ID: 1146615397

View in Genome Browser
Species Human (GRCh38)
Location 17:34353110-34353132
Sequence TTTCCTAATACCTGGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146615397_1146615401 -1 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615397_1146615405 29 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615405 17:34353162-34353184 GATGCTTAAGAGCTCTGTAGTGG No data
1146615397_1146615402 2 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615402 17:34353135-34353157 TTTTGATGAGTTGTGGGAGGAGG No data
1146615397_1146615399 -5 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615399 17:34353128-34353150 GGAAATGTTTTGATGAGTTGTGG No data
1146615397_1146615400 -4 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615400 17:34353129-34353151 GAAATGTTTTGATGAGTTGTGGG No data
1146615397_1146615403 3 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615403 17:34353136-34353158 TTTGATGAGTTGTGGGAGGAGGG No data
1146615397_1146615404 7 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615404 17:34353140-34353162 ATGAGTTGTGGGAGGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146615397 Original CRISPR TTTCCTAATACCTGGATTGA AGG (reversed) Intergenic
No off target data available for this crispr