ID: 1146615393

View in Genome Browser
Species Human (GRCh38)
Location 17:34353096-34353118
Sequence GATTGAAGGGAGTGTCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146615393_1146615402 16 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615402 17:34353135-34353157 TTTTGATGAGTTGTGGGAGGAGG No data
1146615393_1146615399 9 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615399 17:34353128-34353150 GGAAATGTTTTGATGAGTTGTGG No data
1146615393_1146615404 21 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615404 17:34353140-34353162 ATGAGTTGTGGGAGGAGGGCAGG No data
1146615393_1146615403 17 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615403 17:34353136-34353158 TTTGATGAGTTGTGGGAGGAGGG No data
1146615393_1146615401 13 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615393_1146615400 10 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615400 17:34353129-34353151 GAAATGTTTTGATGAGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146615393 Original CRISPR GATTGAAGGGAGTGTCCCCC TGG (reversed) Intergenic
No off target data available for this crispr