ID: 1146612462

View in Genome Browser
Species Human (GRCh38)
Location 17:34319801-34319823
Sequence GTGGGTGTAAAGGACATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 184}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146612455_1146612462 26 Left 1146612455 17:34319752-34319774 CCTCCCATTGTTTGGGGAAATAA 0: 1
1: 0
2: 0
3: 15
4: 151
Right 1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1146612456_1146612462 23 Left 1146612456 17:34319755-34319777 CCCATTGTTTGGGGAAATAATCC 0: 1
1: 1
2: 1
3: 23
4: 177
Right 1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1146612458_1146612462 2 Left 1146612458 17:34319776-34319798 CCAGAACGAAGAACTGTTTCTCA 0: 1
1: 0
2: 2
3: 10
4: 96
Right 1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1146612454_1146612462 27 Left 1146612454 17:34319751-34319773 CCCTCCCATTGTTTGGGGAAATA 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 184
1146612457_1146612462 22 Left 1146612457 17:34319756-34319778 CCATTGTTTGGGGAAATAATCCA 0: 1
1: 0
2: 2
3: 21
4: 236
Right 1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG 0: 1
1: 0
2: 2
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146612462 Original CRISPR GTGGGTGTAAAGGACATTTC AGG Intronic
907010151 1:50955338-50955360 GGGGGTGTAAAGGAATTTCCTGG - Intronic
907371486 1:54006425-54006447 GTGGATGAAAAGGACATTCCAGG - Intergenic
908820844 1:68085019-68085041 GTGAGTCTAATGGACTTTTCTGG - Intergenic
909850456 1:80455454-80455476 GTGGGTGAAATGGACATTGAGGG + Intergenic
910058272 1:83057810-83057832 GTATGTGTAAAGCACATTGCAGG - Intergenic
912643084 1:111366035-111366057 GTTGGTGGAAAGGACATCTCAGG + Intergenic
915315207 1:155024653-155024675 GTGGGTGCAGAGGGCATTCCAGG - Intronic
916702100 1:167307779-167307801 TTTGGTGTAAGGGACATTTTGGG - Intronic
917186583 1:172363297-172363319 GTAGATGCAAAGGACATATCTGG - Intronic
921113837 1:212067294-212067316 GGGGATGTAATTGACATTTCTGG + Intronic
924027586 1:239851582-239851604 GTGGGTGTTTAATACATTTCAGG - Intronic
924198282 1:241633085-241633107 GTGGTTGTAAAGCTCATTTTGGG - Exonic
1063243852 10:4198212-4198234 GAGGGCAGAAAGGACATTTCTGG + Intergenic
1063983269 10:11473624-11473646 GTGGGTGTAATGCACAGCTCTGG + Intronic
1064065949 10:12181676-12181698 GTGCGTGCAAAGGATATATCGGG + Intronic
1065935290 10:30515584-30515606 GTGGGTGTCAAGGCCATAGCAGG + Intergenic
1068559049 10:58492140-58492162 CTGGGTTGAAAGGACATTGCTGG + Intergenic
1070268412 10:74927337-74927359 GTGGGTATAAAGAACCTCTCGGG + Intronic
1070428942 10:76316680-76316702 GTGTGTGTACATCACATTTCTGG - Intronic
1075243136 10:120796331-120796353 GTAGCTGAAAAGGACATTACTGG - Intergenic
1079155584 11:17944419-17944441 TTTGTTGTAAAGGACATTACTGG - Intronic
1080592923 11:33739182-33739204 GGTGGTGAAAAGGCCATTTCTGG - Intergenic
1081009566 11:37792205-37792227 AGGGGTGAAAAAGACATTTCAGG - Intergenic
1083637819 11:64129780-64129802 GTGGGTGTGGGGGACATCTCAGG + Intronic
1083786421 11:64950927-64950949 ATGGGTGGAAAGGGCATTTCAGG - Intronic
1085718768 11:78895544-78895566 GTGGGTGGATAGGAGATTTGAGG - Intronic
1088789960 11:113215863-113215885 GTGGATTTAATGTACATTTCAGG + Intronic
