAAAGAGTGAGTGG + Intronic
975165294 4:71171742-71171764 CAGAGTAATCAAGTAGATGGAGG - Intergenic
976313208 4:83633117-83633139 CTTGGTAATCAAAGAAAGAGGGG + Intergenic
976705052 4:88011404-88011426 CAGGGTATTGAAGGGGAGGGAGG - Intronic
977598428 4:98909887-98909909 CAGGGTAATCATGGAGGAGGCGG + Intronic
978619120 4:110622006-110622028 CAGGGTACGAATAGAGAGGGCGG + Intronic
982406626 4:155027513-155027535 CAGAGTGGCCAAAGAGAGGGTGG - Intergenic
985118067 4:186611539-186611561 CACGGTACTCAAACACAGGGGGG + Exonic
987039653 5:14049909-14049931 CACACTAATCAAAGAGAGTGTGG + Intergenic
992022386 5:72637215-72637237 GAGGGAAAGGAAAGAGAGGGAGG + Intergenic
995696443 5:114883525-114883547 CAGGGAAACAAAAGTGAGGGGGG + Intergenic
996916327 5:128716107-128716129 CAGGGAAATAGAATAGAGGGGGG - Intronic
1001058690 5:168470212-168470234 CAGGGTAATGTCAGAGAGGAAGG - Intronic
1002279769 5:178123476-178123498 CAGGGTAGCCAAAGGGAGTGAGG - Exonic
1002467685 5:179415996-179416018 CAGGGTCTGCAAAGAGAGGTGGG + Intergenic
1002735316 5:181382928-181382950 GATGGTAGTCAAACAGAGGGAGG + Intergenic
1002749205 6:91197-91219 GATGGTAGTCAAACAGAGGGAGG - Intergenic
1003863023 6:10339097-10339119 CAGTGTCATCAAAGAGAGGGAGG - Intergenic
1005312355 6:24570723-24570745 AAGGGACATCACAGAGAGGGAGG + Intronic
1005532620 6:26722738-26722760 CAGGGTGACTAAAGAGAGGGTGG - Intergenic
1005535784 6:26754865-26754887 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1005538175 6:26778927-26778949 CAGGGTGACTAAAGAGAGGGTGG + Intergenic
1006934882 6:37710382-37710404 CTGGGTGAGCACAGAGAGGGAGG - Intergenic
1007282068 6:40720222-40720244 CAGTGTGATCACAGAGAGAGAGG + Intergenic
1009937918 6:70255371-70255393 CAGGGTGATCAAGGACAGCGAGG - Exonic
1010628584 6:78169047-78169069 CTGGGAAATCCAAGAGACGGTGG - Intergenic
1012701001 6:102457745-102457767 CAGGTTAAACACAGAGAAGGAGG - Intergenic
1014036300 6:116770137-116770159 CAAGGTAATGAAATAGAGGGTGG - Intergenic
1015446846 6:133316060-133316082 CAGGGACATCAATGAGAAGGTGG - Intronic
1016443078 6:144104668-144104690 AAGGGTAATCAATAAAAGGGTGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017327482 6:153155929-153155951 GAGGGTAGGCAAAGAGAAGGAGG - Intergenic
1018223311 6:161603847-161603869 AAGGGAAATCCAAGAGAAGGAGG + Intronic
1019239582 6:170655242-170655264 GATGGTAGTCAAACAGAGGGAGG + Intergenic
1019608238 7:1920993-1921015 CAGGCAACCCAAAGAGAGGGTGG + Intronic
1019945670 7:4327296-4327318 CAGGGAGATCATGGAGAGGGAGG - Intergenic
1024945845 7:54806644-54806666 CTGGGGAGTCAAAGAAAGGGGGG + Intergenic
1026098947 7:67368946-67368968 CAGGGTAGAAAAAGTGAGGGAGG - Intergenic
1026820362 7:73543683-73543705 CAGGAGACTCACAGAGAGGGAGG + Intronic
1028442270 7:90877594-90877616 AAGGGTAATAAAATAGAAGGGGG - Intronic
1030440044 7:109577917-109577939 TAGGCTCATCAAAGAGTGGGAGG + Intergenic
1030907869 7:115208934-115208956 CAGGGAAGTCAAACAGGGGGAGG - Intergenic
1031068392 7:117134020-117134042 CAGGGTAATCAAAGAGGGGAAGG - Intronic
