ID: 1146615401

View in Genome Browser
Species Human (GRCh38)
Location 17:34353132-34353154
Sequence ATGTTTTGATGAGTTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146615392_1146615401 14 Left 1146615392 17:34353095-34353117 CCCAGGGGGACACTCCCTTCAAT No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615396_1146615401 0 Left 1146615396 17:34353109-34353131 CCCTTCAATCCAGGTATTAGGAA No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615398_1146615401 -9 Left 1146615398 17:34353118-34353140 CCAGGTATTAGGAAATGTTTTGA No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615393_1146615401 13 Left 1146615393 17:34353096-34353118 CCAGGGGGACACTCCCTTCAATC No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data
1146615397_1146615401 -1 Left 1146615397 17:34353110-34353132 CCTTCAATCCAGGTATTAGGAAA No data
Right 1146615401 17:34353132-34353154 ATGTTTTGATGAGTTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146615401 Original CRISPR ATGTTTTGATGAGTTGTGGG AGG Intergenic
No off target data available for this crispr