1089756260 11:120689602-120689624 ATGGCAGGAAAGGACATTTCAGG - Intronic
1090739915 11:129649802-129649824 GTGGGTATATAGGACATCTCTGG + Intergenic
1091289729 11:134431479-134431501 CTAGGTGTAAAGGACATTCCAGG + Intergenic
1091652005 12:2317809-2317831 CTGGGTGGAGAGGAGATTTCAGG + Intronic
1092159310 12:6307303-6307325 GAAGGAGGAAAGGACATTTCTGG - Intergenic
1093351611 12:18109200-18109222 GTAGATTTAGAGGACATTTCTGG + Intronic
1093572186 12:20679122-20679144 GTGGTTGCAAAGAACATTTCAGG + Intronic
1094169212 12:27474330-27474352 ATGGCTGTAAAAGACATTTGGGG - Intronic
1097426534 12:59452320-59452342 GTGGGTGAGCAGGACATTTATGG - Intergenic
1097829495 12:64208974-64208996 GTGGGTATAAAAGAAAATTCTGG - Intronic
1097954379 12:65468600-65468622 GTGGGTGTAAAGAGCTTTTATGG + Intronic
1098708462 12:73722378-73722400 GTTGGTGTATAGTACAGTTCTGG - Intergenic
1099645093 12:85342894-85342916 GTGGGTGCCAAGGAAGTTTCTGG - Intergenic
1100232045 12:92618546-92618568 ATTGGTGACAAGGACATTTCAGG + Intergenic
1100837747 12:98583169-98583191 ATGGGAGTAAAGGAGATTACTGG + Intergenic
1102945999 12:116988760-116988782 GTGGGCGTAAAGGAGGGTTCTGG - Exonic
1103975035 12:124696909-124696931 GTGGGTATAAAGGAGACTGCAGG + Intergenic
1104851670 12:131878458-131878480 TTGGGTGTAAAGGCAATGTCGGG - Intergenic
1109855267 13:68118944-68118966 ATTGGTGTAAAGAAGATTTCTGG + Intergenic
1110453967 13:75669249-75669271 GTGTGTGTAAGAGAGATTTCTGG + Intronic
1110728182 13:78850258-78850280 CTGAGTGAAAAGAACATTTCTGG + Intergenic
1111563778 13:89988318-89988340 ATGGGTGGAAAGGACATTTCTGG - Intergenic
1113130028 13:107025872-107025894 TTGGGTGTAAAAGTCATTTATGG + Intergenic
1113793101 13:113041123-113041145 CTGGGTGCGAGGGACATTTCTGG + Intronic
1120011046 14:79414710-79414732 GTGTGTGTTAAGAATATTTCAGG + Intronic
1121061966 14:90919621-90919643 GTGAGAGTAAGGGACATGTCTGG - Intronic
1126694511 15:51314642-51314664 GTGGGTAGAGAGGACATTCCAGG - Intronic
1127716165 15:61651276-61651298 GTGGGTTTCAAGGACTTTGCAGG + Intergenic
1128105397 15:65040612-65040634 GATGGTGGAAAGGACATGTCAGG - Intergenic
1128983011 15:72199920-72199942 CTGAGTGATAAGGACATTTCAGG - Intronic
1129164888 15:73771309-73771331 GAAGGTGGAAAGGACATTCCAGG - Intergenic
1130063411 15:80585674-80585696 GTGGGTGTGTAGACCATTTCTGG - Intronic
1132472300 16:112216-112238 GTGGGAAGAAAGAACATTTCTGG + Intronic
1133808691 16:9144820-9144842 CTGGGTGTTAGGGACAGTTCAGG + Intergenic
1134433392 16:14233340-14233362 GAGGGTGTAAAGCACATTTATGG + Intronic
1138086287 16:54136528-54136550 CTGGGTGTAAGGGAGATTGCTGG - Intergenic
1138115336 16:54356551-54356573 GTGGGTGGATGGAACATTTCAGG + Intergenic
1139716519 16:68817853-68817875 GTTGCTATAAAGGACATTTTTGG + Intronic
1142748830 17:1975230-1975252 GTGGGTGTTTGGGACATTTTAGG - Intronic
1142941420 17:3382705-3382727 GGGAGTGGAAAGGGCATTTCAGG - Intergenic
1144059435 17:11569320-11569342 GTGGGTGATCAGGACATCTCAGG - Intergenic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1147546652 17:41407200-41407222 GAGGGTGTACAGGAGTTTTCAGG - Intergenic
1152376293 17:79920456-79920478 GTGGGTGGCAGGGTCATTTCAGG + Intergenic