1031632117 7:124055894-124055916 CAGGGTAATTAAAAACAAGGCGG + Intergenic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1035508192 8:151365-151387 GATGGTAGTCAAACAGAGGGAGG - Intergenic
1036198950 8:6750068-6750090 GAGGGCAACAAAAGAGAGGGTGG - Intronic
1036245041 8:7108826-7108848 CAGGGAAATCTAAGGAAGGGTGG + Intergenic
1037804296 8:22050535-22050557 CGGGGAGGTCAAAGAGAGGGAGG - Intronic
1037963479 8:23116618-23116640 CTGGGTACACACAGAGAGGGAGG - Intronic
1038402855 8:27298564-27298586 CATGGGAATGAGAGAGAGGGAGG + Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040667023 8:49646170-49646192 CAAGGTTTTCAGAGAGAGGGTGG - Intergenic
1041172082 8:55153887-55153909 CAGGCAAATCAAAGATAGAGGGG + Intronic
1041825069 8:62086019-62086041 CAAGGTATTCAAACAAAGGGAGG - Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1044467078 8:92520027-92520049 CAGGTTAATCACAGACAGGCTGG - Intergenic
1045403870 8:101845807-101845829 GAGGGTAAATATAGAGAGGGTGG - Intronic
1046884641 8:119352080-119352102 CAAGGGCATCAAAGAGAGGTGGG + Intergenic
1048022291 8:130550342-130550364 CAGGGAAGTCAAATAGAAGGTGG + Intergenic
1050194428 9:3066022-3066044 CAGGGGAATCAAAGATGAGGAGG - Intergenic
1051082264 9:13307387-13307409 CAGGGAAATCAAAGAGGGGAGGG - Intergenic
1052111905 9:24596162-24596184 CAGGAAAAACAAAGAGGGGGAGG - Intergenic
1053790690 9:41684328-41684350 GTGGGTAATCACAGACAGGGTGG - Intergenic
1054154472 9:61630444-61630466 GTGGGTAATCAAAGACAGGGTGG + Intergenic
1054179038 9:61896022-61896044 GTGGGTAATCACAGACAGGGTGG - Intergenic
1054474246 9:65561564-65561586 GTGGGTAATCACAGACAGGGTGG + Intergenic
1054658500 9:67684799-67684821 GTGGGTAATCACAGACAGGGTGG + Intergenic
1055431178 9:76245831-76245853 CAGGATAATTAAAGGGAGAGAGG + Intronic
1056454176 9:86744465-86744487 CAGGGCAATCAGAGACAGCGGGG - Intergenic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1057721574 9:97535899-97535921 GAGAGAAAGCAAAGAGAGGGAGG + Intronic
1058178591 9:101768093-101768115 CATGGGAATTAAAGAGAGGCAGG + Intergenic
1058421259 9:104835450-104835472 CAGAGCAGTGAAAGAGAGGGAGG - Intronic
1060123708 9:121021174-121021196 CAGGGGATTAAAAGTGAGGGGGG + Intronic
1062534147 9:137014195-137014217 GTGGGTTATCAAAGAGGGGGCGG + Exonic
1203600238 Un_KI270748v1:6305-6327 GATGGTAGTCAAACAGAGGGAGG + Intergenic
1187278160 X:17834754-17834776 CAGGGTAAGAGAAGAGAGGTGGG + Intronic
1190260381 X:48793482-48793504 GAGGGTAATAACAGAGAAGGGGG - Intronic
1192126521 X:68505447-68505469 CAGAGTATTCAAAGAGAGTGAGG + Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1197877117 X:131122198-131122220 AAGAGAAAACAAAGAGAGGGAGG - Intergenic
1198391080 X:136174492-136174514 CTTGCTACTCAAAGAGAGGGAGG - Intronic
1198839600 X:140842068-140842090 CAGGGTAATAAAGGATAGGATGG + Intergenic
1199480736 X:148296143-148296165 CAGGGAAATAGAAGAGAGGTTGG + Intergenic
1200062395 X:153489366-153489388 CACAGTAATCACAGAGAAGGTGG - Intronic
1201620662 Y:15953554-15953576 CAAGGTAGTCAAATAGAGGATGG + Intergenic