1153904454 18:9648963-9648985 TTGGGTGTTAAGGGGATTTCAGG + Intergenic
1156202957 18:34855059-34855081 GTGAGTTTTTAGGACATTTCAGG + Intronic
1156700686 18:39820830-39820852 CTGCGTGTAAAGGATACTTCTGG + Intergenic
1159243820 18:65779126-65779148 GTAGATGCAAAGGACATATCTGG + Intronic
1159287136 18:66368866-66368888 GTGGGTGTCAAGATCATTTAAGG + Intergenic
1160010485 18:75103863-75103885 GTGTGGATATAGGACATTTCAGG + Intergenic
1160135096 18:76264911-76264933 TTGGGTGAAATGGCCATTTCAGG - Intergenic
1165207233 19:34200351-34200373 GTTGGTGTGAAGAACATTTTAGG + Intronic
1165480486 19:36060652-36060674 GGGGGTGAAAAGCACATTCCTGG - Intronic
1165528612 19:36377955-36377977 GTCAGTGGACAGGACATTTCAGG + Intronic
1167768600 19:51500197-51500219 ATGGGGGTAAAGGACACTGCAGG + Exonic
925786115 2:7432362-7432384 GTGGGTGCTCAGGATATTTCCGG - Intergenic
926331900 2:11832510-11832532 GTGGATGTCAAGGGCATCTCCGG - Intergenic
931847703 2:66221810-66221832 GTGGGAATAAATGACATTTTAGG + Intergenic
932501830 2:72189108-72189130 GAGGCTATAAAGGACATTACTGG - Intronic
934031313 2:88050277-88050299 TTTGGAGTGAAGGACATTTCTGG - Intronic
938033410 2:128015369-128015391 GAGAATGTAAGGGACATTTCAGG - Intronic
943390574 2:187262331-187262353 ATGAGAGTAAAGGACATTTGTGG + Intergenic
944809599 2:203315271-203315293 GTGGGTTTAGAGAACAGTTCTGG + Intergenic
945382288 2:209155326-209155348 GTGGGTGTGAAGGACATTTGGGG - Intergenic
945496405 2:210512001-210512023 GTGGGTGGTAAGGAAATATCAGG - Intronic
946413785 2:219529247-219529269 GTGGGTGTCATGGACAGCTCAGG - Intronic
946653040 2:221914740-221914762 GTGGGTTTAAAGGCAATGTCTGG - Intergenic
947390509 2:229634854-229634876 GTGGGGGGAAAGGGCATTTCAGG - Intronic
1170609054 20:17896569-17896591 GTTGCTATAAAGGACATTACTGG + Intergenic
1170664122 20:18371362-18371384 GTGGGTGTAATGTACATATCTGG + Intergenic
1173408303 20:42786597-42786619 ATGGGGGGAAAGGACATTTCTGG - Intronic
1173415777 20:42854523-42854545 GTGGGTGCAAGGCACATGTCAGG - Intronic
1175948627 20:62570450-62570472 TTGTGAGTAATGGACATTTCAGG - Exonic
1176142569 20:63551374-63551396 GTGGCTGTAAAGAACATGTCAGG + Intronic
1177415561 21:20788620-20788642 AAGGCTGTACAGGACATTTCAGG - Intergenic
1181794951 22:25300903-25300925 CTGGGAATAAAGGAAATTTCAGG + Intergenic
1183789601 22:40055346-40055368 GTGGAGGAAAAGGGCATTTCCGG + Intronic
949142355 3:650113-650135 GCAGGTGTCAAGGACATTGCAGG - Intergenic
949284873 3:2390007-2390029 TTGGTTTTAAAGGACATTACTGG + Intronic
950107367 3:10396780-10396802 GAGGGCGAAATGGACATTTCTGG + Intronic
950258814 3:11529008-11529030 GTGGGCCTGGAGGACATTTCAGG + Intronic
951059908 3:18193361-18193383 GTGTGTGTTGAGGACTTTTCAGG + Intronic
952186346 3:30973644-30973666 ATGGGAGGAAAGGGCATTTCAGG - Intergenic
952899449 3:38099852-38099874 GTGGGTGCAAAGGAGAAATCTGG + Intronic
955802560 3:62701205-62701227 GTGGGTGTAACGGCAGTTTCTGG - Intronic
956267684 3:67415660-67415682 GTGTATATAAAGGACATTTTAGG - Intronic
956692405 3:71890320-71890342 GTGTGTGTAAAACACATTGCAGG - Intergenic
959320911 3:104874215-104874237 GGGTTTGTAAAGGACATTTTGGG + Intergenic
964452501 3:156825898-156825920 ATGGGTGTAAAGGGAAGTTCTGG - Intronic
967240763 3:187437127-187437149 GTGGGTGTTGAGGACGGTTCAGG + Intergenic
968929532 4:3571298-3571320 GTGGCTGGAAAGGACAATTTTGG + Intergenic
969945858 4:10782515-10782537 TTGGGTCTCAAGGACACTTCTGG + Intergenic
970295195 4:14622203-14622225 GTGGATTTAAAGGTCAGTTCAGG - Intergenic
970505358 4:16723745-16723767 GTGGATCTGAAGGACATTTCAGG - Intronic
971083536 4:23243892-23243914 GATGGTGTAAATCACATTTCTGG - Intergenic
972264687 4:37448001-37448023 CTGGGTGTAAAGAAGATTACAGG + Exonic
979051175 4:115934943-115934965 GTGGGTGGAAAGGAGATATGTGG + Intergenic
980179826 4:129389947-129389969 GTAGGTGTAAATCAGATTTCTGG + Intergenic
981706138 4:147661015-147661037 GTGGGTATTAAGGACATTGCTGG - Exonic
983528763 4:168787924-168787946 ATGGTTGTAAATGAGATTTCAGG + Intronic
986191487 5:5500443-5500465 ATGGATTTAAAGCACATTTCAGG - Intergenic
986317311 5:6598722-6598744 GTGACTGCAAAGGACATTACTGG + Intergenic
987186119 5:15420791-15420813 GTGGGTGCAAAGGACCCATCAGG + Intergenic
987211493 5:15688396-15688418 GTGAGTGTCAAAAACATTTCTGG + Intronic
987538782 5:19225832-19225854 GTGAGTGGAAAGGAAATTTGAGG - Intergenic
988820975 5:34885294-34885316 GGAGGTGTAAAGAACATTACTGG + Intronic
988939098 5:36123584-36123606 GTGGGTTTAAAAGACAATTGGGG + Intronic
992828875 5:80574682-80574704 GTGGGTGCAATGTACATTTTTGG + Intergenic
992901468 5:81301297-81301319 GAGGGAGTTAAGGACATTCCAGG - Intergenic
995621281 5:114028891-114028913 TTAAGTGAAAAGGACATTTCTGG + Intergenic
995842854 5:116460729-116460751 GTGGGTTTAAAGAATATTTGTGG - Intronic
997524547 5:134543970-134543992 GGAGGTGTGAAGGACAGTTCTGG + Intronic
998510847 5:142712838-142712860 GTCATTTTAAAGGACATTTCTGG + Intergenic
999872851 5:155770374-155770396 GTGGGTGGGAAGAACATTCCAGG + Intergenic
1003839317 6:10104060-10104082 GTAGGTGTTAAGGAAATATCTGG - Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005826415 6:29633632-29633654 TTGGGTGTAGAAGAGATTTCTGG + Intronic
1009864988 6:69386390-69386412 TTGTGTCTAAAGGAGATTTCTGG - Intronic
1009972502 6:70639684-70639706 GAGGGTTTAAAAGTCATTTCTGG + Intergenic
1010253996 6:73737483-73737505 GTGGTTTTAAAGAACATTTGAGG + Intronic
1011018732 6:82787440-82787462 GATGGTGTAAAGCACACTTCAGG - Intergenic
1011762569 6:90584479-90584501 GTGTGTGTTTAGGAAATTTCTGG - Intronic
1011809018 6:91108419-91108441 GTCAGTGTAGAGAACATTTCTGG + Intergenic
1012851324 6:104449176-104449198 GTGGCTGTTGAGGTCATTTCTGG - Intergenic
1013233794 6:108178843-108178865 GTGGTTGTAAATGACATTCAGGG + Intronic
1015980729 6:138835800-138835822 GTGATTATAAAGGACATTGCTGG - Intronic
1016891720 6:149014253-149014275 GTGGGTGGGAAGGTTATTTCAGG + Intronic
1018842796 6:167530571-167530593 GTGGTTGTAAAGGTAATTTCTGG + Intergenic
1019316223 7:388197-388219 GTGGCTGGAGAGGCCATTTCAGG - Intergenic
1020700571 7:11477125-11477147 CTTGCTGTAAAGGACATTTTGGG - Intronic
1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG + Intronic
1021636656 7:22700541-22700563 GAAGGTGTGAAGGACCTTTCAGG - Intergenic
1021866913 7:24967371-24967393 ATGGGAGAGAAGGACATTTCAGG - Intronic
1021982845 7:26071469-26071491 CTGGGGGTAAAGGGCATTACTGG + Intergenic
1022000910 7:26225296-26225318 GTGGGTGTACAGGGCATTCCAGG - Intergenic
1023484182 7:40666446-40666468 GTGGGTGGACAGGATATTTAGGG + Intronic
1023998267 7:45175173-45175195 GTGGGGGTCAGGGACATTCCAGG + Intronic
1026315731 7:69225583-69225605 GTATGTGAAAAGGACTTTTCAGG + Intergenic
1027821067 7:83045356-83045378 TTAAGAGTAAAGGACATTTCAGG - Intronic
1027892917 7:84000049-84000071 GTTGGTTTAAAAGACATTTTAGG + Intronic
1028169044 7:87573754-87573776 GTGGGGGTAAAGGAAATATCTGG - Intronic
1028269024 7:88764381-88764403 TTGGGTATAAAGGAAATTTTGGG + Intronic
1032899215 7:136287847-136287869 ATGGGAGGAAAGGGCATTTCAGG + Intergenic
1033046774 7:137969236-137969258 GTGGCTATAAAGGACATTTTGGG + Intronic
1034065190 7:148129432-148129454 GGGGGTGCAAAGGAACTTTCTGG + Intronic
1034111110 7:148538298-148538320 GTGGGTGAAAAGGGCATTCTAGG - Intergenic
1034334315 7:150310656-150310678 GTGGGTGTCAGGGTCAGTTCAGG - Intronic
1036798668 8:11773625-11773647 GAGGGAGGAAAGGGCATTTCAGG + Intronic
1039716133 8:40110889-40110911 TTGAGAGTAAAAGACATTTCTGG - Intergenic
1041634989 8:60132897-60132919 GGGGGTGAGAAGGACATTCCAGG - Intergenic
1043765819 8:84130971-84130993 CTGAGTGAAAAGGACATTTATGG - Intergenic
1044015694 8:87046836-87046858 GTGGGCGAAAAGGAGATGTCTGG - Intronic
1044024416 8:87150846-87150868 GTGCTTGAGAAGGACATTTCTGG + Intronic
1044387446 8:91606182-91606204 GTGGTTGATAAGGACTTTTCTGG + Intergenic
1045535420 8:103022746-103022768 GTGAGTGAAAAGAACATTCCAGG + Intronic
1047345867 8:124027860-124027882 GTGGGTTTAAAAGCCATTTTAGG - Intronic
1050308228 9:4327621-4327643 GTGGGTCTGAAGGTCCTTTCCGG - Intronic
1052149572 9:25098020-25098042 GTGGGTGTAATAGACACTGCTGG - Intergenic
1054460747 9:65461168-65461190 GTGGCTGGAAAGGACAATTTTGG - Intergenic
1056096767 9:83262729-83262751 CTGGGTGCAGAGGACATTCCAGG - Intronic
1057012366 9:91616335-91616357 TTGGCTATAAAGGACATTACTGG + Intronic
1058143995 9:101390348-101390370 GTGGGTTTAGAGAACAGTTCTGG + Exonic
1058415095 9:104779081-104779103 GTGGGTGCGAAGGATATTCCCGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1060624974 9:125103488-125103510 TGGGATGTAAAAGACATTTCTGG - Intronic
1060870098 9:127033127-127033149 GAGGGTGTGAAGGACATGGCAGG + Intronic
1061707575 9:132464660-132464682 GTGAGTGTAAAGTACACTCCAGG - Intronic
1062462854 9:136669107-136669129 GTGGGCATACAGGACATTTCAGG - Intronic
1186071858 X:5829690-5829712 GTGGCTGTGAAGGACTTTTGTGG + Intergenic
1189755955 X:44271549-44271571 GCTGGTGTAAATGACCTTTCAGG - Intronic
1190036955 X:47034274-47034296 GTGGGTATAGAGGATCTTTCTGG - Intronic
1190124770 X:47694100-47694122 GTAGGTATAAAGGACAATTTGGG + Intergenic
1193166095 X:78282142-78282164 GAAGGAGGAAAGGACATTTCAGG - Intronic
1196961982 X:121013758-121013780 GTGGTTGTAATATACATTTCTGG + Intergenic
1197686803 X:129448608-129448630 GTGGGGGTAAATGTCATTTATGG + Intronic
1202129742 Y:21598812-21598834 GTGGATGTAATGGAAATTTATGG + Intergenic
1202183017 Y:22155700-22155722 GTGGCTGTAATGGAAATTTATGG + Intergenic
1202208342 Y:22430701-22430723 GTGGCTGTAATGGAAATTTATGG - Intergenic